Sen Lin

Peking University, Beijing, Beijing Shi, China

Are you Sen Lin?

Claim your profile

Publications (9)31.53 Total impact

  • [Show abstract] [Hide abstract]
    ABSTRACT: A convenient efficient method for synthesis of a flexible cyclic polyamide (cβ, 1) was developed through cyclodimerization. Electrospray ionization mass spectrometry and nuclear magnetic resonance results showed that 1 selectively binds to the c-myb G-quadruplex with high affinity, and there was no binding with the ILPR, bcl-2, and c-kit G-quadruplexes. This is the first time that a flexible cyclic polyamide was found to have high selectivity for the c-myb G-quadruplex.
    Organic Letters 12/2012; · 6.14 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity. The 12-mer and 24-mer telomeric RNA sequences, r(UAGGGUUAGGGU) and r(UAGGGUUAGGGUUAGGGUUAGGGU), were synthesized by TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization ion-trap mass spectrometry was used to evaluate the binding affinities of three natural flexible cyclic molecules, tetrandrine, fangchinoline and cepharanthine, with the telomeric RNA G-quadruplexes. The fragmentation pathways of the G-quadruplexes and G-quadruplex-ligand complexes were investigated by tandem mass spectrometry. the natural flexible cyclic molecules were found to have high binding affinities to the 12-mer and 24-mer RNA G-quadruplexes with stoichiometry of 1:1 to 3:1. Collision-induced dissociation tandem mass spectrometry shows that the G-quadruplex-ligand complexes lose neutral ammoniums first and the small molecule ligand subsequently. Besides, among the three flexible cyclic molecules, cepharanthine binds most tightly to the RNA G-quadruplexes than tetandrine and fangchinoline. Three flexible cyclic small molecules were found to be potential telomeric RNA G-quadruplex ligands, especially cepharanthine, which has high affinity and binds most tightly to the RNA G-quadruplexes. These findings may provide further implications in the regulation of telomeric RNA and telomerase activity.
    Rapid Communications in Mass Spectrometry 08/2012; 26(16):1803-9. · 2.51 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Myocardial fibrosis is a key pathological change in a variety of heart diseases contributing to the development of heart failure, arrhythmias, and sudden death. Recent studies have shown that relaxin prevents and reverses cardiac fibrosis. Endogenous expression of relaxin was elevated in the setting of heart disease; the extent of such up-regulation, however, is insufficient to exert compensatory actions, and the mechanism regulating relaxin expression is poorly defined. In the rat relaxin-1 (RLN1, Chr1) gene promoter region we found presence of repeated guanine (G)-rich sequences, which allowed formation and stabilization of G-quadruplexes with the addition of a G-quadruplex interactive ligand berberine. The G-rich sequences and the G-quadruplexes were localized adjacent to the binding motif of signal transducer and activator of transcription (STAT)3, which negatively regulates relaxin expression. Thus, we hypothesized that the formation and stabilization of G-quadruplexes by berberine could influence relaxin expression. We found that berberine-induced formation of G-quadruplexes did increase relaxin gene expression measured at mRNA and protein levels. Formation of G-quadruplexes significantly reduced STAT3 binding to the promoter of relaxin gene. This was associated with consequent increase in the binding of RNA polymerase II and STAT5a to relaxin gene promoter. In cardiac fibroblasts and rats treated with angiotensin II, berberine was found to suppress fibroblast activation, collagen synthesis, and extent of cardiac fibrosis through up-regulating relaxin. The antifibrotic action of berberine in vitro and in vivo was similar to that by exogenous relaxin. Our findings document a novel therapeutic strategy for fibrosis through up-regulating expression of endogenous relaxin.
    Endocrinology 06/2012; 153(8):3692-700. · 4.72 Impact Factor
  • Xiaojie Cui, Sen Lin, Gu Yuan
    [Show abstract] [Hide abstract]
    ABSTRACT: The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1-P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1-P3 prefer the end-stacking mode with the G-quadruplex through π-π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1-P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.
