-
[show abstract]
[hide abstract]
ABSTRACT: The gene 5 protein (g5p) encoded by the Ff strains of Escherichia coli bacteriophages is a dimeric single-stranded DNA-binding protein (SSB) that consists of two identical OB-fold (oligonucleotide/oligosaccharide-binding) motifs. Ultrafast time-resolved fluorescence measurements were carried out to investigate the effect of g5p binding on the conformation of 2-aminopurine (2AP) labels positioned between adenines or cytosines in the 16-nucleotide antiparallel tails of DNA hairpins. The measurements revealed significant changes in the conformational heterogeneity of the 2AP labels caused by g5p binding. The extent of the changes was dependent on sub-binding-site location, but generally resulted in base unstacking. When bound by g5p, the unstacked 2AP population increased from ∼22% to 59-67% in C-2AP-C segments and from 39% to 77% in an A-2AP-A segment. The OB-fold RPA70A domain of the human replication protein A also caused a significant amount of base unstacking at various locations within the DNA binding site as evidenced by steady-state fluorescence titration measurements using 2AP-labeled 5-mer DNAs. These solution studies support the concept that base unstacking at most of a protein's multiple sub-binding-site loci may be a feature that allows non-sequence specific OB-fold proteins to bind to single-stranded DNAs (ssDNAs) with minimal preference for particular sequences. © 2013 Wiley Periodicals, Inc. Biopolymers 99: 484-496, 2013.
Biopolymers 07/2013; 99(7):484-96. · 2.87 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Gene 5 protein (g5p) is a dimeric single-stranded DNA-binding protein encoded by Ff strains of Escherichia coli bacteriophages. The 2-fold rotationally symmetric binding sites of a g5p dimer each bind to four nucleotides, and the dimers bind with high cooperativity to saturate antiparallel single-stranded DNA (ssDNA) strands. Ultrafast time-resolved fluorescence spectroscopies were used to investigate the conformational heterogeneity and dynamics of fluorescent 2-aminopurine (2AP) labels sequestered by bound g5p. The 2AP labels were positioned within the noncomplementary antiparallel tail sequences of d(AC)(8) or d(AC)(9) of hairpin constructs so that each fluorescent label could probe a different subsite location within the DNA-binding site of g5p. Circular dichroism and isothermal calorimetric titrations yielded binding stoichiometries of approximately six dimers per oligomer hairpin when tails were of these lengths. Mobility shift assays demonstrated the formation of a single type of g5p-saturated complex. Femtosecond time-resolved fluorescence spectroscopy showed that the 2AP in the free (non-protein-bound) DNAs had similar heterogeneous distributions of conformations. However, there were significant changes, dominated by a large increase in the population of unstacked bases from ~22 to 59-68%, depending on their subsite locations, when the oligomers were saturated with g5p. Anisotropy data indicated that 2AP in the bound state was less flexible than in the free oligomer. A control oligomer was labeled with 2AP in the loop of the hairpin and showed no significant change in its base stacking upon g5p binding. A proposed model summarizes the data.
Biochemistry 09/2011; 50(42):8989-9001. · 3.42 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The enumeration of tetrameric and other sequence motifs that are positively or negatively correlated with in vivo antisense DNA effects has been a useful addition to the arsenal of information needed to predict effective targets for antisense DNA control of gene expression. Such retrospective information derived from in vivo cellular experiments characterizes aspects of the sequence dependence of antisense inhibition that are not predicted by nearest-neighbor (NN) thermodynamic parameters derived from in vitro experiments. However, quantitation of the antisense contributions of motifs is problematic, since individual motifs are not isolated from the effects of neighboring nucleotides, and motifs may be overlapping. These problems are circumvented by a next-nearest-neighbor (NNN) analysis of antisense DNA effects in which the overlapping nature of nearest-neighbors is taken into account.
Next-nearest-neighbor triplet combinations of nucleotides are the simplest that include overlapping sequence effects and therefore can encompass interactions beyond those of nearest neighbors. We used singular value decomposition (SVD) to fit experimental data from our laboratory in which phosphorothioate-modified antisense DNAs (S-DNAs) 20 nucleotides long were used to inhibit cellular protein expression in 112 experiments involving four gene targets and two cell lines. Data were fitted using a NNN model, neglecting end effects, to derive NNN inhibition parameters that could be combined to give parameters for a set of 49 sequences that represents the inhibitory effects of all possible overlapping triplet interactions in the cellular targets of these antisense S-DNAs. We also show that parameters to describe subsets of the data, such as the mRNAs being targeted and the cell lines used, can be included in such a derivation. While NNN triplet parameters provided an adequate model to fit our data, NN doublet parameters did not.
