-
[show abstract]
[hide abstract]
ABSTRACT: Alpha- and flaviviruses contain class II fusion proteins, which form ion-permeable pores in the target membrane during virus entry. The pores generated during entry of the alphavirus Semliki Forest virus have been shown previously to be blocked by lanthanide ions. Here, analyses of the influence of rare earth ions on the entry of the flaviviruses West Nile virus and Uganda S virus revealed an unexpected effect of lanthanide ions. The results showed that a 30 s treatment of cells with an appropriate lanthanide ion changed the cellular chemistry into a state in which the cells no longer supported the multiplication of flaviviruses. This change occurred in cells treated before, during or after infection, did not inhibit multiplication of Semliki Forest virus and did not interfere with host-cell multiplication. The change was generated in vertebrate and insect cells, and was elicited in the presence of actinomycin D. In vertebrate cells, the change was elicited specifically by La(3+), Ce(3+), Pr(3+) and Nd(3+). In insect cells, additional lanthanide ions had this activity. Further analyses showed that lanthanide ion treatment blocked the ability of the host cell to support the replication of flavivirus RNA. These results open two areas of research: the study of molecular alterations induced by lanthanide ion treatment in uninfected cells and the analysis of the resulting modifications of the flavivirus RNA replicase complex. The findings possibly open the way for the development of a general chemotherapy against flavivirus diseases such as Dengue fever, Japanese encephalitis, West Nile fever and yellow fever.
Journal of General Virology 12/2007; 88(Pt 11):3018-26. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Semliki Forest virus (SFV) is enveloped by a lipid bilayer enclosed within a glycoprotein cage made by glycoproteins E1 and E2. E1 is responsible for inducing membrane fusion, triggered by exposure to the acidic environment of the endosomes. Acidic pH induces E1/E2 dissociation, allowing E1 to interact with the target membrane, and, at the same time, to rearrange into E1 homotrimers that drive the membrane fusion reaction. We previously reported a preliminary Calpha trace of the monomeric E1 glycoprotein ectodomain and its organization on the virus particle. We also reported the 3.3 A structure of the trimeric, fusogenic conformation of E1. Here, we report the crystal structure of monomeric E1 refined to 3 A resolution and describe the amino acids involved in contacts in the virion. These results identify the major determinants for the E1/E2 icosahedral shell formation and open the way to rational mutagenesis approaches to shed light on SFV assembly.
Structure 02/2006; 14(1):75-86. · 6.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Recently, class II fusion proteins have been identified on the surface of alpha- and flaviviruses. These proteins have two functions besides membrane fusion: they generate an isometric lattice on the viral surface and they form ion-permeable pores at low pH. An attempt was made to identify inhibitors for the ion pores generated by the fusion proteins of the alphaviruses Semliki Forest virus and Sindbis virus. These pores can be detected and analysed in three situations: (i) in the target membrane during virus entry, by performing patch-clamp measurements of membrane currents; (ii) in the virus particle, by studying the entry of propidium iodide; and (iii) in the plasma membrane of infected cells, by Fura-2 fluorescence imaging of Ca2+ entry into infected cells. It is shown here that, at a concentration of 0.1 mM, rare earth ions block the ion permeability of alphavirus ion pores in all three situations. Even at a concentration of 0.5 mM, these ions do not block formation of the viral fusion pore, as they do not inhibit entry or multiplication of alphaviruses. The data indicate that ions flow through the ion pores into the virus particle in the endosome and from the endosome into the cytoplasm after fusion of the viral envelope with the endosomal membrane. These ion flows, however, are not necessary for productive infection. The possibility that the ability of class II fusion proteins to form ion-permeable pores reflects their origin from protein toxins that form ion-permeable pores, and that entry via class II fusion proteins may resemble the entry of non-enveloped viruses, is discussed.
