D M Gray

University of Texas at Dallas, Dallas, TX, United States

Are you D M Gray?

Claim your profile

Publications (52)219.17 Total impact

  • J D Wen, C W Gray, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The Ff gene 5 protein (g5p) is a cooperative ssDNA-binding protein. SELEX was used to identify DNA sequences favorable for g5p binding at physiological ionic strength (200 mM NaCl) and 37 degrees C. Sequences were selected from a library of 58-mers that contained a central variable segment of 26 nucleotides. DNA sequences selected after eight rounds of SELEX were mostly G-rich, with multiple copies of CPuGGPy, TPuGGGPy, and/or PyPuPuGGGPy motifs. This was unexpected, since g5p has higher binding affinities for polypyrimidine than for polypurine sequences. The most recurrent G-rich sequence, named I-3, was found to have g5p-binding properties that were correlated with a structural transition. At 10 mM NaCl, I-3 existed in a single-stranded form that was saturated by g5p in an all-or-none fashion. At 200 mM NaCl, I-3 existed in a structured form that showed CD spectral features of G-quadruplexes. The g5p binding affinity for this structured form of I-3 was >100-fold higher than for the single-stranded form. Moreover, the structured I-3 was saturated by g5p in two steps, the first of which was the formation of an apparent initiation complex consisting of one I-3 strand and about three g5p dimers. Nuclease S1 footprinting and other experiments showed that g5p molecules in the initiation complex at 200 mM NaCl were bound directly to the G-rich variable segment and that the structure of I-3 was retained after saturation by g5p. Thus, G-rich motifs may form structures favorable for initiation of g5p binding and also provide the actual g5p-binding sites.
    Biochemistry 09/2001; 40(31):9300-10. · 3.38 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: The gene 5 protein (g5p) of Ff bacteriophages is a well-studied model ssDNA-binding protein that binds cooperatively to the Ff ssDNA genome and single-stranded polynucleotides. Its affinity, K omega (the intrinsic binding constant times a cooperativity factor), can differ by several orders of magnitude for ssDNAs of different nearest-neighbor base compositions [Mou, T. C., Gray, C. W., and Gray, D. M. (1999) Biophys. J. 76, 1537-1551]. We found that the DNA backbone can also dramatically affect the binding affinity. The K omega for binding phosphorothioate-modified S-d(A)(36) was >300-fold higher than for binding unmodified P-d(A)(36) at 0.2 M NaCl. CD titrations showed that g5p bound phosphorothioate-modified oligomers with the same stoichiometry as unmodified oligomers. The CD spectrum of S-d(A)(36) underwent the same qualitative change upon protein binding as did the spectrum of unmodified DNA, and the phosphorothioate-modified DNA appeared to bind in the normal g5p binding site. Oligomers of d(A)(36) with different proportions of phosphorothioate nucleotides had binding affinities and CD perturbations intermediate to those of the fully modified and unmodified sequences. The influence of phosphorothioation on binding affinity was nearly proportional to the extent of the modification, with a small nearest-neighbor dependence. These and other results using d(ACC)(12) oligomers and mutant proteins indicated that the increased binding affinity of g5p for phosphorothioate DNA was not a polyelectrolyte effect and probably was not an effect due to the altered nucleic acid structure, but was more likely a general effect of the properties of the sulfur in the context of the phosphorothioate group.
    Biochemistry 02/2001; 40(7):2267-75. · 3.38 Impact Factor
  • Biophysical Journal. 01/2001; 80(1).
  • Source
    G M Hashem, J D Wen, Q Do, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The pyr*pur.pyr type of nucleic acid triplex has a purine strand that is Hoogsteen-paired with a parallel pyrimidine strand (pyr*pur pair) and that is Watson-Crick-paired with an antiparallel pyrimidine strand (pur.pyr pair). In most cases, the Watson-Crick pair is more stable than the Hoogsteen pair, although stable formation of DNA Hoogsteen-paired duplexes has been reported. Using oligomer triplexes of repeating d(AG)12 and d(CT)12 or r(CU)12 sequences that were 24 nt long, we found that hybrid RNA*DNA as well as DNA*DNA Hoogsteen-paired strands of triplexes can be more stable than the Watson-Crick-paired strands at low pH. The structures and relative stabilities of these duplexes and triplexes were evaluated by circular dichroism (CD) spectroscopy and UV absorption melting studies of triplexes as a function of pH. The CD contributions of Hoogsteen-paired RNA*DNA and DNA*DNA duplexes were found to dominate the CD spectra of the corresponding pyr*pur.pyr triplexes.
