Publications (20)30.99 Total impact
-
Article: Acanthoic acid induces cell apoptosis through activation of the p38 MAPK pathway in HL-60 human promyelocytic leukaemia
[show abstract] [hide abstract]
ABSTRACT: The present study was designed to evaluate the molecular mechanisms of the action of acanthoic acid (ACAN) from Acanthopanax koreanum (Araliaceae) against HL-60 human promyelocytic leukaemia cells. ACAN reduced the proliferation of HL-60 cells in a dose- and time-dependent manner accompanied by the induction of apoptosis. Possible mechanisms of ACAN-induced apoptosis were also examined. The results showed that ACAN-induced the phosphorylation of members of the mitogen-activated protein kinase (MAPK) family, c-Jun N-terminal kinase (JNK), p38 MAPK (p38), and extracellular signal-regulated kinase (ERK). A specific p38 MAPK inhibitor (SB203580) significantly blocked ACAN-induced apoptosis and cell viability, whereas an ERK inhibitor (PD98059) and JNK inhibitor (SP600125) had no effect. Moreover, ACAN induced the cleavage of caspase-3 and poly-ADP-ribose polymerase (PARP), and decreased the level of Bcl-xL, but these effects were inhibited by SB203580 pre-treatment. These results strongly suggest that ACAN may have cancer chemopreventive and therapeutic potential, due to its ability to activate the p38 MAPK-mediated signalling pathwaysFood Chemistry 12/2012; 135:2112-2117. · 3.65 Impact Factor -
Article: Acanthoic acid induces cell apoptosis through activation of the p38 MAPK pathway in HL-60 human promyelocytic leukaemia.
[show abstract] [hide abstract]
ABSTRACT: The present study was designed to evaluate the molecular mechanisms of the action of acanthoic acid (ACAN) from Acanthopanax koreanum (Araliaceae) against HL-60 human promyelocytic leukaemia cells. ACAN reduced the proliferation of HL-60 cells in a dose- and time-dependent manner accompanied by the induction of apoptosis. Possible mechanisms of ACAN-induced apoptosis were also examined. The results showed that ACAN-induced the phosphorylation of members of the mitogen-activated protein kinase (MAPK) family, c-Jun N-terminal kinase (JNK), p38 MAPK (p38), and extracellular signal-regulated kinase (ERK). A specific p38 MAPK inhibitor (SB203580) significantly blocked ACAN-induced apoptosis and cell viability, whereas an ERK inhibitor (PD98059) and JNK inhibitor (SP600125) had no effect. Moreover, ACAN induced the cleavage of caspase-3 and poly-ADP-ribose polymerase (PARP), and decreased the level of Bcl-xL, but these effects were inhibited by SB203580 pre-treatment. These results strongly suggest that ACAN may have cancer chemopreventive and therapeutic potential, due to its ability to activate the p38 MAPK-mediated signalling pathways.Food Chemistry 12/2012; 135(3):2112-7. · 3.65 Impact Factor -
Article: Investigation of the component of Lycopodium serratum extract that inhibits proliferation and mediates apoptosis of human HL-60 leukemia cells.
[show abstract] [hide abstract]
ABSTRACT: In this study, we investigate a plant commonly used in herbal medicines, Lycopodium serratum, which is believed to have anti-cancer properties. An alcoholic extract of L. serratum (LSE) was investigated for its ability to induce apoptosis in cultured human promyelocytic leukemia HL-60 cells. Treatment of HL-60 cells with various concentrations of LSE (6-100 μg/mL) resulted in a sequence of events characteristic of apoptosis, including loss of cell viability, morphological changes, and increased sub-G(1) DNA content. Serratenediol (SE), a known biologically active agent, was isolated from MC fraction of LSE and was able to demonstrate significant and dose-dependent growth inhibitory effects on HL-60 cells. Similar to the effects observed with the crude LSE, the SE-related effects included the formation of apoptotic bodies and fragmented DNA, as well as the accumulation of DNA in the sub-G(1) phase of the cell cycle. Analysis of the mechanism of these events indicated that SE treated cells had an increased ratio of Bax/Bcl-xL, released the cytochrome c, activated caspase-9, -3, and cleaved poly-ADP-ribose polymerase (PARP); these observations are hallmarks of apoptotic events. Thus, the results suggest that SE can induce apoptosis via regulating the ratio of Bax/Bcl-xL in HL-60 cell lines.Food and chemical toxicology: an international journal published for the British Industrial Biological Research Association 05/2012; 50(8):2629-34. · 2.99 Impact Factor -
Article: Clinical Characteristics and Surgical Safety in Patients with Acute Appendicitis Aged over 80.