The methodology presented illustrates how NNN antisense inhibitory information can be derived from in vivo cellular experiments. Subsequent calculations of the antisense inhibitory parameters for any mRNA target sequence automatically take into account the effects of all possible overlapping combinations of nearest-neighbors in the sequence. This procedure is more robust than the tallying of tetrameric motifs that have positive or negative antisense effects. The specific parameters derived in this work are limited in their applicability by the relatively small database of experiments that was used in their derivation.
BMC Bioinformatics 01/2010; 11:252. · 2.75 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Noncanonical DNA structures such as G-quadruplexes might obstruct the binding of hRPA, compromising the accuracy of replication, and be a source of genomic instability. In this study, circular dichroism (CD) and electrophoretic mobility shift assay (EMSA) experiments were used to show that hRPA can bind and melt nontelomeric, intramolecular DNA G-quadruplexes under physiologically germane conditions. EMSA results show that hRPA binds to a 58-mer that includes an embedded quadruplex with an affinity equal to or greater than to nonquadruplex forming 58-mers. Moreover, hRPA binds to a 26-mer purine-rich quadruplex-forming sequence with an affinity indistinguishable from that for binding to the complementary pyrimidine-rich sequence. Under the same conditions, hRPA does not have significant affinity for binding to the duplex formed from the two sequences. Thus, DNA secondary structures can significantly modulate the binding affinity of hRPA over and above its known preference for pyrimidine-rich single-stranded sequences, so that at least some intramolecular G-quadruplex structures may not inhibit hRPA binding during DNA replication. CD spectral changes in combination with EMSA titrations suggest that one hRPA heterotrimer is sufficient to form a stable complex with an unfolded 26-mer G-quadruplex prior to the binding of a second hRPA molecule.
Biochemistry 03/2009; 48(5):1099-111. · 3.42 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Circular dichroism (CD) spectroscopy is widely used to characterize the structures of DNA G-quadruplexes. CD bands at 200-300 nm have been empirically related to G-quadruplexes having parallel or antiparallel sugar-phosphate backbones. We propose that a more fundamental interpretation of the origin of the CD bands is in the stacking interactions of neighboring G-quartets, which can have the same or opposing polarities of hydrogen bond acceptors and donors. From an empirical summation of CD spectra of the d(G)5 G-quadruplex and of the thrombin binding aptamer that have neighboring G-quartets with the same and opposite polarities, respectively, the spectra of aptamers selected by the Ff gene 5 protein (g5p) appear to arise from a combination of the two types of polarities of neighboring G-quartets. The aptamer CD spectra resemble the spectrum of d(G3T4G3), in which two adjacent quartets have the same and two have opposite polarities. Quantum-chemical spectral calculations were performed using a matrix method, based on guanine chromophores oriented as in d(G3T4G3). The calculations show that the two types of G-quartet stacks have CD spectra with features resembling experimental spectra of the corresponding types of G-quadruplexes.
Chirality 04/2008; 20(3-4):431-40. · 2.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The circular dichroism (CD) spectra of single-stranded DNAs (ssDNAs) are significantly perturbed by the binding of single-stranded DNA binding proteins such as the Ff bacteriophage gene 5 protein (g5p) and the A domain of the 70 kDa subunit of human replication protein A (RPA70-A). These two proteins have similar OB-fold secondary structures, although their CD spectra at wavelengths below 250 nm differ greatly. The spectrum of g5p is dominated by a tyrosyl L(a) band at 229 nm, while that of RPA70-A is dominated by its beta secondary structure. Despite differences in their inherent spectral properties, these two proteins similarly perturb the spectra of bound nucleic acid oligomers. CD spectra of free, non-protein-bound ssDNAs are dependent on interactions of the nearest-neighboring nucleotides in the sequence. The CD spectra (per mol of nucleotide) of simple repetitive sequences 48 nucleotides in length and containing simple combinations of A and C are related by nearest-neighbor equations. For example, 3 x Deltaepsilon[d(AAC)(16)] = 3 x Deltaepsilon[d(ACC)(16)] + Deltaepsilon[d(A)(48)] - Deltaepsilon[d(C)(48)]. Moreover, nearest-neighbor equations relate the spectra of ssDNAs when they are bound by g5p, indicating that each type of perturbed nearest neighbor has a similar average structure within the binding site of the protein.
