-
Aiko Amagai
[show abstract]
[hide abstract]
ABSTRACT: A novel and critical function of ethylene, a potent plant hormone, has been well documented in Dictyostelium, because it leads cells to the sexual development (macrocyst formation) by inducing zygote formation. Zygote formation (sexual cell fusion) and the subsequent nuclear fusion are the characteristic events occurring during macrocyst formation. A novel gene, zyg1 was found to be predominantly expressed during the sexual development, and its enforced expression actually induces zygote formation. As expected, the zygote inducer, ethylene enhances the expression of zyg1. Thus the function of ethylene has been verified at all of individual (macrocyst formation), cellular (zygote formation), and molecular levels (zyg1 expression). Based on our recent studies concerning the behavior and function of the zyg1 product (ZYG1 protein), the signal transduction pathways involved in zygote formation are proposed in this review.
Embryologia 05/2011; 53(4):617-23. · 2.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We have previously reported that benzohydroxamic acid (BHAM), a potent inhibitor of cyanide (CN)-resistant respiration mediated by alternative oxidase (AOX), induces formation of unique cell masses (i.e., stalk-like cells with a large vacuole and thick cell wall) in starved Dictyostelium cells. Unexpectedly, however, aox-null cells prepared by homologous recombination exhibited normal development under normal culture conditions on agar, indicating that BHAM-induced stalk formation is not solely attributable to inhibition of CN-resistant respiration. This also suggests that a series of pharmacological approaches in the field of life science has serious limitations. Under stress (e.g., in submerged culture), starved aox-null cells exhibited slightly delayed aggregation compared with parental Ax-2 cells; most cells remained as loose aggregates even after prolonged incubation. Also, the developmental defects of aox-null cells became more marked upon incubation for 30 min just after starvation in the presence of ≥ 1.75 mmol/L H(2)O(2). This seems to indicate that CN-resistant respiration could mitigate cellular damage through reactive oxygen species (ROS), because AOX has a potential role in reduction of ROS production. Starved aox-null cells did not develop in the presence of 5 mmol/L KCN (which completely inhibited the conventional cytochrome-mediated respiration) and remained as non-aggregated single cells on agar even after prolonged incubation. Somewhat surprisingly, however, parental Ax-2 cells were found to develop normally, forming fruiting bodies even in the presence of 10 mmol/L KCN. Taken together, these results suggest that CN-resistant respiration might compensate for the production of adenosine tri-phosphate via oxidative phosphorylation.
Embryologia 09/2010; 52(7):645-56. · 2.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We have previously shown that in Dictyostelium cells a 32 kDa protein is rapidly and completely dephosphorylated in response to starvation that is essential for the initiation of differentiation (Akiyama & Maeda 1992). In the present work, this phosphoprotein was identified as a homologue (Dd-RPS6) of ribosomal protein S6 (RPS6) that is an essential member for protein synthesis. As expected, Dd-RPS6 seems to be absolutely required for cell survival, because we failed to obtain antisense-RNA mediated cells as well as Dd-rps6-null cells by homologous recombination in spite of many trials. In many kinds of cell lines, RPS6 is known to be located in the nucleus and cytosol, but Dd-RPS6 is predominantly located in the cell cortex with cytoskeletons, and in the contractile ring of just-dividing cells. In this connection, the overexpression of Dd-RPS6 greatly impairs cytokinesis during axenic shake-cultures in growth medium, resulting in the formation of multinucleate cells. Much severe impairment of cytokinesis was observed when Dd-RPS6-overexpressing cells (Dd-RPS6(OE) cells) were incubated on a living Escherichia coli lawn. The initiation of differentiation triggered by starvation was also delayed in Dd-RPS6(OE) cells. In addition, Dd-RPS6(OE) cells exhibit defective differentiation into prespore cells and spores during late development. Thus, it is likely that the proper expression of Dd-RPS6 may be of importance for the normal progression of late differentiation as well as for the initiation of differentiation.