    Nucleic Acids Research 09/1999; 27(16):3371-9. · 8.81 Impact Factor
  • Source
    T C Mou, C W Gray, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The Ff gene 5 protein (g5p) is considered to be a nonspecific single-stranded DNA binding protein, because it binds cooperatively to and saturates the Ff bacteriophage single-stranded DNA genome and other single-stranded polynucleotides. However, the binding affinity Komega (the intrinsic binding constant times a cooperativity factor) differs by over an order of magnitude for binding to single-stranded polynucleotides such as poly[d(A)] and poly[d(C)]. A polynucleotide that is more stacked, like poly[d(A)], binds more weakly than one that is less stacked, like poly[d(C)]. To test the hypothesis that DNA base stacking, a nearest-neighbor property, is involved in the binding affinity of the Ff g5p for different DNA sequences, Komega values were determined as a function of NaCl concentration for binding to six synthetic sequences 48 nucleotides in length: dA48, dC48, d(AAC)16, d(ACC)16, d(AACC)12, and d(AAACC)9A3. The binding affinities of the protein for these sequences were indeed found to be related to the nearest-neighbor compositions of the sequences, rather than to simple base compositions. That is, the g5p binding site, which is spanned by four nucleotides, discriminates among these sequences on the basis of the relative numbers of nearest neighbors (AA, CC, and AC plus CA) in the sequence. The results support the hypothesis that the extent of base stacking/unstacking of the free, nonbound ssDNA plays an important role in the binding affinity of the Ff gene 5 protein.
    Biophysical Journal 04/1999; 76(3):1537-51. · 3.67 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: A core Y61F mutant of the gene 5 single-stranded DNA-binding protein (g5p) of f1 bacterial virus aggregated when expressed from a plasmid, but, after refolding in vitro, it behaved much like wild-type and may be a stability or folding mutant. Circular dichroism (CD) titrations showed the same cooperative polynucleotide binding modes for Y61F and wild-type g5p. There are n = 4 and n congruent with 2.5 modes for binding to poly[d(A)] at low ionic strengths, but n = 4, n = 3, and n congruent with 2-2.5 modes for binding to fd single-stranded viral DNA (fd ssDNA), where n is the number of nucleotides occluded by each bound g5p monomer in a given mode. Y61F g5p has slightly reduced affinity in the n = 4 mode. Electron microscopy showed that Y61F g5p forms left-handed nucleoprotein superhelices indistinguishable from wild-type. Progression from binding to fd ssDNA in the n = 4 to n = 3 to n congruent with 2-2.5 mode is accompanied by an increase in the number of helical turns, an increase from (7.7 +/- 0.3) to (9.5 +/- 0.3) to ( approximately 10-13) g5p dimers per turn, and a decrease in the number of DNA nucleotides per turn. From CD spectra for four of five possible Y --> F g5p mutants, we infer that the fifth tyrosine, Tyr 56, contributes strongly to the CD. Retention of a strong 229 nm CD band in all mutants indicates that all retain elements of the native structure. Spectra of Y26F, Y34F, and Y61F g5p imply limited mobility of the replacement Phe. Comparison of measured with calculated CD spectra also suggests limited mobility for Tyr 26 and Tyr 34 in g5p in solution, and provides new information that the g5p structure in solution may be dominated by Tyr 41 rotamers differing from that stabilized in the crystal.