    International journal of biological macromolecules 03/2012; 50(4):996-1001. · 2.37 Impact Factor
  • Sen Lin, Ming Xu, Gu Yuan
    [Show abstract] [Hide abstract]
    ABSTRACT: The G-quadruplexes formed from G-rich strands in the telomere and oncogene-promoter regions are regarded as new promising targets in the cancer therapy. A G-quadruplex in the downstream flanking region of the signal transducer and activator of transcription 3 (STAT3) gene was explored. Its folding patterns were proposed to be 3:2:2 and 3:3:1 loop isomers by the mutation analysis by CD spectroscopy. The structures were constructed and refined by molecular modeling method.
    Chinese Chemical Letters 03/2012; 23(3):329–331. · 1.18 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: It has been reported that binding of STAT3 protein to the 5'-flanking region of the relaxin gene may result in downregulation of the relaxin expression. There is a Guanine(G)-rich segment located in about 3.8 Kb upstream of the relaxin gene and very close to the STAT3's binding site. In our study, NMR spectroscopy revealed the formation of G-quadruplex by this G-rich strand, and the result was confirmed by ESI mass spectrometry and CD spectroscopy. The theoretical structure of RLX G-quadruplex was constructed and refined by molecular modeling. When this relaxin G-quadruplex was stabilized by berberine(ΔTm = 10°C), a natural alkaloid from a Chinese herb, the gene expression could be up-regulated in a dose-dependent manner which was proved by luciferase assay. This result is different from the general G-quadruplex function that inhibiting the telomere replication or down-regulating many oncogenes expression. Therefore, our study reported a novel G-quadruplex in the relaxin gene and complemented the regulation mechanism about gene expression by G-quadruplexes.
    PLoS ONE 01/2012; 7(2):e31201. · 3.53 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: G-Quadruplexes have been proved to exist in 5'-untranslated region (5'-UTR), promoter, intron and exon regions of many human genes. Here we report an intramolecular G-quadruplex formed by a G-rich sequence in the 3'-flanking region of signal transducers and activators of transcription 3 (STAT3) gene. The results showed that this G-rich sequence could affect the expression of STAT3. When the STAT3 G-quadruplex was stabilized by a novel non-planar ligand Cepharanthine (CEP), the decreased expression of STAT3 was observed in primary cultured cardiomyocytes. We also demonstrated that the down-regulation of STAT3 was most likely occurred at the transcriptional level. Our results provide a new clue for studying the G-quadruplex formation, recognition and function in the 3'-flanking region of gene.
    Bioorganic & medicinal chemistry letters 08/2011; 21(19):5987-91. · 2.65 Impact Factor
  • Source
    Rapid Communications in Mass Spectrometry 04/2011; 25(7):993-6. · 2.51 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: This study has demonstrated the formation of the G-quadruplex structure from the G-rich sequence in the promoter region of the bcl-2 oncogene; the formation could be induced by addition of NH(4)(+) or K(+) ions. The binding affinity and stoichiometry of seven small molecules with the G-quadruplex were examined by using ESI-MS, as well as CD and UV spectroscopy. The binding-affinity order was determined to be P1 approximately = P5 > P2 > P3 approximately = P4 > P7 > P6. In particular, the small-molecule induction of the structural transition between the G-quadruplex and duplex DNA forms in this promoter region was investigated by ESI-MS. We directly observed specific binding of dehydrocorydaline (P7) and cationic porphyrin (P5) in one system consisting of the G-quadruplex and the duplex DNA, respectively. The results indicate that P7 selectively stabilizes the G-quadruplex and shifts the equilibrium toward G-quadruplex formation of the bcl-2 promoter, whereas P5 converts the G-quadruplex into the duplex DNA, which results in strong and selective binding to the duplex form. Therefore, P5 and P7 with their attractive binding specificities could be considered as precursors for pathway-specific drug design for regulation of bcl-2 oncogene transcription.
    Chemistry - A European Journal 01/2009; 15(10):2445-52. · 5.93 Impact Factor