Embryologia 08/2009; 51(6):533-46. · 2.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Folic acid (folate; vitamin Bc) is well recognized as essential for the proper metabolism of the essential amino acid methionine as well as for the synthesis of adenine and thymine. A folate deficiency has been Implicated in a wide variety of disorders from Alzheimer's disease to depression and neural tube defects. In the cellular slime molds, including Dictyostelium, vegetative growth-phase cells are known to chemotactically move toward folate that is secreted by bacterial food sources such as Escherichia coli. Intracellular folate signal transductlon, including G proteins, Ca(2+)channels, and the PIP3 pathway, has been reported in D. discoideum. To our surprise, the genuine chemoattractant(s) of free-living protozoan amoebae have remained to be determined, possibly because of lack of a pertinent method for assaying chemotaxis. We recently isolated a primitive free-living amoeba from the soil of Costa Rica and identified it as a new species of the genus Vahlkampfia belonging to Subclass Gymnamoebia, which includes Entamoeba and Acanthamoeba. The amoebae can grow and multiply quite rapidly, engulfing nearby bacteria such as E. coli. Importantly, we have demonstrated here using a quite simple but finely designed chemotaxis assay that the Vahlkampfia amoebae exhibit chemotaxis toward higher folate concentrations. Riboflavin and cyanocobalamin were also found to serve as positive chemoattractants. Among these chemoattractants, folate is of particular importance because its function seems to be evolutionarily conserved as a potent chemoattractant of amoeboid cells in a wide range of organisms as well as in the Protista and cellular slime molds.
ZOOLOGICAL SCIENCE 04/2009; 26(3):179-86. · 0.95 Impact Factor
-
Aiko Amagai
[show abstract]
[hide abstract]
ABSTRACT: The cellular slime mold, Dictyostelium mucoroides-7 (Dm7) exhibits clear dimorphism; macrocyst formation as a sexual process and sorocap formation as an asexual process. These two life cycles are regulated by two regulators, ethylene and cyclic AMP (cAMP). This is the first report demonstrating a novel function of ethylene at the cellular level. That is, ethylene induces a zygote formed by cell fusion and subsequent nuclear fusion. Recently, the function of ethylene at the molecular level has been clarified as it induces zygote formation through an enhanced expression of a novel gene, zyg1. The signaling pathway for induction or inhibition of zygote formation is now trying to be clarified focusing on the ZYG1 protein.
Gene regulation and systems biology 01/2009; 3:21-30.
-
[show abstract]
[hide abstract]
ABSTRACT: When nutrients are depleted, Dictyostelium cells undergo cell cycle arrest and initiate a differentiation program for survival. We have found a novel gene, srsA, which is rapidly expressed in the first 5 min following the removal of nutrients and is turned off within an hour. This gene encodes a small protein with no significant similarity to previously characterized proteins. Disruption of srsA results in delayed expression of the early genes acaA and carA that encode adenylyl cyclase and the cAMP receptor necessary for chemotactic aggregation, respectively. Streaming is delayed several hours and the aggregates are larger than normal in the mutant strains. These phenotypes are cell-autonomous. Overexpression of srsA also results in delayed aggregation. Some of the slugs of the srsA(OE) strains showed stalked migration reminiscent of the slugs of the related species Dictyostelium mucoroides. The terminal structures formed by srsA(OE) cells were grossly abnormal and contained very few viable spores. When cells overexpressing srsA were developed together with an excess of wild-type cells, the fruiting bodies were still abnormal, indicating that the mutant cells have a dominant effect on late development. These findings suggest that srsA may be involved in both the starvation response and late differentiation.