Chirality 06/2006; 18(5):370-82. · 2.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.
Biochemistry 04/2004; 43(9):2622-34. · 3.42 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Single-stranded DNA or RNA libraries used in SELEX experiments usually include primer-annealing sequences for PCR amplification. In genomic SELEX, these fixed sequences may form base pairs with the central genomic fragments and interfere with the binding of target molecules to the genomic sequences. In this study, a method has been developed to circumvent these artificial effects. Primer-annealing sequences are removed from the genomic library before selection with the target protein and are then regenerated to allow amplification of the selected genomic fragments. A key step in the regeneration of primer-annealing sequences is to employ thermal cycles of hybridization-extension, using the sequences from unselected pools as templates. The genomic library was derived from the bacteriophage fd, and the gene 5 protein (g5p) from the phage was used as a target protein. After four rounds of primer-free genomic SELEX, most cloned sequences overlapped at a segment within gene 6 of the viral genome. This sequence segment was pyrimidine-rich and contained no stable secondary structures. Compared with a neighboring genomic fragment, a representative sequence from the family of selected sequences had about 23-fold higher g5p-binding affinity. Results from primer-free genomic SELEX were compared with the results from two other genomic SELEX protocols.
Nucleic Acids Research 02/2004; 32(22):e182. · 8.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Antisense oligodeoxynucleotides (ODNs) have biological activity in treating various forms of cancer. The antisense effects of two types of 20mer ODNs, phosphorothioate-modified ODNs (S-ODNs) and S-ODNs with 12 2'-O-methyl groups (Me-S-ODNs), targeted to sites 109 and 277 of bcl-2 mRNA, were compared. Both types were at least as effective as G3139 (Genta, Inc.) in reducing the level of Bcl-2 protein in T24 cells following a 4 h transfection at a dose of 0.1 micro M. Circular dichroism spectra showed that both types formed A-form duplexes with the complementary RNA, and the melting temperatures were in the order of Me-S-ODN.RNA > normal DNA.RNA > S-ODN.RNA. In comparison with the S-ODN, the Me-S-ODN had reduced toxic growth inhibitory effects, was less prone to bind the DNA-binding domain A of human replication protein A, and was as resistant to serum nucleases. Neither type of oligomer induced apoptosis, according to a PARP-cleavage assay. Hybrids formed with Me-S-ODN sequences were less sensitive to RNase H degradation than those formed with S-ODN sequences. Despite this latter disadvantage, the addition of 2'-O-methyl groups to a phosphorothioate-modified ODN is advantageous because of increased stability of binding and reduced non-specific effects.
Nucleic Acids Research 01/2004; 32(6):2008-16. · 8.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The gene 5 protein (g5p) from Ff filamentous virus is a model single-stranded DNA (ssDNA) binding protein that has an oligonucleotide/oligosaccharide binding (OB)-fold structure and binding properties in common with other ssDNA-binding proteins. In the present work, we use circular dichroism (CD) spectroscopy to analyze the effects of amino acid substitutions on the binding of g5p to double-stranded DNA (dsDNA) compared to its binding to ssDNA. CD titrations of poly[d(A). d(T)] with mutants of each of the five tyrosines of the g5p showed that the 229-nm CD band of Tyr34, a tyrosine at the interface of adjacent protein dimers, is reversed in sign upon binding to the dsDNA, poly[d(A). d(T)]. This effect is like that previously found for g5p binding to ssDNAs, suggesting there are similarities in the protein-protein interactions when g5p binds to dsDNA and ssDNA. However, there are differences, and the possible perturbation of a second tyrosine, Tyr41, in the complex with dsDNA. Three mutant proteins (Y26F, Y34F, and Y41H) reduced the melting temperature of poly[d(A). d(T)] by 67 degrees C, but the wild-type g5p only reduced it by 2 degrees C. This enhanced ability of the mutants to denature dsDNA suggests that their binding affinities to dsDNA are reduced more than are their binding affinities to ssDNA. Finally, we present evidence that when poly[d(A). d(T)] is melted in the presence of the wild-type, Y26F, or Y34F proteins, the poly[d(A)] and poly[d(T)] strands are separately sequestered such that renaturation of the duplex is facilitated in 2 mM Na(+).