[show abstract] [hide abstract]
ABSTRACT: The aim of this study was to evaluate the clinical characteristics and treatment outcomes, including surgical safety, in patients over 80 years of age who underwent an appendectomy. This study involved 160 elderly patients who underwent an appendectomy for acute appendicitis: 28 patients over 80 years old and 132 patients between 65 and 79 years old. The rate of positive rebound tenderness was significantly higher in the over 80 group (P = 0.002). Comparisons of comorbidity, diagnostic tool and delay in surgical treatment between the two groups were not statistically different. American Society of Anesthesiologists score was significantly higher in the over 80 group than in the 65 to 79 group (2.4 ± 0.5 vs. 1.6 ± 0.5; P < 0.00005). Comparisons of operative times and use of drainage between the two groups were not statistically different. In the pathologic findings, periappendiceal abscess was more frequent in the over 80 group (P = 0.011). No significant differences existed between the two groups when comparing the results of gas out and the time to liquid diet, but the postoperative hospital stay was significantly longer in the over 80 group (P = 0.001). Among the postoperative complications, pulmonary complication was significantly higher in the over 80 group (P = 0.005). However, operative mortality was zero in each group. In case of suspicious appendicitis in elderly patients, efforts should be made to use aggressive diagnostic intervention, do appropriate surgery and prevent pulmonary complications especially in patients over 80 years of age.Journal of the Korean Society of Coloproctology 04/2012; 28(2):94-9. -
Article: Complete mitochondrial genome of the longtooth grouper Epinephelus bruneus (Perciformes, Serranidae).
[show abstract] [hide abstract]
ABSTRACT: We determined the complete nucleotide sequence of the mitochondrial (mt) genome for the longtooth grouper, Epinephelus bruneus (Perciformes, Serranidae). This mt genome, consisting of 16,686 base pairs (bp), encoded genes for 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region as those found in other vertebrates, with the gene order identical to that of typical vertebrates. A major noncoding region between the trnP and trnF genes (991 bp) was considered to be the control region (D-loop). Within this sequence, 22 copies of a 17-bp tandem repeat element, 5'-TGATATTACATATATGC-3', were identified in the control region unlike previous reported Epinephelus species.Mitochondrial DNA 03/2012; 23(2):137-8. · 1.49 Impact Factor -
Article: Quercitrin protects against oxidative stress-induced injury in lung fibroblast cells via up-regulation of Bcl-xL
[show abstract] [hide abstract]
ABSTRACT: The cytoprotective effect of quercitrin (QR) against oxidative stress induced cell damage by hydrogen peroxide (H2O2) in Chinese hamster lung fibroblast (V79-4) cells was investigated. QR evidenced a scavenging effect of 1,1-diphenyl-2-picrylhydrazyl (DPPH), superoxide, hydroxyl radicals and on intracellular ROS, and thus prevented lipid peroxidation. As a result, QR reduced H2O2-induced cell death and apoptosis in V79-4 cells. Moreover, H2O2 induced the cleavage of caspase-3, -9, and poly-ADP-ribose polymerase (PARP) and a reduction in Bcl-xL levels, whereas pretreatment with QR significantly inhibited caspase-3, -9, and PARP cleavage and the reduction in Bcl-xL levels, and ultimately ameliorated H2O2- induced apoptosis. Taken together, these results indicate that the treatment of V79-4 cells with QR can block H2O2-induced apoptosis via the regulation of Bcl-xL. QR may be exploited as a biopreservative in food applications or as a health supplement to alleviate oxidative stress.Journal of Functional Foods 01/2012; 4:253-262. · 2.45 Impact Factor -
Article: Laparoscopic versus open appendectomy for appendicitis in elderly patients.