Differentiation 08/2008; 76(10):1093-103. · 2.81 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The novel gene dia2 (differentiation-associated gene 2) was originally isolated as a gene expressed specifically in response to initial differentiation of Dictyostelium discoideum Ax-2 cells. Using dia2(AS) cells in which the dia2 expression was inactivated by the antisense RNA method, DIA2 protein was found to be required for cAMP signaling during cell aggregation. During late development, the DIA2 protein changed its location from the endoplasmic reticulum (ER) to prespore-specific vacuoles (PSVs) that are specifically present in prespore cells of the slug. In differentiating prestalk cells, however, DIA2 was found to be nearly lost from the cells. Importantly, exocytosis of PSVs from prespore cells and the subsequent spore differentiation were almost completely impaired in dia2(AS) cells. In addition, spore induction by externally applied 8-bromo cAMP was significantly suppressed in dia2(AS) cells. Taken together, these results strongly suggested that DIA2 might be closely involved in cAMP signaling and spore differentiation as well as in the initiation of differentiation during Dictyostelium development.
Differentiation 04/2008; 76(3):310-22. · 2.81 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Disruption of mitochondrial genes may become a powerful tool for elucidating precisely the functions of individual mitochondrial genes. However, it is generally difficult to manipulate genetically mitochondrial genes, because 1) a mitochondrion is surrounded by inner and outer membranes, and 2) there are a large number of mtDNA copies in a single cell. This is the reason why we tried to establish a novel method for disrupting a certain mitochondrial gene (rps4), using Dictyostelium cells.
Here, we have developed a new method for specifically disrupting a mitochondrial gene (rps4 ; ribosomal protein subunit S4), by a combination of homologous recombination and delivery of an appropriate restriction endonuclease (SfoI) into mitochondria. First, mitochondrially targeted SfoI whose expression is under control of the tetracycline (Tet)-regulated gene expression system was introduced into cells heteroplasmic with respect to the rps4 gene. Then, the heteroplasmic cells were produced by homologous recombination by use of the construct in which the unique SfoI site and the 5'-half of the rps4 coding region were deleted not to be digested by SfoI, and therefore their mitochondria have both the wild-type mtDNA and the mutant mtDNA with the disrupted rps4 gene. In response to removal of Tet from growth medium, SfoI was selectively delivered into mitochondria and digested only the wild-type mtDNA but not the mutated rps4. Thus one can gain rps4-null cells with only the mutated mtDNA, under the Tet-minus condition.
The mitochondrial gene-disruption method presented here must be widely useful for precisely determining the functions of individual mitochondrial genes. This is the first report to demonstrate complete and specific mitochondrial gene disruption.
BMC Genetics 02/2008; 9:25. · 2.47 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Polypeptide elongation factor 2 (EF-2) plays an essential role in protein synthesis and is believed to be indispensable for cell proliferation. Recently, it has been demonstrated that there are two kinds of EF-2 (EF-2A and EF-2B with 76.6% of sequence identity at the amino acid level) in Dictyostelium discoideum. Although the knockout of EF-2A slightly impaired cytokinesis, EF-2A null cells exhibited almost normal protein synthesis and cell growth, suggesting that there is another molecule capable of compensating for EF-2 function. Since EF-2B is the most likely candidate, we examined its function using ef-2b knockdown cells prepared by the RNAi method. Our results strongly suggest that EF-2B is required for protein synthesis and cell proliferation, functioning as the real EF-2. Interestingly, the expressions of ef-2a and ef-2b mRNAs during development are reversely regulated, and the ef-2b expression is greatly augmented in ef-2a null cells.