Journal of General Virology 01/2006; 86(Pt 12):3311-20. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The influence of hypertonicity of the growth medium on polyribosome structure in Hela cells was measured after double labelling of the cells under conditions where the ribosomal RNA and the polyribosomal messenger RNA were labelled with [14C]uridine and [3H]uridine, respectively.Increase of the tonicity of the growth medium by addition of NaCl or sucrose leads to a total disaggregation of the cellular polyribosomes within less than 10 min. The process is fully reversible, even if RNA synthesis is blocked by high doses of actinomycin D, and can be repeated at least twice under these conditions.This reaction is probably caused by a specific block of initiation of protein synthesis under these conditions.The ribosomes are set free as 80-S monoribosomes free of messenger RNA, which is found in the lysate in the form of ribonucleoprotein complexes of widely varying sedimentation velocities.Some possible implications of these findings are discussed.
European Journal of Biochemistry. 03/2005; 27(1):162 - 173.
-
European Journal of Biochemistry. 03/2005; 24(3):477 - 484.
-
[show abstract]
[hide abstract]
ABSTRACT: Studies using the alphavirus Semliki Forest virus have indicated that the viral E1 fusion protein forms two types of pore: fusion pores and ion-permeable pores. The formation of ion-permeable pores has not been generally accepted, partly because it was not evident how the protein might form these different pores. Here it is proposed that the choice of the target membrane determines whether a fusion pore or ion-permeable pores are formed. The fusion protein is activated in the endosome and for steric reasons only a fraction of the activated molecules can interact with the endosomal membrane. This target membrane reaction forms the fusion pore. It is proposed that the rest of the activated molecules interact with the membrane in which the protein is anchored and that this self-membrane reaction leads to formation of ion-permeable pores, which can be detected in the target membrane after fusion of the viral membrane into the target membrane.
Journal of General Virology 07/2004; 85(Pt 6):1695-701. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Recently, we presented evidence that the E1 fusion protein of the alphavirus Semliki Forest virus forms ion-permeable pores in the target membrane after fusion. We proposed that the homologous fusion proteins of flaviviruses and hepatitis C virus form similar pores. To test this hypothesis for the E fusion protein of flaviviruses, the release of [(3)H]choline from liposomes by the flavivirus West Nile (WN) virus was determined. [(3)H]Choline was released at mildly acid pH. The pH threshold depended on the lipid composition. Release from certain liposomes was activated even at neutral pH. To identify the generation of individual pores, single cells were investigated with the patch-clamp technique. The formation of individual pores during low pH-induced WN virus entry at the plasma membrane occurred within seconds. These experiments were performed in parallel with Semliki Forest virus. The results indicated that, similar to alphavirus infection, infection with flaviviruses via endosomes leads to the formation of ion-permeable pores in the endosome after fusion, which allows the flow of protons from the endosome into the cytoplasm during virus entry. However, in vitro translation experiments of viral cores showed that, in contrast to alphaviruses, which probably need this proton flow for core disassembly, the genome RNA of WN virus present in the viral core is directly accessible for translation. For entry of flaviviruses, therefore, a second pathway for productive infection may exist, in which fusion of the viral membrane is activated at neutral pH by contact with a plasma membrane of appropriate lipid composition.
Journal of General Virology 08/2003; 84(Pt 7):1711-21. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Alphaviruses are small enveloped viruses that have been used extensively as model enveloped viruses. During infection, virus particles are taken up into endosomes, where a low pH activates the viral fusion protein, E1. Fusion of the viral and the endosomal membranes releases the viral core into the cytoplasm where cores are disassembled by interaction with 60S ribosomal subunits. Recently, we have shown that in vitro this disassembly is strongly stimulated by low pH. We have proposed that after entry of the core into the cytoplasm, the viral membrane proteins that have been transferred to the endosomal membrane form an ion-permeable pore in the endosome. The resulting flow of protons from the endosome into the cytoplasm through this pore could generate a low-pH environment for core disassembly in vivo. Here we report two types of analysis aimed at the identification of such pores. First, the release of [3H]choline from the interior of liposomes was analysed in the presence of virus particles and viral proteins. Secondly, cells were infected with Sindbis or Semliki Forest alphaviruses at the plasma membrane and the possible generation of ion-permeable pores during this process was analysed by whole-cell voltage clamp analysis of the membrane current. The results obtained indicated that the proposed pores are in fact generated and allowed us to identify the formation of individual pores. Available evidence indicates that the alphavirus E1 protein probably forms these pores. Proteins homologous to the alphavirus E1 protein are present in flaviviruses and hepatitis C virus.