[show abstract] [hide abstract]
ABSTRACT: The appendectomy is the most common emergent surgical procedure in elderly patients. The increasing number of elderly persons has been accompanied by an increase in the number of cases of acute appendicitis in the elderly. In order to understand the clinical significance of a laparoscopic appendectomy for elderly patients with appendicitis, we investigated the results of a laparoscopic appendectomy for treating patients over 60 years of age with appendicitis and compared them with the results for an open technique. We studied retrospectively patients over 60 years of age who underwent an appendectomy with either a laparoscopic (LA) or open (OA) technique for appendicitis between July 2007 and December 2009. There were 30 patients in the LA group and 47 patients in the OA group. The demographic data, operative time, length of the hospital stay, bowel movement, pain control, cost, complications and pre-existing disease were assessed. There were no significant differences between the LA and the OA groups with respect to pre-existing diseases, gender, age, American Society of Anesthesiologists (ASA) score and the number of cases of complicated appendicitis, operative time, length of hospital stay, and times of analgesics use. However, the proportion of early gas out (within POD #2) was significantly greater in the LA group (80% vs. 57%, P < 0.05), and postoperative complications were significantly lower in the LA group (7% vs. 32%, P < 0.01). The costs for the two groups were not significantly different. A laparoscopic appendectomy is a safe and effective procedure in elderly patients and is not associated with any increase in morbidity. It can be recommended for routine use in treating elderly patients with appendicitis.Journal of the Korean Society of Coloproctology 10/2011; 27(5):241-5. -
Article: Clinical Significance of Perineal Descent in Pelvic Outlet Obstruction Diagnosed by using Defecography.
[show abstract] [hide abstract]
ABSTRACT: The aim of this study was to evaluate the clinical significance of perineal descent (PD) in pelvic outlet obstruction patients diagnosed by using defecography. One hundred thirty-six patients with pelvic outlet obstruction (POO; median age 49 years) had more than one biofeedback session after defecography. Demographic finding, clinical bowel symptoms and anorectal physiological studies were compared for PD at rest and PD with dynamic changes. Age (r = 0.33; P < 0.001), rectocele diameter (r = 0.31; P < 0.01), symptoms of incontinence (P < 0.05) and number of vaginal deliveries (r = 0.46; P < 0.001) were correlated with increased fixed PD. However, the female gender (P < 0.005), rectal intussusceptions (P < 0.05), negative non-relaxing puborectalis syndrome (P < 0.00005) and rectocele (P < 0.0005) were correlated with increased dynamic PD. Duration of symptoms, number of bowel movements, history of pelvic surgery and difficult defecation were not related with PD. There was no significant correlation between fixed and dynamic PD and success of biofeedback therapy. Age, vaginal delivery and diameter of the rectocele are associated with increased fixed PD. Female gender, rectal intussusceptions and a rectocele are correlated with increased dynamic PD. Biofeedback is an effective option for POO regardless of severity of PD.Journal of the Korean Society of Coloproctology 12/2010; 26(6):395-401. -
Article: Complete mitochondrial genome of three Branchiostegus (Perciformes, Malacanthidae) species: genome description and phylogenetic considerations.
