Are you E Borsali?

Claim your profile

Publications (11)15.15 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5'TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5'TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. Detection of fungi in corneal samples by HRM. High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction.
    Ophthalmology 02/2012; 119(5):945-50. · 5.56 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: We report a case of a 67-year-old woman with no significant past ocular history, who was referred for management of an unresponsive microbial keratitis resulting from trauma with a piece of clothing fabric 1 month previously in Portugal and worsening despite topical fortified antibiotics. On examination, visual acuity was limited to "light perception". Slit lamp examination revealed an 11×11mm full-thickness corneal infiltrate. Confocal images showed branching hyphae suggestive of a fungal infection. Fungal cultures of corneal scrapings revealed growth of Cylindrocarpon lichenicola, a saprophytic, filamentous fungus, which is an unusual cause of keratitis. Despite aggressive antifungal therapy with voriconazole and amphotericin B, she required penetrating keratoplasty for impending corneal perforation. Follow-up was uneventful, with no recurrence at 1 year. Fungal infections must be suspected in all corneal ulcers of traumatic etiology. Specific cultures and confocal microscopy must be performed early, so as to enable early treatment modification.
    Journal francais d'ophtalmologie 12/2011; 35(5):356.e1-5. · 0.51 Impact Factor
  • Médecine et Maladies Infectieuses 11/2011; 41(12):665-6. · 0.75 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Purpose Acanthamoeba keratitis (AK) is a sight-threatening infection. Classic PCR enhanced sensitivity but required post-amplification procedures, increasing contamination risks. The reported real-time PCRs are unable to detect all the genotypes associated with pathology. We present a new strategy validated American Type Cell Collection strains and corneal scrapings.Methods A were detected by a fast PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green. Sequences selected in the mitochondrion were: forward primer: 5‘GCAGTCGCGGTAATACGA; reverse: 5’ACCACCTACGCACCCTTTACA and probe: 6-FAM-AGTGTTATTCGCATTGACTGGGTGTAA-TAMRA.Results The new test detects all A with different lab equipment (1 cyst or less/specimen). A.astronyxis signals are inferior to others; however, primers diluted in SYBR Green mix (without probe) detect 0.1 cyst/µl or less of this strain. For clinical samples microscopic examination and cultures detected 6 out 10 but f-d-real-t PCR 100% with results confirmed by SYBR Green. Other PCRs bracketing different regions (ribosome) detected 80 % and produced false positives for samples containing Salmonella lexinton, C. sporulans, S. marcescens and Propionibacteria.Conclusion Highly sensitive diagnosis is necessary to administrate efficient treatments at the onset of AK. The strains from the ATCC with higher sensitivity and specificity than techniques previously reported. New approaches based on High Resolution Melting r-t PCR are in development in the CHNO to detect and molecularly characterize in one run different strains of protozoa and Fungi infecting the eye.
    Acta ophthalmologica 09/2011; 89(s248). · 2.44 Impact Factor
  • Médecine et Maladies Infectieuses 03/2011; 41(6):345-6. · 0.75 Impact Factor
  • Source
    Acta ophthalmologica 03/2011; 89(2):e215-6. · 2.44 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: IntroductionBacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing.
    Pathologie Biologie - PATHOL BIOL. 01/2011; 59(5):248-255.
  • [Show abstract] [Hide abstract]
    ABSTRACT: A 68-year-old woman presented with a painless inflammation of the right superior eyelid that had started several weeks before. The clinical diagnosis concluded in canaliculitis and the solid concretions were surgically extracted from the superior canalicula. The anaerobic bacteria Fusobacterium nucleatum sp. nucleatum was isolated. Signs dramatically regressed two weeks after surgery followed by one course of oral amoxicillin and clavulanic acid associated with topical tobramycin. The clinical signs had disappeared two months later.
    Journal francais d'ophtalmologie 01/2011; 34(3):188.e1-4. · 0.51 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: To study the usefulness of in vivo confocal microscopy imaging for the diagnosis of Acanthamoeba keratitis. A retrospective review of 50 cases of Acanthamoeba keratitis followed at the Quinze-Vingts National Ophthalmology Hospital from January 2005 to July 2008 was conducted. Gender, age, contact lens wear, best-corrected visual acuity before and after treatment, slit-lamp examination findings, corneal scrapings for biological analysis, and in vivo confocal microscopy images were analyzed. Nearly 82% of the cases of keratitis had a history of contact lens wear. Polymerase chain reaction (PCR) was positive for 40% of the samples. Heidelberg Retinal Tomograph II-Rostock Cornea Module (HRTII-RCM) examination detected images evoking Acanthamoeba cyst-like images in 84% of the cases. When the quality of biological samples was inadequate, the assessment of Acanthamoeba cysts using in vivo confocal microscopy made it possible to orient the diagnosis and to partially explain favorable progression under treatment. This technique showed images suggesting combined Acanthamoeba and fungal keratitis. HRTII-RCM in vivo confocal microscopy is a non invasive and rapid technique that may be helpful for the diagnosis of Acanthamoeba keratitis, especially when laboratory testing is not contributive and when Acanthamoeba keratitis is combined with a fungal infection.
    Journal francais d'ophtalmologie 05/2010; 33(6):383-90. · 0.51 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. The frt PCR detects 0,01 CFU/μl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.
    Pathologie Biologie 11/2009; 59(5):248-55. · 1.67 Impact Factor
  • Journal Francais D Ophtalmologie - J FR OPHTALMOL. 01/2009; 32.