Journal of General Virology 02/2003; 84(Pt 1):173-81. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Disassembly of alphavirus cores early in infection involves interaction of the core with 60S ribosomal subunits. This interaction might be subjected to regulatory processes. We have established an in vitro system of core disassembly in order to identify cellular proteins involved in the regulation of disassembly. No evidence for the existence of such proteins was found, but it became apparent that certain organic solvents and detergents or a high proton concentration (pH 6.0) stimulated core disassembly. Alphaviruses infect cells by an endosomal pathway. The low pH in the endosome activates a fusion activity of the viral surface protein E1 and leads to fusion of the viral membrane with the endosomal membrane, followed by release of the core into the cytoplasm. Since the presence of the E1 protein in the plasma membrane of infected cells leads to increased membrane permeability at low pH, our findings indicate that disassembly of alphavirus cores could be regulated by the proton concentration. We propose that the viral membrane proteins present in the endosomal membrane after fusion form a pore, which allows the flow of protons from the endosome into the cytoplasm. This process would generate a region of low pH in the cytoplasm at the correct time and place to allow the efficient disassembly of the incoming viral core by 60S subunits.
Journal of General Virology 11/2002; 83(Pt 10):2417-26. · 3.36 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Alphaviruses are isometric enveloped viruses approximately 70 nm in diameter. The viral surface contains 80 glycoprotein spikes arranged in aT= 4 lattice. Each of these spikes consists of three heterodimers of the viral membrane proteins E1 (approximately 49 kDa) and E2 (approximately 51 kDa). Cryoelectron microscopic analyses have shown that the spikes form a protein shell on the viral surface. We have made an attempt to isolate biologically active protein fragments from this surface and to grow crystals from such fragments. To this end membrane proteins were extracted with Nonidet-P40 from the Semliki Forest alphavirus and the proteins were separated from detergent by centrifugation. A protein complex containing the E1 and E2 molecules in quantitative yield was obtained by this procedure. This complex has the following properties: It sediments at approximately 30S, it chromatographs with an apparent molecular mass of approximately 580,000 Da during gel filtration, it cannot be dissociated by either nonionic detergents or 6 M urea, and at acid pH it is a highly active hemagglutinin. The data indicate that this 30S hemagglutinin complex, which has not been hitherto described for alphaviruses, may represent a variant form of the protein lattice present on the alphavirus surface. Cleavage of this complex by subtilisin selectively removes carboxy-terminal sequences from the E1 and E2 proteins, which contain the cytoplasmic and transmembrane segments of the proteins and a small part of their ectodomain. The remaining ectodomains are called E1ΔS and E2ΔS. This proteolysis also leads to dissociation of the 30S complex. The cleavage products accumulate in the form of a heterodimer of the E1ΔS and E2ΔS proteins. Treatment of the heterodimer with PNGase F leads to rapid removal of carbohydrate from the E2ΔS protein and a dissociation of the complex into the constituent molecules, which can be separated by chromatography. The finding that the heterodimer and the purified E1ΔS protein both function as hemagglutinin at acid pH indicates that the E1 protein represents the alphavirus hemagglutinin. We have obtained crystals of the E1ΔS protein and are currently in the process of determining the atomic structure of this protein by the isomorphous replacement method.