    Biochemistry 05/1998; 37(20):7463-77. · 3.38 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Knowledge of the relative stabilities of S-DNA.RNA hybrids of different sequences is important for choosing RNA targets for hybridization with antisense phosphorothioate oligodeoxyribonucleotides (S-DNAs). It is also important to know how hybrid secondary structure varies with sequence, since different structures could influence thermal stability and the activity of RNase H. Our approach has been to study relatively simple sequences consisting of repeating di-, tri-, and tetranucleotides, which allow the maximum resolution of nearest-neighbor effects. Circular dichroism (CD) spectra and melting temperatures were acquired for 16 hybrid sequences that could be formed by mixing S-DNA and RNA oligomers of 24 nucleotides in length. CD spectra of S-DNA.RNA hybrids were sequence-dependent and were similar to those of analogous unmodified hybrids. From singular value decomposition, the major CD spectral component was like that of the A-conformation. Three nearest-neighbor relationships among the hybrid CD spectra were in as good agreement as are such relationships among spectra of duplex RNAs. Tm values ranged from 44.1 degrees C for S-d(ACT)8. r(AGU)8 to 66.6 degrees C for S-d(CCT)8.r(AGG)8 (in 0.15 M K+, phosphate buffer, pH 7). The S-DNA.RNA hybrids had a sequence-dependence of melting temperatures that was approximately the same as that calculated using published data for normal DNA.RNA hybrids [Sugimoto, N., Nakano, S., Katoh, M., Matsumura, A., Nakamuta, H., Ohmichi, T.,Yoneyama, M., & Sasaki, M. (1995) Biochemistry 34, 11211-11216]. In general, sequence-dependent CD spectra and Tm values of S-DNA.RNA hybrids appear to reflect the unique nearest-neighbor interactions of adjacent base pairs, where the S-DNA and RNA strands are in different, but relatively uniform, conformations.
    Biochemistry 01/1998; 37(1):61-72. · 3.38 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Circular dichroism (CD) spectra and melting temperature (Tm) data for five duplexes containing phosphorothioate linkages were compared with data for four unmodified duplexes to assess the effect of phosphorothioate modification on the structure and stability of DNA. DNA and DNA.RNA duplexes. Nine duplexes were formed by mixing oligomers 24 nt long in 0.15 M K+(phosphate buffer), pH 7.0. Unmodified DNA.DNA and RNA.RNA duplexes were used as reference B-form and A-form structures. The CD spectra of the modified hybrids S-d(AC)12.r(GU)12 and r(AC)12.S-d(GT)12 differed from each other but were essentially the same as the spectra of the respective unmodified hybrids. They were more A-form than B-form in character. CD spectra of duplexes S-d(AC)12.d(GT)12 and d(AC)12.S-d(GT)12 were similar to that of d(AC)12.d(GT)12, except for a reduced long wavelength CD band. Sulfur modifications on both strands of the DNA duplex caused a pronounced effect on its CD spectrum. The order of thermal stability was: RNA.RNA > DNA.DNA > DNA.RNA > S-DNA.DNA > S-DNA. RNA > S-DNA.S-DNA. Phosphorothioation of one strand decreased the melting temperature by 7.8+/-0.6 degrees C, regardless of whether the substitution was in a hybrid or DNA duplex. Thermodynamic parameters were obtained from a multistate analysis of the thermal melting profiles. Interestingly, the destabilizing effect of the phosphorothioate substitution appears to arise from a difference in the entropy upon forming the DNA.DNA duplexes, while the destabilizing effect in the DNA.RNA hybrids appears to come from a difference in enthalpy.
    Nucleic Acids Research 10/1997; 25(20):4098-105. · 8.81 Impact Factor
  • B L Mark, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: We used a mutant gene 5 protein (g5p) to assign and interpret overlapping CD bands of protein nucleic acid complexes. The analysis of overlapping protein and nucleic acid CD bands is a common challenge for CD spectroscopists, since both components of the complex may change upon binding. We have now been able to more confidently resolve the bands of nucleic acids complexed with the fd gene 5 protein by exploiting a mutant gene 5 protein that has an insignificant change in tyrosine optical activity at 229 nm upon binding to nucleic acids. We have studied the interactions of the mutant Y34F g5p (Tyr-34 substituted with phenylalanine) with poly[r(A)], poly[d(A)], and fd single-stranded DNA (ssDNA). Our results showed the following: (1) The 205-300 nm spectrum of poly[r(A)] saturated with the Y34F mutant (P/N = 0.25) was essentially the sum of the spectra of poly[r(A)] at a high temperature plus the spectrum of the free protein, except for a minor negative band at 257 nm. (2) The spectra of poly[d(A)] and fd ssDNA saturated with the mutant protein at a P/N = 0.25, minus the spectra of the free nucleic acids at a high temperature, also essentially equaled the spectrum of the free protein in the 205-245 nm region. (3) While the overall secondary structure of the Y34F protein did not change upon binding to any of these nucleic acids, there could be changes in the environment of individual aromatic residues. (4) Nucleic acids complexed with the g5p are unstacked (as if heated) and (in the cases of the DNAs) perturbed as if part of a dehydrated double-stranded DNA. (5) Difference spectra revealed regions of the spectrum specific for the particular nucleic acid, the protein, and whether g5p was bound to DNA or RNA.