[show abstract] [hide abstract]
ABSTRACT: We cloned and sequenced the complete mitochondrial DNA (mtDNA) of three tilefishes (Branchiostegus albus, Branchiostegus argentatus, and Branchiostegus japonicus) to characterize and compare their mitochondrial genomes (mitogenomes). The mitogenomes of B. albus, B. argentatus, and B. japonicus were 16,532, 16,550, and 16,541 bp long, respectively, and all consisted of 37 genes (13 protein-coding genes, 2 ribosomal RNA, and 22 transfer RNA (tRNAs)), which are typical for vertebrate mtDNA. As in other bony fishes, most genes were encoded on the H-strand, except for the nad6 and eight tRNA genes that were encoded on the L-strand. Among the 13 protein-coding genes of all three tilefishes, 2 reading-frame overlaps were found on the same strand: atp8 and atp6 overlapped by 10 nucleotides, and nad4L and nad4 overlapped by 7 nucleotides. The identity of the nad4 gene between B. albus and B. argentatus was the lowest at 87%. Conversely, the identity of the nad6 gene between B. albus and B. japonicus was the highest at 99%. Most tRNA genes were similar in length among the three species, while the tRNA-Ser((AGY)) of B. japonicus was 9 bp longer than those of B. albus and B. argentatus. The control region of the mitogenome spanned 853, 862, and 856 bp in B. albus, B. argentatus, and B. japonicus, respectively. A maximum likelihood tree constructed using 11,035 sites contained five independent groups with bootstrap values of 100% in support of their divergence. All three tilefishes examined were clustered with the Pomacanthidae species in Group II.Mitochondrial DNA 10/2010; 21(5):151-9. · 1.49 Impact Factor -
Article: Complete mitochondrial genome of the rabbitfish Siganus fuscescens (Perciformes, Siganidae)Full Length Research Paper
[show abstract] [hide abstract]
ABSTRACT: We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei.07/2009; 18(4):295-301. -
Article: Comparison of the mitochondrial genomes of East Asian Pseudolabrus fishesFull-Length Research Article
[show abstract] [hide abstract]
ABSTRACT: We determined the complete mitochondrial genomes of Pseudolabrus sieboldi and P. eoethinus, and analyzed the genome organization, codon usage, and transition/transversion mutation ratio of the mitochondrial genome. The mitochondrial genomes of P. sieboldi and P. eoethinus are 16,507 and 16,508 bp in length, respectively, and consisted of 37 genes (13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs), which is typical for vertebrate mitochondrial DNA. All protein-coding genes of two species used the initiation codon ATG except the cytochrome c oxidase subunit (CO) 1, which began with GTG as an initiation codon. However, the termination codon for the NADH dehydrogenase subunit (ND) 6 gene encoded with TAA in P. sieboldi, and TAG in P. eoethinus. The 12S and 16S rRNA genes were 949 and 1694 bp, respectively, in P sieboldi, and were 948 and 1693 bp in P. eoethinus. The A+T content of the two rRNA genes were 52.9% in P. sieboldi and 52.5% in P. eoethinus, which is slightly lower than that of other labrid species. The identity of the 13 protein-coding genes ranged between 67% (ND6) and 94% (CO2 and ATP8). The G+C contents of all of the protein-coding genes of P. sieboldi were slightly higher than those of P. eoethinus. Our data contribute to the identification, and further our understanding, of the comparative genetics of Pseudolabrus species distributed in East Asia.07/2009; 19(5):453-460. -
Article: Comparison of the mitochondrial genomes of East Asian Pseudolabrus fishes.
[show abstract] [hide abstract]
ABSTRACT: We determined the complete mitochondrial genomes of Pseudolabrus sieboldi and P. eoethinus, and analyzed the genome organization, codon usage, and transition/transversion mutation ratio of the mitochondrial genome. The mitochondrial genomes of P. sieboldi and P. eoethinus are 16,507 and 16,508 bp in length, respectively, and consisted of 37 genes (13 protein-coding genes, two ribosomal RNAs, and 22 transfer RNAs), which is typical for vertebrate mitochondrial DNA. All protein-coding genes of two species used the initiation codon ATG except the cytochrome c oxidase subunit (CO) 1, which began with GTG as an initiation codon. However, the termination codon for the NADH dehydrogenase subunit (ND) 6 gene encoded with TAA in P. sieboldi, and TAG in P. eoethinus. The 12S and 16S rRNA genes were 949 and 1694 bp, respectively, in P. sieboldi, and were 948 and 1693 bp in P. eoethinus. The A + T content of the two rRNA genes were 52.9% in P. sieboldi and 52.5% in P. eoethinus, which is slightly lower than that of other labrid species. The identity of the 13 protein-coding genes ranged between 67% (ND6) and 94% (CO2 and ATP8). The G + C contents of all of the protein-coding genes of P. sieboldi were slightly higher than those of P. eoethinus. Our data contribute to the identification, and further our understanding, of the comparative genetics of Pseudolabrus species distributed in East Asia.Mitochondrial DNA 11/2008; 19(5):453-60. · 1.49 Impact Factor -
Article: Complete mitochondrial genome of the rabbitfish Siganus fuscescens (Perciformes, Siganidae).