Virology 06/1999; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The surface of Rubella virus contains the glycoproteins E1 and E2. The E1 protein induces neutralizing antibodies and has been implicated in the process of recognition of cellular receptors. To gain information on the structural organization of the E1 protein we have analyzed the disulfide bonds present within this molecule. The reactivity of the protein with radioactively labeled iodoacetic acid indicates that all 20 cysteine residues present in the ectodomain of the E1 protein are involved in disulfide formation. E1 protein was purified by preparative SDS–PAGE under nonreducing conditions from virus particles grown in tissue culture in the presence of [35S]cysteine. The purified protein was digested with a number of proteases followed by reversed phase high-performance liquid chromatography (HPLC). [35S]cysteine-containing peptides were identified and characterized by N-terminal amino acid sequence determination. These analyses identified the following eight disulfide bridges: C(1)–C(2); C(3)–C(15); C(6)–C(7); C(9)–C(10); C(11)–C(12); C(13)–C(14); C(17)–C(18); and C(19)–C(20). The two disulfide bridges formed by the residues C(4), C(5), C(8), and C(16) have not been identified with certainty, but a likely organization can be derived. The data obtained are discussed in the context of a possible structural and functional organization of the E1 protein.
Virology 05/1997; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Early in infection core protein is transferred from alphavirus cores to ribosomes (Wengler and Wangler, 1984, Virology 134, 435–442) and it has been suggested that ribosome binding is a property of alphavirus core protein which is involved in core disassembly. Here we describe in vitro analyses of this transfer. Sindbis virus cores, incubated with ribosomes either in a reticulocyte lysate or in buffer, are disassembled with a concomitant transfer of core protein to the large ribosomal subunit. Preincubation of ribosomes with core protein blocks disassembly. Limited proteolysis of Sindbis virus core releases the carboxy-terminal core protein domain as a soluble fragment (Strong and Harrison, 1990, J. Virol. 64, 3992–3994). Trypsin- or proteinase Lys-C-released fragments contain the amino-terminal residue met (106) or gln (94), respectively. The fragment generated by proteinase Lys-C binds to ribosomes and interferes with core disassembly whereas the slightly shorter tryptic fragment has none of these activities. These and further analyses indicate that a conserved sequence element which surrounds amino acid met (106) of SIN CP, the so-called RBSc, element, leads to binding of core protein to ribosomes and thereby to core disassembly. Implications of the experiments for regulation of assembly of alphavirus cores and for the core protein-induced resistance to viral multiplication observed in plant virus systems are discussed.
Virology 01/1993; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Recently it has been reported that a membrane fraction can be isolated from West Nile virus-infected BHK cells which contains the viral nonstructural (NS) proteins as major constituents (Wangler et al., 1990). In this report we show that treatment of these membranes with subtilisin releases the carboxy-terminal segment of the NS 3 protein as a soluble protein of about 50 kDa apparent molecular weight. This molecule, which is called the p50-S protein, can be purified by standard chromatographic procedures. The p50-S protein binds to poly(A) and apparently represents a nucleoside triphosphatase which is stimulated in the presence of ssRNA molecules. The data represent experimental support for the predicted role of this segment of the NS 3 protein as an RNA helicase. Some properties of the p50-S protein are described and a possible function of this protein segment during RNA synthesis is discussed.
Virology 11/1991; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: In order to analyze the organization of the membrane proteins pre M, M, and E of the West Nile (WN) flavivirus we have studied the influence of proteolytic cleavage of intact virus on the structure of these proteins. The amino acid sequence of all proteins is known, all six disulfides present in the viral E protein have been identified, and it has been suggested that the E protein contains regions R1, L1, R2, L2, and R3, which together form the E protein ectodomain followed by a car☐yterminal membrane anchor region(Th. Nowak and G. Wengler (1987) Virology 156, 127–137). The results of our analyses can be summarized as follows: (1) The surface of the WN virus contains E protein oligomers; the E protein molecules present in these structures contain two segments which are exposed to proteolytic attack; the segments are located in parts L1 and R3 of the E protein. (2) Proteolytic cleavage of these oligomers in these regions neither destroys nor releases the oligomers from the viral surface. (3) The WN virus surface contains a layer of 7-nm ring-shaped subunits identifiable by electron microscopy which are neither destroyed nor released by proteolytic cleavage. (4) An E protein trimer can be isolated from the surface of protease-treated WN virus. This trimer is morphologically similar to the 7-nm ring-shaped element which can be identified on the surface of native and protease-treated WN virus by electron microscopy.