Biopolymers 01/2004; 70(4):637-48. · 2.87 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Two sets of 20-mer phosphorothioate-modified oligodeoxynucleotide DNAs (sODN) and 21-mer or 22-mer small interfering RNAs (siRNAs), targeted to the same coding sites in raf-1 mRNA, were compared for their abilities to reduce the amount of endogenously expressed Raf-1 protein in T24 cells. The amount of Raf-1 protein was monitored by careful quantitation of Western blots. We found that the siRNAs were somewhat less effective than the S-ODNs in reducing the Raf-1 protein level 20 hours after a 4-hour transfection. The siRNA duplexes were characterized by circular dichroism (CD) spectra, and melting temperatures (Tm) were obtained for the siRNA duplexes and DNA x RNA hybrids formed by the S-ODNs. The S-ODNs differed in their effectiveness, the S-ODN that formed the more stable hybrid being the more effective in reducing the Raf-1 protein level, but the two siRNAs were equally effective despite a difference in Tm of about 20 degrees C. Finally, the siRNAs and S-ODNs had a comparable nonspecific effect on a nontargeted (Bcl-2) protein. Our data add to others in the literature that show it can be difficult to select siRNAs that are more effective than antisense ODNs in downregulating endogenously expressed proteins.
Oligonucleotides 02/2003; 13(5):313-24. · 2.80 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The Ff gene 5 protein (g5p) is classified as a single-stranded DNA-binding protein. However, we previously showed that g5p binds with high affinity to a SELEX-selected G-rich 58-mer DNA oligomer, I-3, that forms an intramolecular G-quadruplex [Wen, J.-D., Gray, C. W., and Gray, D. M. (2001) Biochemistry 40, 9300-9310]. In 200 mM NaCl at 37 degrees C, g5p binds to I-3 in two stages, the first stage being the formation of a discrete intermediate complex that appears to be a precursor to a saturated g5p x I-3 complex. For the present paper, CD spectroscopy and DMS methylation techniques were used to investigate the binding of g5p to the I-3 oligomer and to the truncated 26-nucleotide core of the I-3 oligomer. The core sequence, called I-3c26, was d(GGGGTCAGGCTGGGGTTGTGCAGGTC). Results were the following: (1) The g5p binds in one stage to I-3c26 in 200 mM NaCl at 37 degrees C. (2) The intermediate complex of g5p.I-3 is formed by the binding of g5p to the core sequence. (3) G-quadruplex structures are maintained in both the g5p x I-3 and g5p x I-3c26 complexes, but the bound G-quadruplex structures are altered from their respective steady-state folded forms in 200 mM NaCl. (4) CD kinetics measurements showed that the I-3c26 quadruplex folds in two stages and that a transiently folded form is apparently the same as the altered structure to which g5p binds. (5) DMS methylation protection and interference experiments identified two guanines that are differentially involved in the steady-state folded and g5p-bound G-quadruplex structures. A model for a possible I-3c26 G-quadruplex structure is described.
Biochemistry 10/2002; 41(38):11438-48. · 3.42 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The assembly and stability of the RNA polymerase II transcription preinitiation complex on a eukaryotic core promoter involves the effects of TFIIA on the interaction between TATA-binding protein (TBP) and DNA. To extend our understanding of these interactions, we characterized properties of ALF, a germ cell-specific TFIIA-like factor. ALF was able to stabilize the binding of TBP to DNA, but it could not stabilize TBP mutants A184E, N189E, E191R, and R205E nor could it facilitate binding of the TBP-like factor TRF2/TLF to a consensus TATA element. However, phosphorylation of ALF with casein kinase II resulted in the partial restoration of complex formation using mutant TBPs. Studies of ALF-TBP complexes formed on the Adenovirus Major Late (AdML) promoter revealed protection of the TATA box and upstream sequences from -38 to -20 (top strand) and -40 to -22 (bottom strand). The half-life and apparent K(D) of this complex was determined to be 650 min and 4.8 +/- 2.7 nm, respectively. The presence of ALF or TFIIA did not significantly alter the ability of TBP to bind TATA elements from several testis-specific genes. Finally, analysis of the distinct, nonhomologous internal regions of ALF and TFIIAalpha/beta using circular dichroism spectroscopy provided the first evidence to suggest that these domains are unordered, a result consistent with other genetic and biochemical properties. Overall, the results show that while the sequence and regulation of the ALF gene are distinct from its somatic cell counterpart TFIIAalpha/beta, the TFIIAgamma-dependent interactions of these factors with TBP are nearly indistinguishable in vitro. Thus, a role for ALF in the assembly and stabilization of initiation complexes in germ cells is likely to be similar or identical to the role of TFIIA in somatic cells.