[show abstract] [hide abstract]
ABSTRACT: We determined the complete nucleotide sequence of the mitochondrial genome for the rabbitfish Siganus fuscescens (Perciformes, Siganidae). This mitochondrial genome, consisting of 16,491 base pairs (bp), included 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a noncoding control region similar those found in other vertebrates; the gene order was identical to that of typical vertebrates. Most of the genes of S. fuscescens were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser [UCN], Glu, and Pro) genes were encoded on the L-strand. The reading frames of ATPase 8 and 6 and those of ND4L and ND4 overlapped by ten and seven nucleotides, respectively. All mitochondrial protein-coding genes began with an ATG start codon, except for CO1, which started with GTG. Open reading frames of S. fuscescens ended with TAA (ND1, CO1, ATPase 8, ND4L, ND5 and ND6), and the remainder had incomplete stop codons, either TA (ATPase 6 and CO3) or T (ND2, CO2, ND3, ND4, and Cytb). The origin of L-strand replication in S. fuscescens was located in a cluster of five tRNA genes (WANCY) and was 34 nucleotides in length. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (828 bp) was considered to be the control region (D-loop). Within this sequence, we identified a conserved sequence block characteristic of this region. The rabbitfish was grouped with Siganus canaliculatus in most parsimony analyses, which showed 100% bootstrap support for their divergence. These findings are useful for inferring phylogenetic relationships and identification within the suborder Acanthuroidei.DNA Sequence 09/2007; 18(4):295-301. · 0.75 Impact Factor -
Article: Complete mitochondrial genome of the rock bream Oplegnathus fasciatus (Perciformes, Oplegnathidae) with phylogenetic considerations.
[show abstract] [hide abstract]
ABSTRACT: We determined the complete nucleotide sequence of the mitochondrial genome for the rock bream, Oplegnathus fasciatus (Perciformes, Oplegnathidae). This mitochondrial genome, consisting of 16,511 base pairs (bp), encoded genes for 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and a noncoding control region like those found in other vertebrates, with the gene order identical to that of typical vertebrates. Most of the genes of O. fasciatus were encoded on the H-strand, while the ND6 and eight tRNA (Gln, Ala, Asn, Cys, Tyr, Ser (UCN), Glu and Pro) genes were encoded on the L-strand. The reading frames of two pairs of genes overlapped: ATPase 8 and 6 and ND4L and ND4 by ten and seven nucleotides, respectively. The origin of L-strand replication in O. fasciatus was in a cluster of five tRNA genes (WANCY) and was 41 nucleotides in length. The conserved motif (5'-GCGGG-3') was found at the base of the stem within the tRNA-Cys gene. A major noncoding region between the tRNA-Pro and tRNA-Phe genes (835 bp) was considered to be the control region (D-loop). Within this sequence, we identified a termination-associated sequence and a conserved sequence block characteristic to this region. In most parsimony analyses, the O. fasciatus was positioned in the clade including Emmelichthyidae, Lutjanidae, Percidae, Centrarchidae, and Sparidae, with 100% bootstrap support for their divergence.Gene 06/2007; 392(1-2):174-80. · 2.34 Impact Factor -
Article: Molecular genetic analysis of ancient cattle bones excavated from archaeological sites in Jeju, Korea.