Virology 10/1987; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Flaviviruses contain a large membrane-associated protein V3, having a mol mass of about 50 kDa which is responsible for hemagglutination. We have isolated the V3 protein from the West Nile (WN) flavivirus and determined its amino-terminal amino acid sequence and amino acid sequences of fragments derived from this protein. We have also transcribed parts of the WN virus genome RNA into cDNA and cloned and sequenced this CDNA. The results of these analyses have allowed us to identify the region of the viral genome coding for the V3 protein. In this report we describe the total nucleotide sequence of the genome region coding for the WN virus V3 protein and the amino acid sequence of the V3 protein derived from these analyses. The exact carboxy terminus of the V3 protein has not been determined in these experiments. These analyses have shown that the V3 protein of WN virus does not contain an Asn-X-Ser/Thr sequence which could allow addition of N-linked carbohydrate chains to this protein. In accordance with this finding, analyses of metabolic labeling of the V3 protein using [3H]glucosamine indicate that the WN virus V3 protein is an unglycosylated protein. Together with our earlier analyses these results show that the viral structural proteins are present on the genome RNA in the order 5′-terminuscore protein (V2)-small membrane-associated protein (NV2)-large membrane-associated protein (V3) and describe the nucleotide sequences coding for all WN virus structural proteins identified so far. A hypothesis concerning the processes involved in the synthesis of all viral structural proteins and the probable orientation of these proteins relative to the endoplasmatic reticulum membrane based on the structure of these proteins is discussed.
Virology 01/1986; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Cell-associated flaviviruses contain the two membrane proteins V3 and NV2 besides the viral core protein V2 whereas extracellular viruses do contain V2 protein and the two membrane proteins V3 and V1. Since the V1 protein could not be detected in infected cells it has been suggested that V1 is generated from NV2 by proteolytic cleavage during the release of virus from cells (D. Shapiro, W. E. Brandt, and P. K. Russell (1972), Virology50, 906–911). We have isolated the viral structural proteins V1, V2, and NV2 from the flavivirus West Nile virus and determined their amino-terminal amino acid sequences and amino acid sequences of peptides derived from these proteins. We have also transcribed parts of the viral genome into cDNA and cloned and sequenced this cDNA. The analyses of the protein structure of V1, V2, and NV2 together with the determination of the amino-terminal sequence of V3 (data not shown) have allowed us to identify the nucleotide region coding for the structural proteins V2, NV2, and V1. The primary structure of this nucleotide sequence is presented in this report. The data show that the amino terminus of the viral core protein V2 is followed by the amino termini of the proteins NV2, V1, and V3, respectively. These data for the first time identify the exact order of all structural proteins of a flavivirus identified so far. Our data strongly support the above-mentioned hypothesis that V1 is derived from NV2 by proteolytic cleavage and furthermore indicate that V1 represents the nonglycosylated carboxy-terminal part of NV2 which contains those sequences which anchor NV2 in the viral membrane. A working hypothesis is presented in which two species of cellular enzymes, signalase(s) removing signal sequences and enzymes involved in cleaving polyproteins after a pair of basic amino acids, do generate the proteins V2, NV2, and V1 from the growing peptide chain synthesized during translation of the 42 S genome RNA which functions as mRNA for these proteins.
