Donald M. Gray

University of Texas at Dallas, Dallas, TX, United States

Are you Donald M. Gray?

Claim your profile

Publications (12)52.46 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: The gene 5 protein (g5p) of Ff bacteriophages is a well-studied model ssDNA-binding protein that binds cooperatively to the Ff ssDNA genome and single-stranded polynucleotides. Its affinity, K omega (the intrinsic binding constant times a cooperativity factor), can differ by several orders of magnitude for ssDNAs of different nearest-neighbor base compositions [Mou, T. C., Gray, C. W., and Gray, D. M. (1999) Biophys. J. 76, 1537-1551]. We found that the DNA backbone can also dramatically affect the binding affinity. The K omega for binding phosphorothioate-modified S-d(A)(36) was >300-fold higher than for binding unmodified P-d(A)(36) at 0.2 M NaCl. CD titrations showed that g5p bound phosphorothioate-modified oligomers with the same stoichiometry as unmodified oligomers. The CD spectrum of S-d(A)(36) underwent the same qualitative change upon protein binding as did the spectrum of unmodified DNA, and the phosphorothioate-modified DNA appeared to bind in the normal g5p binding site. Oligomers of d(A)(36) with different proportions of phosphorothioate nucleotides had binding affinities and CD perturbations intermediate to those of the fully modified and unmodified sequences. The influence of phosphorothioation on binding affinity was nearly proportional to the extent of the modification, with a small nearest-neighbor dependence. These and other results using d(ACC)(12) oligomers and mutant proteins indicated that the increased binding affinity of g5p for phosphorothioate DNA was not a polyelectrolyte effect and probably was not an effect due to the altered nucleic acid structure, but was more likely a general effect of the properties of the sulfur in the context of the phosphorothioate group.
    Biochemistry 02/2001; 40(7):2267-75. · 3.19 Impact Factor
  • Source
    T C Mou, Carla W. Gray, Donald M. Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The Ff gene 5 protein (g5p) is considered to be a nonspecific single-stranded DNA binding protein, because it binds cooperatively to and saturates the Ff bacteriophage single-stranded DNA genome and other single-stranded polynucleotides. However, the binding affinity Komega (the intrinsic binding constant times a cooperativity factor) differs by over an order of magnitude for binding to single-stranded polynucleotides such as poly[d(A)] and poly[d(C)]. A polynucleotide that is more stacked, like poly[d(A)], binds more weakly than one that is less stacked, like poly[d(C)]. To test the hypothesis that DNA base stacking, a nearest-neighbor property, is involved in the binding affinity of the Ff g5p for different DNA sequences, Komega values were determined as a function of NaCl concentration for binding to six synthetic sequences 48 nucleotides in length: dA48, dC48, d(AAC)16, d(ACC)16, d(AACC)12, and d(AAACC)9A3. The binding affinities of the protein for these sequences were indeed found to be related to the nearest-neighbor compositions of the sequences, rather than to simple base compositions. That is, the g5p binding site, which is spanned by four nucleotides, discriminates among these sequences on the basis of the relative numbers of nearest neighbors (AA, CC, and AC plus CA) in the sequence. The results support the hypothesis that the extent of base stacking/unstacking of the free, nonbound ssDNA plays an important role in the binding affinity of the Ff gene 5 protein.
    Biophysical Journal 04/1999; 76(3):1537-51. · 3.83 Impact Factor
  • Vincent P. Antao, Donald M. Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: CD spectra were used to compare the acid-induced structural transitions of poly[d(A)] and poly[d(C)] with those of poly[r(A)] and poly[r(C)], respectively. The types of base pairing were probably the same in the acid self-complexes of both A-containing polymers and in the acid self-complexes of both C-containing polymers. Similar base pairings were indicated by similarities in the difference CD spectra showing the changes during the first major acid-induced transitions of the polymers. Information from the CD spectra and pKa values of the transitions suggested that the transitions for the RNA polymers involved similar structural changes. The two DNA polymers were markedly different. Single-stranded poly[d(A)] was in the most stacked structure and had the lowest pKa for forming an acid self-complex. Single-stranded poly[d(C)] was in the least stacked structure and had the highest pKa for forming a protonated duplex.
    Journal of biomolecular Structure & Dynamics 05/1993; 10(5):819-39. · 2.98 Impact Factor
  • Kenneth H. Johnson, Donald M. Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.
