Immanuel Rode

Max Planck Institute of Immunobiology and Epigenetics, Freiburg, Baden-Württemberg, Germany

Are you Immanuel Rode?

Claim your profile

Publications (3)41.77 Total impact

  • Source
    Immanuel Rode, Thomas Boehm
    [Show abstract] [Hide abstract]
    ABSTRACT: Involution of the thymus is accompanied by a decline in the number of thymic epithelial cells (TECs) and a severely restricted peripheral repertoire of T-cell specificities. TECs are essential for T-cell differentiation; they originate from a bipotent progenitor that gives rise to cells of cortical (cTEC) and medullary (mTEC) phenotypes, via compartment-specific progenitors. Upon acute selective near-total ablation during embryogenesis, regeneration of TECs fails, suggesting that losses from the pool of TEC progenitors are not compensated. However, it is unclear whether this is also true for the compartment-specific progenitors. The decline of cTECs is a prominent feature of thymic involution. Because cTECs support early stages of T-cell development and hence determine the overall lymphopoietic capacity of the thymus, it is possible that the lack of sustained regenerative capacity of cTEC progenitor cells underlies the process of thymic involution. Here, we examine this hypothesis by cell-type-specific conditional ablation of cTECs. Expression of the human diphtheria toxin receptor (hDTR) gene under the regulatory influence of the chemokine receptor Ccx-ckr1 gene renders cTECs sensitive to the cytotoxic effects of diphtheria toxin (DT). As expected, DT treatment of preadolescent and adult mice led to a dramatic loss of cTECs, accompanied by a rapid demise of immature thymocytes. Unexpectedly, however, the cTEC compartment regenerated after cessation of treatment, accompanied by the restoration of T-cell development. These findings provide the basis for the development of targeted interventions unlocking the latent regenerative potential of cTECs to counter thymic involution.
    Proceedings of the National Academy of Sciences 02/2012; 109(9):3463-8. · 9.81 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: About 500 million years ago, a new type of adaptive immune defense emerged in basal jawed vertebrates, accompanied by morphological innovations, including the thymus. Did these evolutionary novelties arise de novo or from elaboration of ancient genetic networks? We reconstructed the genetic changes underlying thymopoiesis by comparative genome and expression analyses in chordates and basal vertebrates. The derived models of genetic networks were experimentally verified in bony fishes. Ancestral networks defining circumscribed regions of the pharyngeal epithelium of jawless vertebrates expanded in cartilaginous fishes to incorporate novel genes, notably those encoding chemokines. Correspondingly, novel networks evolved in lymphocytes of jawed vertebrates to control the expression of additional chemokine receptors. These complementary changes enabled unprecedented Delta/Notch signaling between pharyngeal epithelium and lymphoid cells that was exploited for specification to the T cell lineage. Our results provide a framework elucidating the evolution of key features of the adaptive immune system in jawed vertebrates.
    Cell 07/2009; 138(1):186-97. · 31.96 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: GCCATGGAACCTTCTAGTCCTAAGAAGAAGAGAAAGGTGTCTAGAGGA; initiation codon underlined) followed by nt 901-1428 in accession number X81593 (encoding the Mus musculus Foxn1 forkhead DNA binding domain), followed by a linker encoded by TCTAGTTATTCAGGGTCAGGCTCAGGT and nt 172-1053 in accession number M10017 encoding the repression domain (enRD) of the D. melanogaster engrailed gene followed by CTCTAG providing an in-frame stop codon. The full-length M. musculus Foxn1 cDNA corresponds to the entire sequence in accession number X81593. The wild-type Foxn1 and the Foxn1-enRD fragments were cloned into the heat-inducible pSGH2 expression construct (Bajoghli et al., 2004). The final constructs were injected at 30-40 ng/µl together with 0.5 units/µl I-SceI meganuclease (New England Biolabs) into blastomeres at the one-cell stage. For screening, 9dpf embryos were heat-treated at 39°C for 15 min. About twenty embryos for each construct with the strongest gfp expression were selected for breeding. Mature F0 fish were in-crossed and their F1 progeny was assayed for gfp expression after heat shock. All F2 transgenic offspring showed identical and reproducible results after heat treatment and were used for the experiments.