    Biopolymers 10/1997; 42(3):337-48. · 2.88 Impact Factor
  • Progress in Biophysics and Molecular Biology 01/1996; 65. · 2.91 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Circular dichroism spectroscopy was used to study mutants of phage fd gene 5 protein (Y26F, Y34F, and Y41F) in which three of the five tyrosines, Tyr-26, Tyr-34, and Tyr-41, were individually substituted with phenylalanine. The tyrosine 229 nm CD bands of the wild type, Y26F, and Y41F gene 5 proteins decreased in magnitude during complex formation with either fd ssDNA or poly[d(A)]. However, the Y34F gene 5 protein showed no decrease in the 229 nm band during titrations of these nucleic acids. This suggested that Tyr-34 of the wild type gene 5 protein dominated the 229 nm CD changes upon binding to single-stranded DNA. Titrations of poly[d(A)] or fd ssDNA with wild type, Y26F, Y34F, or Y41F gene 5 proteins resulted in perturbations of the nucleic acid near-UV CD bands, specific for the particular nucleic acid, but similar for all four proteins (in 2 mM sodium phosphate buffer, pH 7.0). For both nucleic acids, the addition of protein beyond a certain [protein monomer]/[nucleotide] ratio (0.25 for poly[d(A)] or 0.33 for fd ssDNA) resulted in a partial reversal of the CD change of the nucleic acid. These data are interpreted to mean that, in addition to the two well-known n = 4 and n = 3 stoichiometric modes of binding, there is a third mode of binding in which the nucleic acid is in limited contact with the protein. As shown by salt dissociation studies of complexes with poly[d(A)], the binding affinities, K omega, of the proteins were in the order: wild type > Y26F > Y34F > or = Y41F (for the n = 4 binding mode in 0.1-0.2 M NaCl). Our data indicate that Tyr-34 plays a more important role in forming a complex with ssDNA than is apparent in current models of the g5p.ssDNA complex. We suggest that the hydroxyl moieties of Tyr-34 and Tyr-41 are both somehow involved in stabilizing the interface of bound protein dimers.
    Biochemistry 10/1995; 34(39):12854-65. · 3.38 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Small-angle scattering and electron microscopy studies of fd gene 5 protein (g5p) and reconstituted g5p.nucleic acid complexes have been used to test models for the complexes and evaluate their uniqueness. In addition, we have obtained new information on the dependence of nucleotide type and protein/nucleotide (P/N) ratio on the structure of the complexes. Reconstituted complexes were made with single-stranded fd viral DNA (fd ssDNA), poly[d(A)] and poly[r(A)]. All complexes form similar left-handed, flexible superhelices having approximately the same diameter, but the pitch differs among these complexes. The g5p protein is a dimer in solution and the dimers associate to form a superhelical framework to which the polynucleotide is attached. The combined X-ray and neutron scattering data confirm the nucleic acid is inside the protein superhelix. A Monte Carlo integration modeling procedure applied to the scattering data was used to systematically test large numbers of possible models for each complex, and previously proposed models based on parameters obtained from electron microscopy were found to be essentially correct and unique. The data on the complexes with different P/N ratios showed that mass per unit length values decreased while the rise per dimer and pitch of the superhelix increased for g5p.fd-ssDNA complexes with decreasing P/N ratios.
    Journal of Molecular Biology 07/1995; 249(3):576-94. · 3.91 Impact Factor
  • D M Gray, S H Hung, K H Johnson
    [Show abstract] [Hide abstract]
    ABSTRACT: Absorption and CD measurements of complementary oligomers and mixtures are described. The concentrations of oligomers may be estimated from absorption measurements and nearest-neighbor calculations of molar extinction coefficients. Interactions between complementary strands in mixtures can lead to obvious differences between measured CD spectra and the average of the spectra of the individual strands. CD spectra also allow an assessment of whether the individual strands are in self-complexes, which could compete with duplex or triplex formation. Isodichroic and isoabsorptive points provide important indicators of the stoichiometry of the strands in base-paired complexes. CD spectra provide an important means of characterizing differences in the conformations of DNA, RNA, and hybrid duplexes or triplexes having analogous sequences.