    Journal of biomolecular Structure & Dynamics 03/1992; 9(4):733-45. · 2.98 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Helical complexes formed between fd DNA and reductively methylated fd gene 5 protein were indistinguishable by electron microscopy from complexes formed with the nonmethylated protein. 13C NMR spectroscopy of 13C-enriched N epsilon, N epsilon-dimethyllsyl residues of the protein showed that three of these residues (Lys-24, Lys-46, and Lys-69) were selectively perturbed by binding of the oligomer d(pA)7. These were the same lysyl residues that we previously found to be most protected from methylation by binding of the protein to poly[r(U)] [Dick, L. R., Sherry, A. D., Newkirk, M. M., & Gray D. M. (1988) J. Biol. Chem. 263, 18864-18872]. Thus, these lysines are probably directly involved in the nucleic acid binding function of the protein. Negatively charged chelates of lanthanide ions were used to perturb the 13C NMR resonances of labeled lysyl and amino-terminal residues of the gene 5 protein. The terbium chelate was found to bind tightly (Ka approximately 10(5) M-1) to the protein with a stoichiometry of 1 chelate molecule per protein dimer. 13C resonances of Lys-24, Lys-46, and Lys-69 were maximally shifted by the terbium chelate and were maximally relaxed by the gadolinium chelate. Also, the terbium chelate was excluded by the oligomer d(pA)7. Computer fits of the induced chemical shifts of 13C resonances with those expected for various positions of the terbium chelate failed to yield a possible chelate binding site unless the chemical shift for Lys-24 was excluded from the fitting process.(ABSTRACT TRUNCATED AT 250 WORDS)
    Biochemistry 09/1989; 28(19):7896-904. · 3.19 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: CD spectra and difference-CD spectra of (a) two DNA X RNA hybrid duplexes (poly[r(A) X d(U)] and poly[r(A) X d(T)]) and (b) three hybrid triplexes (poly-[d(T) X r(A) X d(T)], poly[r(U) X d(A) X r(U)], and poly[r(T) X d(A) X r(T)]) were obtained and compared with CD spectra of six A X U- and A X T-containing duplex and triplex RNAs and DNAs. We found that the CD spectra of the homopolymer duplexes above 260 nm were correlated with the type of base pair present (A-U or A-T) and could be interpreted as the sum of the CD contributions of the single strands plus a contribution due to base pairing. The spectra of the duplexes below 235 nm were related to the polypurine strands present (poly-[r(A)] or poly[d(A)]). We interpret the CD intensity in the intermediate 255-235 nm region of these spectra to be mainly due to stacking of the constituent polypurine strands. Three of the five hybrids (poly[r(A) X d(U)], poly[r(A) X d(T)], and poly[d(T) X r(A) X d(T)]) were found to have heteronomous conformations, while poly[r(U) X d(A) X r(U)] was found to be the most A-like and poly[r(T) X d(A) X r(T)], the least A-like.
    Nucleic Acids Research 01/1987; 14(24):10071-90. · 8.81 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Circular dichroism measurements were used to study the binding of fd gene 5 protein to fd DNA, to six polydeoxynucleotides (poly[d(A)], poly[d(T)], poly[d(I)], poly[d(C)], poly[d(A-T)], and the random copolymer poly[d(A,T)]), and to three oligodeoxynucleotides (d(pA)20, d(pA)7, and d(pT)7). Titrations of these DNAs with fd gene 5 protein were generally done in a low ionic strength buffer (5 mM Tris-HCl, pH 7.0 or 7.8) to insure tight binding, needed to obtain stoichiometric endpoints. By monitoring the CD of the nucleic acids above 250 nm, where the protein has no significant intrinsic optical activity, we found that there were two modes of binding, with the number of nucleotides covered by a gene 5 protein monomer (n) being close to either 4 or 3. These stoichiometries depended upon which polymer was titrated as well as upon the protein concentration. Single endpoints at nucleotide/protein molar ratios close to 3 were found during titrations of poly[d(T)] and fd DNA (giving n = 3.1 and 2.8 +/- 0.2, respectively), while CD changes with two apparent endpoints at nucleotide/protein molar ratios close to 4 and approximately 3 were found during titrations of poly[d(A)], poly[d(I)], poly[d(A-T)], and poly[d(A,T)] (with the first endpoints giving n = 4.1 4.0, 4.0, and 4.1 +/- 0.3, respectively). Calculations showed that the CD changes we observed during these latter titrations were consistent with a switch between two non-interacting binding modes of n = 4 and n = 3. We found no evidence for an n = 5 binding mode. One implication of our results is that the Brayer and McPherson model for the helical gene 5 protein-DNA complex, which has 5 nucleotides bound per protein monomer (G. Brayer and A. McPherson, J. Biomol. Struct. and Dyn. 2, 495-510, 1984), cannot be correct for the detailed solution structure of the complex. We interpreted the CD changes above 250 nm upon binding of the gene 5 protein to single-stranded DNAs to be the result of a slight unstacking of the bases, along with a significant alteration of the CD contributions of the individual nucleotides in the case of A-and/or T-containing DNAs. Interestingly, CD contributions attributed to nearest-neighbor interactions in free poly[d(A-T)], poly[d(A,T)], poly[d(A)], and poly[d(T)] were partially maintained in the CD spectra of the protein-saturated polymers, so that neighboring nucleotides, when bound to the protein at 20 degrees C, appeared to interact with one another in much the same manner as in the free polymers at 50 degrees C.(ABSTRACT TRUNCATED AT 250 WORDS)
    Journal of biomolecular Structure & Dynamics 07/1986; 3(6):1079-110. · 2.98 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We have investigated CD spectra of double-stranded RNA (dsRNA) in a variety of ethanolic and salt solutions. Solution conditions were varied by the addition of salts and ethanol, alone, or in combinations. (1) On addition of either salt or ethanol alone to solutions of dsRNA, we found that the positive CD band at 264 nm increased by up to 7% (in salt) or 12% (in ethanol) and underwent a long-wavelength shift of 3 nm. Concomitantly, the negative CD band at 296 nm decreased. These CD changes may be indicative of an A- to A′-RNA secondary-conformation change on dehydration. (2) On addition of both salt and ethanol, in various combinations that caused precipitation of dsRNA, three types of CD spectral changes were found, which we take to indicate at least two different types of intermolecular arrays of RNA molecules. Type I precipitate was flocculent and its CD spectrum had a differential scattering component at long wavelengths. Type II condensate was finely dispersed and was characterized by a doubling of the CD magnitude at 264 nm and simultaneous disappearance of the 210 nm band, to give a CD spectrum close to that previously reported for RNA condensed in the presence of polyethylene glycol and salt [Ψ+ RNA; Evdokimov, Y.M., Pyatigorskaya, T.L., Kadikov, V.A., Polyvtsev, O.F., Doskocil, J., Koudelka, J. & Varshavsky, Y.M., (1976) Nucleic Acids Res.3, 1533–1547]. Type III precipitate was flocculent and had CD spectra that included features that were present for Types I and II condensates; thus, the RNA in this precipitate may not have been in a unique intermolecular array.
