4G/5G polymorphism of the plasminogen activator inhibitor-1 gene and risk of restenosis after coronary artery stenting.

Abstract

Plasminogen activator inhibitor-1 (PAI-1) has been proposed as a candidate risk factor for restenosis after coronary artery stenting. Transcription, level, and activity of PAI-1 are influenced by the 4G/5G polymorphism in the promoter region of PAI-1 gene. The polymorphism may therefore affect wound-healing processes in injured blood vessels and influence restenosis.
In 1850 consecutive patients, angiographic measures of restenosis and the clinical outcome at 30 days and 1 year after stent implantation were evaluated. Angiographic restenosis was defined as > or =50% diameter stenosis determined at follow-up angiography, performed 6 months after stenting. The 4G/5G genotypes were determined with TaqMan technique.
Among the patients, the frequency of the 4G allele was 0.55. Follow-up angiography was done in 84% of the patients. We observed restenosis in 32.5% of 4G/4G carriers, 32.2% of 4G/5G carriers, and 35.7% of 5G/5G carriers (P =.52). The occurrence of a major adverse event (death, myocardial infarction, or target vessel revascularization due to restenosis-induced ischemia) was 5.6% in 4G/4G carriers, 5.3% in 4G/5G carriers, and 4.6% in 5G/5G carriers at 30 days (P =.80), and 24.7% in 4G/4G carriers, 23.0% in 4G/5G carriers, and 26.2% in 5G/5G carriers at 1 year (P =.45).
The 4G/5G polymorphism of the PAI-1 gene is not associated with an increased risk of thrombotic and restenotic events after coronary artery stenting.

Full text

Page 1

Genetics
4G/5G Polymorphism of the plasminogen activator
inhibitor-1 gene and risk of restenosis after
coronary artery stenting
Corinna Bo ¨ttiger, MD, Werner Koch, PhD, Christina Lahn, Julinda Mehilli, MD, Nicolas von Beckerath, MD,
Albert Scho ¨mig, MD, and Adnan Kastrati, MD Mu ¨nchen, Germany
Background Plasminogen activator inhibitor-1 (PAI-1) has been proposed as a candidate risk factor for restenosis
after coronary artery stenting. Transcription, level, and activity of PAI-1 are influenced by the 4G/5G polymorphism in the
promoter region of PAI-1 gene. The polymorphism may therefore affect wound-healing processes in injured blood vessels
and influence restenosis.
Methods In 1850 consecutive patients, angiographic measures of restenosis and the clinical outcome at 30 days
and 1 year after stent implantation were evaluated. Angiographic restenosis was defined as ?50% diameter stenosis de-
termined at follow-up angiography, performed 6 months after stenting. The 4G/5G genotypes were determined with Taq-
Man technique.
Results Among the patients, the frequency of the 4G allele was 0.55. Follow-up angiography was done in 84% of
the patients. We observed restenosis in 32.5% of 4G/4G carriers, 32.2% of 4G/5G carriers, and 35.7% of 5G/5G
carriers (P ? .52). The occurrence of a major adverse event (death, myocardial infarction, or target vessel revasculariza-
tion due to restenosis-induced ischemia) was 5.6% in 4G/4G carriers, 5.3% in 4G/5G carriers, and 4.6% in 5G/5G
carriers at 30 days (P ? .80), and 24.7% in 4G/4G carriers, 23.0% in 4G/5G carriers, and 26.2% in 5G/5G carriers
at 1 year (P ? .45).
Conclusion The 4G/5G polymorphism of the PAI-1 gene is not associated with an increased risk of thrombotic and
restenotic events after coronary artery stenting. (Am Heart J 2003;146:855–61.)
The deployment of endovascular stents offers a sig-
nificant advance in the percutaneous treatment of ath-
erosclerotic disease, but in-stent restenosis affects
about 30% of patients in the months after an initially
successful intervention.1Fibrinolysis, and especially
plasminogen activator inhibitor-1 (PAI-1) as an impor-
tant factor in fibrinolysis,2is thought to play a major
role in the process of restenosis, as experimental and
clinical data such as impairment of the fibrinolytic sys-
tem and subsequent changes of the PAI-1 plasma pro-
tein level or activity after coronary interventions sug-
gest.3–13Although the factors disturbing the balance of
PAI-1 levels or activity after coronary interventions are
largely unknown, one or more genetic polymorphisms
are potentially involved in regulation of PAI-1.
The most intensively studied variation of the PAI-1
gene is the common 4G/5G deletion/insertion poly-
morphism.14Presence of the 4G motif has been found to
lead to higher transcriptional activity than presence of
the 5G motif.14,15In correlation with these experimental
results, plasma PAI-1 protein levels and activities were
higher in subjects homozygous for the 4G allele than in
subjects homozygous for the 5G allele.14–17
We examined the association of the functionally rele-
vant 4G/5G polymorphism of the PAI-1 gene with the
risk of restenosis after coronary artery stenting in a
large cohort of patients.
Methods
Patients
The study included 1850 consecutive white patients with
symptomatic coronary artery disease who underwent stent
implantation in coronary arteries at Deutsches Herzzentrum
From theaDeutsches Herzzentrum Mu ¨nchen and 1. Medizinische Klinik rechts der Isar,
Technische Universita ¨t Mu ¨nchen, Mu ¨nchen, Germany.
Submitted October 11, 2002; accepted March 10, 2003.
Reprint requests: Corinna Bo ¨ttiger, MD, Deutsches Herzzentrum Mu ¨nchen, Laza-
rettstrasse 36, 80636 Mu ¨nchen, Germany.
E-mail: boettiger@dhm.mhn.de
© 2003, Mosby, Inc. All rights reserved.
0002-8703/2003/$30.00 ? 0
doi:10.1067/S0002-8703(03)00363-6