Biochemical and Biophysical Research Communications 09/2007; 359(3):586-91. · 2.48 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We have previously demonstrated that a potent plant hormone, ethylene induces sexual development including zygote formation in Dictyostelium cells, and that a novel gene (zyg1) is also involved in zygote formation. Based on these findings, the present work was mainly designed to reveal (1) the precise relationship between the ethylene amount and zygote formation, and (2) the relation of in situ ethylene synthesis to zyg1 expression, using transformants that over- or under-produce ACC-oxidase (Dd-aco) involved in ethylene biosynthesis. ACO(OE) cells overexpressing Dd-aco gene overproduced ethylene and exhibited the augmented zygote formation. In contrast, ACO-RNAi cells, in which the expression of Dd-aco was suppressed by the RNAi method, showed a reduced level of ethylene production, thus resulting in inhibition of zygote formation. Importantly, the expression of zyg1 was affected by the amount of ethylene produced: Zyg1 expression was augmented in ACO(OE) cells, but was significantly suppressed in ACO-RNAi cells. In another experiment, we found that 1-methylcyclopropene (1-MCP), which is known to inhibit the function of ethylene by binding specifically to ethylene receptors, greatly suppresses zygote formation. These results indicate that ethylene is capable of inducing zygote formation through the expression of zyg1.
Experimental Cell Research 08/2007; 313(11):2493-503. · 3.58 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.
Eukaryotic Cell 09/2005; 4(8):1477-82. · 3.60 Impact Factor
-
Aiko Amagai
[show abstract]
[hide abstract]
ABSTRACT: Dictyostelium mucoroides-7 (Dm7) and a mutant (MF1) derived from it exhibit homothallic macrocyst formation in the sexual process. As previously shown, the zygote formation during macrocyst formation is induced by a potent plant hormone, ethylene. The present work was undertaken to know if ethylene is also involved in heterothallic and homothallic macrocyst formation in D. discoideum. In heterothallic macrocyst formation between NC4 and V12M2 cells, ethionine, an analogue of methionine, inhibits macrocyst formation through arresting specifically the acquisition process of fusion competence. Such an inhibitory effect of ethionine was almost completely cancelled by co-application of ACC (1-aminocyclopropane-1-carboxylic acid), the immediate precursor of ethylene. Essentially the same effects of ethionine and ACC were also noticed on homothallic macrocyst formation in D. discoideum AC4. Thus it seems most likely that ethylene is required for the acquisition of fusion competence during macrocyst formation, and that in a variety of strains examined there is a common mechanism regulated by ethylene, beyond the difference of sexual modes.
Embryologia 04/2005; 34(3):293 - 299. · 2.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: TRAP1 (tumor necrosis factor receptor-associated protein 1) is a member of the molecular chaperone HSP90 (90-kDa heat shock protein) family. In this study, we mainly examined the behavior of Dictyostelium TRAP1 homologue, Dd-TRAP1, during Dictyostelium development by immunoelectron microscopy. In vegetatively growing D. discoideum Ax-2 cells, Dd-TRAP1 locates in nucleolus and vesicles in addition to the cell cortex including cell membrane. Many of Dd-TRAP1 molecules moved to the mitochondrial matrix in response to differentiation, although Dd-TRAP1 on the cell membrane seems to be retained. Some Dd-TRAP1 was also found to be secreted to locate outside the cell membrane in Ax-2 cells starved for 6 h. At the multicellular slug stage, Dd-TRAP1 was primarily located in mitochondria and cell membrane in both prestalk and prespore cells. More importantly, in differentiating prespore cells, a significant number of Dd-TRAP1 locates in the PSV (prespore-specific vacuole) that is a sole cell type-specific organelle and essential for spore wall formation, whereas some Dd-TRAP1 in the cell cortical region of prestalk cells. These findings strongly suggest the importance of Dd-TRAP1 regulated temporally and spatially during Dictyostelium development. Incidentally, we also have certified that the glucose-regulated protein 94 (Dd-GRP94) is predominantly located in Golgi vesicles and cisternae, followed by its colocalization with Dd-TRAP1 in the PSV.