    Biopolymers 02/1986; 25(1):91-117. · 2.29 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The first-neighbor approximation for the representation of double-stranded polynucleotide CD has been widely applied. Two apparently different formalisms have appeared. We discuss and compare those formalisms and show them to be identical. We present an updated optimum basis set of polydeoxynucleotide CD spectra and the resulting first-neighbor unit contribution matrix derived from these data.
    Biopolymers 12/1984; 23(11 Pt 2):2639-59. · 2.29 Impact Factor
  • Source
    Stephen P. Edmondson, Donald M. Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: We have examined the absorption and circular dichroism spectra of intact Penicillium chrysogenum virus, empty capsid particles, and isolated double-stranded RNA. The absorbance at 260 nm of intact virus was less than 4% hypochromic relative to the absorbances of the free double-stranded RNA and free viral protein, indicating very little change in the base stacking interactions of the RNA. Circular dichroism studies of intact virus indicate that the capsid protein consists of 45% alpha-helix. Empty capsids, containing a protein of the same molecular weight as intact virus protein, were found to have 30% alpha-helix, suggesting a conformational change in the capsid upon assembly with RNA. The conformation of double-stranded RNA in the virus was slightly altered from the solution structure of the RNA in 0.01 M Na+ and resembled the conformation of double-stranded RNA partially bound with spermidine. However, the virus does not appear to contain polyamines. Electrophoretic experiments indicate a pH- and salt-titratable RNA binding site on the capsid protein in virus disrupted by urea or non-ionic detergents. The results are consistent with significant ionic interactions between the RNA and the capsid protein in the virus.
    Nucleic Acids Research 02/1983; 11(1):175-92. · 8.81 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: It is known that DNA in aqueous-ethanol solutions undergoes a B to A conformational change between 60% and 80% (w/w) ethanol. We have found that precipitates formed by adding salt to DNA in 60% and 80% ethanolic solutions can be very different. DNA precipitated from 60% ethanol forms a fine condensate that only slowly settles out of suspension and shows a characteristic differential scattering of circularly polarized light at long wavelengths. DNA precipitated from 80% ethanol forms a flocculent aggregate that exhibits the CD spectral features of the A conformation. Data from circular dichroism spectra of natural and synthetic nucleic acids and from X-ray diffraction patterns of the precipitates show that DNA molecules precipitated from 60% and 80% ethanol are, respectively, in the B and A conformation. Therefore, the different secondary conformations of DNA in ethanolic solutions are maintained during precipitation under these conditions. These results are of general importance for the preparation and study of condensed forms of DNA, since a relatively small change in the extent of dehydration can change the secondary conformation of DNA and markedly affect the character of a subsequent precipitate.
    Nucleic Acids Research 02/1979; 6(6):2089-107. · 8.81 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We have tested 21 different basis sets of synthetic DNA circular dichroism spectra and have slected one for use in spectral analyses of natural DNAs. This “standard” set consists of spectra of eight polymers: poly[d(A-A-T)·d(A-T-T)], poly[d(A-G-G)·d(C-C-T)], poly[d(A-T)·d(A-T)], poly[d(G-C)·d(G-C)], poly[d(A-G)·d(C-T)], poly[d(A-C)·d(G-T)], poly[d(A-T-C)·d(G-A-T)], and poly[d(A-G-C)·d(G-C-T)]. This basis set, applied according to the first-neighbor polymer procedure of Gray and Tinoco, allows a more uniformly accurate spectral analysis of six natural complex DNAs and eight (A+T)-rich satellite DNAs for base composition and first-neighbor frequencies than was previously possible. We find that spectra of poly[d(A)·d(T)] and/or poly[d(A-C-T-)·d(A-G-T)] are not generally required for good analysis results but we show in this and the following paper that these spectra are needed for the most accurate analyses of some satellite DNAs.
    Biopolymers 02/1978; 17(1):85-106. · 2.29 Impact Factor