Page 2

Mu ¨nchen and 1. Medizinische Klinik rechts der Isar der Tech-
nischen Universita ¨t Mu ¨nchen. All patients were scheduled for
angiographic follow-up at 6 months. All patients participating
in this study gave written informed consent for the interven-
tion, follow-up angiography, and genotype determination.
The study protocol conformed to the Declaration of Helsinki
and was approved by the institutional ethics committee.
Stent placement protocols and poststenting therapy have
been previously described in detail.18,19Postprocedural ther-
apy consisted of aspirin (100 mg twice daily, indefinitely)
and ticlopidine (250 mg twice daily for 4 weeks). Patients
considered at a higher risk for stent thrombosis received ad-
junct therapy with the glycoprotein IIb/IIIa blocker abcix-
imab. The decision to give abciximab was at the operator’s
discretion.
Genotype determination
Genomic DNA was extracted from peripheral blood leuko-
cytes with the QIAamp Blood Kit (Qiagen, Hilden, Germany)
or the High Pure PCR Template Preparation Kit (Roche Diag-
nostics, Mannheim, Germany). Genotype analysis was per-
formed with allele-specific fluorogenic probes by TaqMan
technique (Applied Biosystems, Weiterstadt, Germany).20Oli-
gonucleotide primers 5? CAGACAAGGTTGTTGACACAAGAGA
3? and 5? TCCCTCATCCCTGCCATGT 3? were used to am-
plify a 114-bp (5G allele) or 113-bp (4G allele) sequence con-
sisting of nucleotides ?734 (5G allele) or ?733 (4G allele) to
?621 upstream of exon 1 of the IL-6 gene.14The sequences
of the probe oligonucleotides were complementary to the
mRNA-like DNA strand: 5? FAM-CACGGCTGACTCCCCACGTGT
3? (4G allele-specific) and 5? VIC-CGGCTGACTCCCCCACGTGT
3? (5G allele-specific). FAM (6-carboxy-fluorescein) and VIC (Ap-
plied Biosystems, patent pending) designate the fluorogenic
dyes covalently bound to the 5? ends of the probes. The 2-step
thermocycling procedure consisted of 40 cycles of denaturation
at 95°C for 15 seconds, annealing and extension at 60°C for 1
minute. As a control, genotyping was repeated for 20% of the
samples using DNA prepared separately from the original blood
sample.
To identify DNAs homozygous for the 4G and 5G alleles,
which were required as genotype standards for TaqMan as-
says, and to test the accuracy of results obtained with the
TaqMan method, conventional genotype determination was
performed. This was done by polymerase chain reaction
(PCR), subsequent digestion of the PCR product with restric-
tion enzyme BseLI (MBI Fermentas, St Leon-Rot, Germany),
and separation of the restriction fragments by electrophoresis
in a polyacrylamide gel (Invitrogen, Groningen, The Nether-
lands). Primers 5? CACAGAGAGAGTCTGGCCACGT 3? (for-
ward) and 5? GGTGGCTCGAGGGCAGAAT 3? (reverse) were
used to amplify a 147-bp (5G allele) or 146-bp (4G allele)
sequence comprising nucleotides ?698 (5G allele) or ?697
(4G allele) to ?552. The upstream primer was modified with
respect to the genomic sequence (C instead of A) to create a
5G allele-specific BseLI restriction site (CCN5N2GG) that is
not present in the 4G-specific PCR product.21The thermocy-
cling procedure consisted of denaturation at 95°C for 1
minute, annealing and extension at 60°C for 1 minute, re-
peated for 35 cycles, followed by a final extension at 72°C
for 7 minutes. BseLI (MBI Fermentas, St Leon-Rot, Germany)
cleaved the 4G allele-specific PCR product into 2 fragments
of 96 bp and 50 bp and the 5G allele-specific PCR product
into 3 fragments of 74 bp, 50bp, and 23 bp. Genotypes were
determined without knowledge of patients’ clinical and an-
giographic data.
Angiographic assessment
Lesion morphology was classified according to the modi-
fied American College of Cardiology/American Heart Associa-
tion grading system into type A, B1, B2, and C22; lesions of
types B2 and C were considered complex lesions. Digital an-