Experimental Cell Research 03/2005; 303(2):415-24. · 3.58 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Dd-TRAP1 is a Dictyostelium homologue of tumor necrosis factor receptor-associated protein 1 (TRAP-1). Dd-TRAP1 is located in the cortex of cells growing at a low density, but was found to be translocated to mitochondria with the help of a novel prestarvation factor that was accumulated in growth medium along with increased cell densities. The knockdown mutant of Dd-TRAP1 (TRAP1-RNAi cells) exhibited a significant defect in prestarvation response. Although TRAP1-RNAi cells showed normal expressions of classical prestarvation genes [dscA (discoidin I) and car1 (carA; cAMP receptor)], the expression of differentiation-associated genes (dia1 and dia3) induced by the prestarvation response were markedly repressed. By contrast, transformants overexpressing Dd-TRAP1 showed an early prestarvation response and also increased expression of dia1 and dia3 in a cell-density-dependent manner. Importantly, introduction of Dd-TRAP1 antibody into D. discoideum Ax-2 cells by electroporation inhibited the translocation of Dd-TRAP1 from the cortex to mitochondria and greatly inhibited the initiation of differentiation. Taken together, these results indicate that Dd-TRAP1 is translocated to mitochondria by sensing the cell density in growth medium and enhances the early developmental program through a novel prestarvation response.
Journal of Cell Science 12/2004; 117(Pt 24):5759-70. · 6.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Most unexpectedly, there is now increasing evidence that mitochondria have novel and crucial functions in the regulatory machinery of the growth/differentiation transition, cell-type determination, cellular movement and pattern formation. Here we created rho delta cells with a reduced amount (about 1/4) of mitochondrial DNA (mtDNA) from Dictyostelium discoideum Ax-2 cells, by exposing Ax-2 cells to ca. 30 microg/ml of ethidium bromide (EtBr) in axenic growth medium. Importantly, the rho delta cells exhibited a series of fascinating behaviors: when they were starved, they showed a marked delay of differentiation and stopped their development at the slug stage, thus failing to construct fruiting bodies. Moreover, cell patterning and cell-type proportioning were found to be greatly modified in slugs (referred to as rho delta slugs) derived from rho delta cells. That is, prestalk differentiation was significantly enhanced in rho delta slugs, while prespore differentiation was markedly inhibited. In addition, the clear anterior prestalk/posterior prespore pattern was considerably disturbed in rho delta slugs, presumably because of incomplete sorting between the two types of differentiated cells. After the assay of phototaxis, rho delta slugs also exhibited highly disordered movement towards the light source. Taken together, these results suggest that mtDNA might have important multiple functions in a variety of cellular processes during Dictyostelium development.
Journal of Cell Science 08/2004; 117(Pt 15):3141-52. · 6.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Cellular slime molds are fascinating to the field of developmental biology, and have long been used as excellent model organisms for the study of various aspects of multicellular development. We have recently isolated alpha-pyronoids, named dictyopyrones A-D (1-4), from various species of Dictyostelium cellular slime molds, and it was shown that compound 3 may regulate Dictyostelium development. In this study, we synthesized dictyopyrones A-D (1-4) and their analogues, investigated the physiological role of the molecules in cell growth and morphogenesis in D. discoideum, and further verified their effects on human leukemia K562 cells. Nitrogen-containing compounds 22 and 37 strongly inhibited cell growth in K562 leukemia cells, indicating that these compounds may be utilized as novel lead compounds for anti-leukemic agents.
Bioorganic & Medicinal Chemistry 07/2004; 12(12):3203-14. · 2.92 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Certain proteins encoded by mitochondrial DNA (mt-DNA), including mt-ribosomal protein S4 (rps4), appear to play important roles in the initiation of cell differentiation. Partial disruption of rps4 in Dictyostelium discoideum Ax-2 cells by means of homologous recombination greatly impairs the progression of differentiation, while the the rps4(OE) cells in which the rps4 mRNA was overexpressed in the extra-mitochondrial cytoplasm exhibit enhanced differentiation (Inazu et al., 1999). We have prepared a specific anti-RPS4 antibody and generated transformants (rps4(AS) cells) by antisense-mediated gene inactivation of rps4. Surprisingly, in the rps4(AS) cells the progress of differentiation was found to be markedly inhibited, suggesting that the antisense rps4 RNA synthesized in the extra-mitochondrial cytoplasm might be as effective as the partial disruption of rps4 gene. Immunostaining of the rps4(OE) cells with the anti-RPS4 antibody demonstrated that the RPS4 protein synthesized in the extra-mitochondrial cytoplasm is capable of moving to the nucleus, as predicted by PSORTII. Taken together with the results obtained using immunostained Ax-2 cells, we propose a possible pathway of RPS4 translocation coupled with differentiation.
