Yan-Yu Zhang

Academy of Military Medical Sciences, Tianjin, Tianjin Shi, China

Are you Yan-Yu Zhang?

Claim your profile

Publications (4)1.59 Total impact

  • Article: [Infection of the mononuclear cell subpopulations in murine bone marrow with murine cytomegalovirus].
    [show abstract] [hide abstract]
    ABSTRACT: This study was aimed to explore the infection characteristics of murine mononuclear cell subpopulations in bone marrow with murine cytomegalovirus (MCMV). Subpopulations of mononuclear cells, including lin(+), lin(-), lin(-)CD117(+) and lin(-)CD117(-) cells, were infected with MCMV after being separated by MACS, and induced to differentiation by adding cytokines or inducer, then nucleic acid and proteins were detected. The results indicated that the MCMV DNA, IE transcrip and IE protein could be detected in the lin(+) cells infected with MCMV; no virus products were detected in infected lin(-) cells without adding any stimulating factors, while IE and E transcrips and proteins were detected after adding GM-CSF, rhEPO or phorbol ester in the lin(-) cells infected with MCMV. Furthermore, no IE or E gene transcrips were detected in the lin(-)CD117(+) and lin(-)CD117(-) cells, but the cell colony formation of lin(-)CD117(+) hematopoietic stem and progenitor cells was inhibited after MCMV infection and expression of CD117 antigen on cell surface of the lin(-) cells was downregulated. It is concluded that MCMV can latently infect subpopulations of mononuclear cells in the murine bone marrow. Cells which are of characteristics of primitive stem and progenitor cells are not susceptible to MCMV, but infection of these cells with MCMV can inhibit functions of cells and downregulate the expression of antigen on cells surface.
    Zhongguo shi yan xue ye xue za zhi / Zhongguo bing li sheng li xue hui = Journal of experimental hematology / Chinese Association of Pathophysiology 10/2011; 19(5):1218-23.
  • Article: Human cytomegalovirus-encoded chemokine receptor homolog US28 stimulates the major immediate early gene promoter/enhancer via the induction of CREB.
    [show abstract] [hide abstract]
    ABSTRACT: The major immediate early (MIE) gene of cytomegalovirus plays a key role in determining the activation and replication of cytomegalovirus, which represents the most important event signaling the onset of virus-induced disease relapse. The viral-encoded chemokine receptor homolog US28 can constitutively activate many cellular transcription factors, which can bind to the promoter/enhancer of the MIE gene and activate its transcription. Using reporter gene assays in HEK293 cells, we found that US28 enhanced the transcription efficiency of MIE and other genes via cAMP response element-binding protein (CREB). Inhibition of CREB partially blocked the effect of US28, whereas forskolin enhanced this effect. There was a direct correlation between CREB and transcription of MIE gene. These data, together with the broad-spectrum effect of cellular transcription factors, suggest that US28 may be involved in the very early transcription of the host cell during virus activation.
    Journal of Receptor and Signal Transduction Research 09/2009; 29(5):266-73. · 1.59 Impact Factor
  • Article: [Human cytomegalovirus-encoded US28 stimulates the CREB related transcriptional activity].
    [show abstract] [hide abstract]
    ABSTRACT: To observe the effect of the human cytomegalovirus(HCMV)-encoded chemokine receptor homolog US28 on the human transcription factor CREB related transcriptional activity. The US28 gene was cloned from DNA of HCMV-infected fibroblast at 72 h post infection. The amplified gene fragment was subsequently cloned into pcDNA3.1 eukaryotic expression vector. The recombinant plasmid was selected and identified by sequence analysis. US28-pcDNA3.1 was added to the Dual-Luciferase Reporter Assay System. The immunoreactive bands of phospho-CREB(p-CREB)and luminescence values were observed. The constructed recombinant vector was verified by PCR analysis and DNA sequencing. US28 enhanced the transcriptional efficiency of CRE driving gene via p-CREB. HCMV could enhance the transcriptional activity of CRE driving gene via p-CREB. CREB might be involved in the very early reprogramming of the host cell during virus activation.
    Xi bao yu fen zi mian yi xue za zhi = Chinese journal of cellular and molecular immunology 06/2009; 25(5):385-8.
  • Article: [Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].
    [show abstract] [hide abstract]
    ABSTRACT: The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.
    Zhongguo shi yan xue ye xue za zhi / Zhongguo bing li sheng li xue hui = Journal of experimental hematology / Chinese Association of Pathophysiology 09/2005; 13(4):542-7.