Virology 10/1985; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: Core-like (CL) particles which closely resemble alphavirus cores in size, shape, and relative amount of nucleic acid and protein have been assembled in vitro from Sindbis (SIN) virus core (C) protein and single-stranded nucleic acids in buffer containing 1 M urea [G. Wengler, U. Boege, G. Wengler, H. Bischoff, and K. Wahn (1982)Virology118, 401–410]. We have now analyzed the interaction of SIN virus C protein and nucleic acids in vitro under conditions designed to resemble those present in the cell during core assembly. In buffer containing 100 mM K-acetate, 1.7 mM Mg-acetate, pH 7.4, CL particles are efficiently assembled from all single-stranded nucleic acids analyzed, and even heparin and polyvinylsulfate are incorporated into such particles. A reticulocyte lysate translates SIN virus-specific mRNA into C protein under these ionic conditions. Interactions of C protein with nucleic acids and ribosomes in a reticulocyte lysate have also been analyzed. The following conclusions can be drawn from these analyses: (1) In accordance with earlier findings [N. Glanville and I. Ulmanen (1976) Biochem. Biophys. Res. Commun.71, 393–399] the C protein translated in vitro efficiently binds to ribosomes. (2) Exogenously added C protein binds to the large subunit of the ribosomes in the lysate. (3) CL particles can be assembled in the lysate from exogenous added 42 S genome RNA and exogenous added C protein if both components are present at sufficiently high concentrations. (4) The C protein translated from viral mRNA in the lysate is transferred from the ribosomes into preassembled CL particles containing 42 S RNA in the lysate. (5) If only small amounts of CL particles are added into a lysate these particles disaggregate and core protein molecules are transferred from the particles to the large subunit of the ribosomes. The results on the assembly of CL particles in vitro allow the formulation of some hypotheses concerning the assembly and disassembly of core particles in vivo.
Virology 02/1984; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m7GpppAUAG and m7GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories (Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus (Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.
Virology 01/1983; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: A system has been developed that allows the reconstruction of a core-like (CL) ribonucleoprotein (RNP) from Sindbis virus-specific core protein and genome RNA in vitro. The RNP particles were analyzed by equilibrium density gradient centrifugation and electron microscopy. The CL RNP is similar in size, shape, and texture to authentic viral core. The assembly of the homologous CL RNP in vitro depends on the relative concentrations of protein and RNA in the reaction: At low concentrations of protein incomplete particles of rather high density are made; increase of the protein concentration leads to an optimum concentration at which the protein is quantitatively incorporated into complete CL particles; further increase in protein concentration leads to the formation of a precipitate which has not been analyzed in detail. No identifiable structures were generated in vitro in the absence of nucleic acid, but all single-stranded deoxyribonucleic and ribonucleic acids analyzed were incorporated into particles similar to those formed in the presence of viral genome RNA. These complexes are called heterologous CL nucleoproteins. Since nucleic acids differing in size between about 100 and 6000 nucleotides (e.g., tRNA and fd DNA), which vary widely in secondary structure are efficiently incorporated into heterologous CL particles, probably all single-stranded nucleic acids in this size range can be efficiently incorporated into such particles in vitro. Some implications of a possible interaction between viral core protein and single-stranded nucleic acids other than the viral genome in vivo, e.g., during the synthesis of defective interfering particles or during inhibition of host cell DNA synthesis, are discussed.
Virology 05/1982; · 3.35 Impact Factor
-
[show abstract]
[hide abstract]
ABSTRACT: The amino acid sequences of the core proteins of the alphaviruses Sindbis virus and Semliki Forest virus have been analyzed. The complete primary structures of both proteins are presented. At a few points in the N-terminal sequence regions the nucleotide sequences of the mRNA coding for the proteins (Garoff et al., Proc. Nat. Acad, Sci. USA77, 6376–6380,1980; Rice and Strauss, Proc. Nat. Acad. Sci. USA78, 2062–2066, 1981) have been used to align peptides. The N-terminal part of the proteins is rich in basic amino acids and proline, whereas the C-terminal region of the molecules does not show a preponderance of a specific type of amino acid. The transition between the two regions occurs in the region around amino acid residue 110. Whereas extensive sequence homology exists in the C-terminal part of both molecules (113 out of 163 amino acid residues are present in identical sequences) the sequence homology present in the N-terminal part is less pronounced. The data indicate that the physicochemical properties rather than the exact amino acid sequence are conserved in the N-terminal parts of the proteins. Both proteins contain the amino acid sequence Gly-Asp-Ser-Gly characteristic of eukaryotic serine proteases in the C-terminal highly conserved region of the molecule. Possible functions of both parts of the alphavirus-specific core proteins in the assembly of the virus and in the synthesis of viral structural proteins are discussed.
Virology 09/1981; · 3.35 Impact Factor