[show abstract] [hide abstract]
ABSTRACT: Ancient cattle bones were excavated from archaeological sites in Jeju, Korea. We used molecular genetic techniques to identify the species and establish its relationship to extant cattle breeds. Ancient DNA was extracted from four sources: a humerus (Gonae site, A.D. 700-800), two fragments of radius, and a tooth (Kwakji site, A.D. 0-900). The mitochondrial DNA (mtDNA) D-loop regions were cloned, sequenced, and compared with previously reported sequences of various cattle breeds (9 Asian, 8 European, and 3 African). The results revealed that these bones were of the breed, Bos taurus, and a phylogenetic tree indicated that the four cattle bones formed a monophyletic group with Jeju native black cattle. However, the patterns of sequence variation and reports from archaeological sites suggest that a few wild cattle, with a different maternal lineage, may have existed on Jeju Island. Our results will contribute to further studies of the origin of Jeju native cattle and the possible existence of local wild cattle.Molecules and Cells 01/2006; 20(3):325-30. · 2.18 Impact Factor -
Article: Characterization of a RAPD fragment unique to species with hairy fruit skin in the genus Actinidia
[show abstract] [hide abstract]
ABSTRACT: To develop a SCAR primer related to the hairy-fruit trait in the genusActinidia, we took a PCR-RAPD approach using arbitrary 10-mer primers. PCR with the UBC 376 primer generated specific fragments from three species with hairy fruit skin. Those fragments were then cloned to determine their nucleotide sequences. Two SCAR primers were designed from the UBC 376 primer and nucleotide sequences were obtained from the PCR fragments. A SCAR primer, OKC385, specifically amplified a 385-bp fragment from one clone ofActinidia eriantha, four ofActinidia chinensis, and four ofActinidia deliciosa. Deduced amino acid sequences of this fragment showed high sequence homology with plant cellulose synthases, which are involved in the biosynthesis of cellulose, a major cell wall component. The 385-bp fragment was specifically detected only in the seriesPerfectae C.F. Liang of sectionStellatae Li. This type has many hairs on the leaves, fruits, and stems, suggesting that the gene containing the PCR fragment is involved in hair formation in this phylogenetic group. Taken together, our results suggest that the SCAR primer, OKC385, can be used as a specific primer for early selection of the non-hair trait in breeding of the genusActinidia.Journal of Plant Biology 08/2004; 47(3):210-215. · 1.07 Impact Factor -
Article: Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea
[show abstract] [hide abstract]
ABSTRACT: The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea.Euphytica 01/2004; 138(1):81-88. · 1.55 Impact Factor -
Article: Chloroplast inheritance patterns in Actinidia hybrids determined by single stranded conformation polymorphism analysis.
[show abstract] [hide abstract]
ABSTRACT: The inheritance patterns of the chloroplast genomes of the Actinidia hybrids A. eriantha (male parent) x A. chinensis (female parent) and A. chinensis (male parent) x A. melanandra (female parent) were analyzed using single-strand conformation polymorphism (SSCP) analysis of the trnL-trnF and psbA-trnH intergenic spacers. This showed that the artificial hybrids between A. eriantha and A. chinensis all had the haplotype of their male parent. Alignment of the sequences of A. eriantha and A. chinensis revealed four substitutions and one insertion (GATTC) in trnL-trnF and two substitutions in psbA-trnH. In contrast, the haplotypes of the artificial hybrids between A. chinensis and A. melanandra had the same patterns as their female parent. Alignment of the entire region of A. chinensis and A. melanandra revealed 12 substitutions: 1 in trnL-trnF and 11 in psbA-trnH. However, no sequence variation in the trnL-trnF and psbA-trnH intergenic spacers was found. We have developed a simple screening method for detecting the inheritance patterns of Actinidia chloroplast DNA haplotypes using SSCP analysis of the trnL-trnF and psbA-trnH intergenic spacers. Our findings indicate that the inheritance of the chloroplast genome in Actinidia hybrids differs according to the species selected.Molecules and Cells 05/2003; 15(2):277-82. · 2.18 Impact Factor -
Article: Genetic characterization of horse bone excavated from the Kwakji archaeological site, Jeju, Korea.