ZOOLOGICAL SCIENCE 01/2004; 20(12):1455-65. · 0.95 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Evidence has been obtained indicating that the cell's position in the cell cycle at the onset of starvation is a naturally occurring variable closely involved in the subsequent sorting and pattern formation during the development of Dictyostelium discoideum Ax2. It is of interest to know whether a similar phenomenon is also noticed in species other than D. discoideum and also without any treatment of cells for cell synchronization. For this, the sorting behavior of D. mucoroides-7 (Dm7) cells and its relation to the cell-cycle phase at the onset of starvation were analyzed, using non-synchronized Dm7 cells pulse-labeled with 5′-bromo-2-deoxyuridine (BrdU). The results demonstrate that Dm7 cells starved at the early G2 phase aggregate most rapidly, but are eventually sorted out to the posterior prespore zone of migrating slugs. In contrast, cells starved at the mid late G2 phase exhibited slower aggregation, but were sorted out to the anterior zone (tip), this being basically similar to the sorting behavior of D. discoideum cells. Measurements of cell numbers and nuclearity provided evidence that approximately 80% of cells progressed their cell-cycle after the formation of multicellular structures (mounds), probably coupling with prespore differentiation as in the case of D. discoideum. Thus, cell cycle-dependent sorting during Dictyostelium development is most likely to be a common phenomenon in different species.
Embryologia 10/2003; 38(1):33 - 40. · 2.21 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: EF-2 is believed to be indispensable for polypeptide chain elongation in protein synthesis and therefore for cell proliferation. Surprisingly, we could isolate ef2 null cells from Dictyostelium discoideum that exhibited almost normal growth and protein synthesis, which suggests that there is another molecule capable of compensating for EF-2 function. The knock-out of Dictyostelium EF-2 (Dd-EF2H; 101 kDa phosphoprotein) impairs cytokinesis, resulting in formation of multinucleate cells. The initiation of differentiation, including the acquisition of aggregation competence, was delayed in Dd-ef2 null cells compared with that in wild-type. By contrast, Dd-ef2 overexpression enhanced the progression of differentiation, thus indicating a positive involvement of Dd-EF2H in growth/differentiation transition.
Journal of Cell Science 08/2003; 116(Pt 13):2647-54. · 6.11 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Dd-TRAP1 is a Dictyostelium homologue of TRAP-1, a human protein that binds to the type 1 tumor necrosis factor (TNF) receptor. TRAP-1 has a putative mitochondrial localization sequence and shows significant homology to members of the HSP90 family. Although TRAP-1 is mainly localized to mitochondria in several mammalian cells, in certain tissues it is also localized at specific extramitochondrial sites. In Dictyostelium cells, Dd-TRAP1 is predominantly located in the cell membrane/cortex during growth and just after starvation. Double staining of vegetatively growing cells with the anti-Dd-TRAP1 antibody and TRITC-phalloidin has demonstrated colocalization of Dd-TRAP1 and F-actin at the leading edge of cortical protrusions such as pseudopodes. Coupled with differentiation, however, Dd-TRAP1 located at the cortical region is translocated to mitochondria in spite of the absence of the mitochondrial localization sequence at its N-terminus. The translocation of this protein raises interesting and fundamental questions regarding possible mechanisms by which Dd-TRAP1 is involved in cellular differentiation.
Experimental Cell Research 11/2002; 280(1):45-54. · 3.58 Impact Factor