Journal of Biological Chemistry 10/2002; 277(37):34208-16. · 4.77 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The gene 5 protein (g5p) of the Ff virus contains five Tyr, individual mutants of which have now all been characterized by CD spectroscopy. The protein has a dominant tyrosyl 229-nm L(a) CD band that is shown to be approximately the sum of the five individual Tyr contributions. Tyr41 is particularly important in contributing to the high cooperativity with which the g5p binds to ssDNA, and Y41F and Y41H mutants are known to differ in dimer-dimer packing interactions in crystal structures. We compared the solution structures and binding properties of the Y41F and Y41H mutants using CD spectroscopy. Secondary structures of the mutants were similar by CD analyses and close to those derived from the crystal structures. However, there were significant differences in the binding properties of the two mutant proteins. The Y41H protein had an especially low binding affinity and perturbed the spectrum of poly[d(A)] in 2 mM Na(+) much less than did Y41F and the wild-type gene 5 proteins. Moreover, a change in the Tyr 229 nm band, assigned to the perturbation of Tyr34 at the dimer-dimer interface, was absent in titrations with the Y41H mutant under low salt conditions. In contrast, titrations with the Y41H mutant in 50 mM Na(+) exhibited typical CD changes of both the nucleic acid and the Tyr 229-nm band. Thus, protein-protein and g5p-ssDNA interactions appeared to be mutually influenced by ionic strength, indicative of correlated changes in the ssDNA binding and cooperativity loops of the protein or of indirect structural constraints.
Protein Science 04/2002; 11(3):601-13. · 2.80 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: One of the problems that hamper the use of antisense DNAs as effective drugs is the non-specific binding of chemically-modified oligonucleotides to cellular proteins. We previously showed that the affinity of a model ssDNA-binding protein, the Ff gene 5 protein (g5p), was >300-fold higher for phosphorothioate-modified DNA (S-DNA) than for unmodified dA(36), consistent with the propensity of S-DNA to bind indiscriminately to proteins. The current work shows that g5p binding is also sensitive to sugar and pyrimidine modifications used in antisense oligomers. Binding affinities of g5p for 10 36mer oligomers were quantitated using solution circular dichroism measurements. The oligomers contained C-5-propyne (prC), 2'-O-methyl (2'-O-Me) or 2'-OH (RNA) groups, alone or combined with the phosphorothioate modification. In agreement with reported increases in antisense activity, the addition of prC or 2'-O-Me modifications substantially reduced the affinity of oligomers for g5p by approximately 2-fold compared with the same DNA oligomer sequences containing only phosphorothioate linkages. That is, such modifications moderated the propensity of the phosphorothioate group to bind tightly to the g5p. The Ff g5p could be a useful model protein for assessing non-specific binding effects of antisense oligomer modifications.
Nucleic Acids Research 03/2002; 30(3):749-58. · 8.03 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: We review CD studies of a single-stranded DNA binding protein, g5p, of the Ff group of bacterial viruses. The CD spectrum of the g5p is dominated by a positive tyrosine La band at 229 nm, to which all five of the protein tyrosines contribute. The La band becomes much less positive upon binding of g5p to nucleic acids. CD spectra of mutant proteins identified a single tyrosine, Y34, that is largely responsible for this CD perturbation. At >250 nm, CD perturbations of nucleic acids can be monitored during g5p binding, and CD titrations have identified two distinct modes of binding of the g5p at physiological ionic strength (0.2 M NaCl). SELEX selection of sequences bound preferentially by g5p yielded a G-rich sequence that is closely related to telomere sequences and has CD properties of a G-tetraplex. CD spectroscopy showed that the presumed G-quadruplex form is maintained within saturated g5p x DNA complexes.
Enantiomer A Journal of Stereochemistry 7(2-3):49-58.