[show abstract] [hide abstract]
ABSTRACT: We determined the nucleotide sequences of the hypervariable D-loop region of mitochondrial DNA (mtDNA) from horse bone (humerus, A.D. 700 to A.D. 800) that was excavated from the Kwakji archaeological site, Jeju, Korea. We compared them with ones from extant horses. We designed three pairs of oligonucleotide primers from the tRNA-Thr and tRNA-Phe gene regions of mtDNA that are highly conserved among many other animal species. We cloned 232, 336, and 644 bp from the horse bone in order to determine the mtDNA D-loop sequence. The sequence was 1,124 bp long; the middle contained 19 tandem repeats of an 8-bp sequence (TGTGCACC) that is specific to equines. The mtDNA D-loop region contained each base (total number, percentage of total) as follows: A (317, 28.20%), C (336, 29.89%), G (169, 15.04%), and T (302, 26.87%). This sequence, like those of other horse populations, was AT rich. Sequence divergence was the lowest (1.71%) between the ancient horse bone and that of the Thoroughbred horse 1. The neighbor-joining and strict consensus tree of three of the most parsimonious trees also suggested that the ancient bone was considerably unrelated to native Jeju horses. The molecular phylogenetic characteristics of the horse bone that was excavated from the Kwakji archaeological site (Jeju, Korea) showed that some horse breeds may have existed on Jeju Island, Korea before Mongolian horses were introduced. The horse bone that was excavated from the Kwakji archaeological site may aid future research on the origin and ancestry of native Jeju horses.Molecules and Cells 11/2002; 14(2):224-30. · 2.18 Impact Factor -
Article: Investigation of the phylogenetic relationships within the genus Citrus (Rutaceae) and related species in Korea using plastid trnL-trnF sequences
[show abstract] [hide abstract]
ABSTRACT: The phylogenetic relationships within the genus Citrus and related species found in Korea were analyzed by comparing the trnL-trnF intergenic spacer sequences of the chloroplast DNA (cpDNA). All 21 accessions had trnL-trnF sequences of identical length, 372 base pairs (bp). Of the 377 aligned positions in the trnL-trnF regions of these species, 67 sites were variable (17.8%, 67/377). Pairwise sequence divergences in the trnL-trnF region ranged from 0 to 3.2% in the ingroup accessions and from 8.8 to 10.9% between the in- and the outgroup species Phellodendron amurense. The greatest divergence (3.2%) was between C. aurantium and C. natsudaidai. A phylogenetic tree was generated based on maximum parsimony (MP) analysis of the trnL-trnF sequences data from 22 accessions, including the outgroup taxon, producing 17 equally most parsimonious trees. The consensus tree contained eight independent clusters. Cluster I contained C. platymamma, which has a collared fruit shape, unique among Korean Citrus. Cluster II contained mostly mandarin and pummelo accessions. Cluster V contained C. sunki and six accessions of C. unshiu. Four of six C. unshiu accessions had identical sequences. In addition, Nagami kumquat (Fortunella margarita) was phylogenetically close to Citrus, whereas the trifoliate orange (Poncirus trifoliate) was distant from Korean Citrus species, both local species and cultivars. These results confirmed that analyses of cpDNA trnL-trnF sequences can detect enough polymorphisms to differentiate Korean Citrus species and to determine their phylogenetic relationships.Scientia Horticulturae 104(2):179-188. · 1.53 Impact Factor
Top co-authors
Top Journals
Institutions
-
2012
-
Southwest Research Institute
San Antonio, TX, USA
-
-
2007–2010
-
Biodiversity Research Institute
Gorham, ME, USA
-
-
2002–2006
-
Jeju National University
Ansan, Gyeonggi, South Korea
-