    Methods in Enzymology 02/1995; 246:19-34. · 2.00 Impact Factor
  • Biophysical Journal. 01/1995; 68(2 PART 2).
  • Source
    S H Hung, Q Yu, D M Gray, R L Ratliff
    [Show abstract] [Hide abstract]
    ABSTRACT: CD spectra and difference CD spectra of four d(oligopurine).r(oligopyrimidine) and four r(oligopurine).d(oligopyrimidine) hybrid duplexes containing mixed A.T(U) and G.C base pairs were compared with the spectra of four DNA.DNA and four RNA.RNA oligomer duplexes of similar repeating sequences. The 16 duplexes were formed by mixing oligomers that were 24 nucleotides long. The buffer was 0.05 M Na+ (phosphate), pH 7.0. DNA.DNA and RNA.RNA oligomer duplexes were used as reference B-form and A-form structures. We found that the CD spectra of d(purine).r(pyrimidine) and r(purine).d(pyrimidine) hybrid duplexes were different from the CD spectra of either DNA.DNA or RNA.RNA duplexes. The data suggested that these hybrids have intermediate structures between A-form RNA and B-form DNA structures. The CD spectra of d(purine).r(pyrimidine) and r(purine).d(pyrimidine) hybrid duplexes were different from each other, but the hybrids in each class had consistent CD spectra as indicated by nearest-neighbor comparisons. Thus, it appeared that the two types of hybrids belonged to different structural classes. The negative 210 nm band found in difference CD spectra was correlated with the presence of an r(purine) strand in the hybrid duplexes. The melting temperatures (Tm values) of these hybrids were compared with the Tm values of the DNA.DNA and RNA.RNA duplexes. The order of the thermal stability was: RNA.RNA duplex > r(purine).d(pyrimidine) hybrid > DNA.DNA duplex > d(purine).r(pyrimidine) hybrid, when comparing analogous sequences.
    Nucleic Acids Research 10/1994; 22(20):4326-34. · 8.81 Impact Factor
  • V P Antao, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: CD spectra were used to compare the acid-induced structural transitions of poly[d(A)] and poly[d(C)] with those of poly[r(A)] and poly[r(C)], respectively. The types of base pairing were probably the same in the acid self-complexes of both A-containing polymers and in the acid self-complexes of both C-containing polymers. Similar base pairings were indicated by similarities in the difference CD spectra showing the changes during the first major acid-induced transitions of the polymers. Information from the CD spectra and pKa values of the transitions suggested that the transitions for the RNA polymers involved similar structural changes. The two DNA polymers were markedly different. Single-stranded poly[d(A)] was in the most stacked structure and had the lowest pKa for forming an acid self-complex. Single-stranded poly[d(C)] was in the least stacked structure and had the highest pKa for forming a protonated duplex.
    Journal of biomolecular structure & dynamics 05/1993; 10(5):819-39. · 4.99 Impact Factor
  • B A Clack, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: In this study, we have separated the contributions of DNA and protein to the absorption and linear dichroism (LD) of each of four phages: fd, IKe, Pf1, and Pf3. We have found that the DNA packaged in each of the phages is hypochromic relative to the purified single-stranded DNA, suggesting that bases are stacked in all of the phages. We have oriented the phages by flow and for the first time report the intrinsic LD from 320 to 190 nm for each of these phages. From the intrinsic LD of the phages and the isotropic absorption of the individual components, we have determined the reduced dichroism of the DNA within the phages and, subsequently, the maximum angle of inclination of the DNA bases (from the helix axis) for the packaged DNA. The maximum angles were 63 degrees and 64 degrees for the DNAs of class I phages fd and IKe, respectively. The angles were significantly less, 51 degrees and 49 degrees, for the DNAs of the class II phages Pf1 and Pf3, respectively. Thus, the two classes of phage differ in the structures of their packaged DNA, the DNA bases of the class II phages being more parallel to the long axis of the phage than are the DNA bases of the class I phages.
    Biopolymers 08/1992; 32(7):795-810. · 2.88 Impact Factor
  • K H Johnson, D M Gray
    [Show abstract] [Hide abstract]
    ABSTRACT: The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.
    Journal of biomolecular structure & dynamics 03/1992; 9(4):733-45. · 4.99 Impact Factor
  • Methods in Enzymology 02/1992; 211:389-406. · 2.00 Impact Factor
  • Faseb Journal. 01/1992; 6(1).