giograms were analyzed off-line using the automated edge-
detection system CMS (Medis Medical Imaging Systems, Nu-
enen, The Netherlands). Matched views were selected for
angiograms recorded before and immediately after the inter-
vention, and at follow-up. The parameters measured were
lesion length, reference diameter, minimal lumen diameter,
diameter stenosis, and diameter of the maximally inflated bal-
loon during stent placement. Acute lumen gain was calcu-
lated as the difference between the final poststenting mini-
mal lumen diameter and the minimal lumen diameter present
before stenting. Late lumen loss was calculated as the differ-
ence between final poststenting minimal lumen diameter and
minimal lumen diameter measured at follow-up angiography.
Loss index was calculated as the ratio of late lumen loss and
acute lumen gain. Operators who performed the quantitative
assessment were unaware of the genotype data.
Definitions and study end points
The diagnosis of unstable angina pectoris at presentation
was based on a history of crescendo angina, angina at rest or
with minimal exertion, or angina of new onset (within 1
month) in the absence of clear-cut electrocardiographic and
cardiac enzyme changes indicative of an acute MI.23Acute
MI was diagnosed in the presence of a clinical episode of
prolonged chest pain with either the appearance of 1 or
more new pathologic Q waves on the electrocardiogram or
an increase in creatine kinase (or its MB isoenzyme) levels to
at least twice the upper normal limit. Patients were defined
as having diabetes mellitus if they were on active treatment
with insulin or an oral antidiabetic agent; for patients with
dietary treatment, documentation of an abnormal fasting
blood glucose tolerance test based on the World Health Or-
ganization criteria24was required for establishing this diagno-
sis. Persons reporting regular smoking in the prior 6 months
were considered to be current smokers. Systemic arterial hy-
pertension was defined as systolic blood pressure of ?140
mm Hg or diastolic blood pressure of ?90 mm Hg25on at
least 2 separate occasions. Hypercholesterolemia was defined
as a documented total cholesterol value ?6.2 mmol/L. The
definition of cardiovascular risk factors was based on the data
obtained during the actual hospitalization or from the pa-
tient’s chart.
The primary end point of the study was angiographic reste-
nosis defined as a diameter stenosis of ?50% at 6-month fol-
low-up angiography. The number of patients included was
based on the assumption of a 30% difference in the resteno-
sis rates between carriers and noncarriers of the 4G allele,
allowing for missing follow-up angiography in ?20% of the
patients and selecting an ?-error of 0.05 and a ?-error of 0.10
for a 2-sided test. The secondary end point of the study was
American Heart Journal
November 2003
856 Bo ¨ttiger et al

Page 3

the combined event rate of death, myocardial infarction or
target vessel revascularization due to symptoms or signs of
ischemia in the presence of angiographic restenosis. The fol-
low-up protocol included a telephone interview at 30 days, a
clinical visit at 6 months, and an additional telephone contact
at 1 year after stent placement. For patients reporting cardiac
symptoms during the telephone interview, at least 1 clinical
and electrocardiographic follow-up visit was scheduled and
performed at the outpatient clinic or by the referring physi-
cian. In case of suspected restenosis, a follow-up angiography
was performed. At 1 year, all information derived from hospi-
tal readmission records or provided by the referring physi-
cian or by the outpatient clinic was entered into the com-
puter database. Persons who performed clinical follow-up
were not aware of the patient’s genotype.
Statistical analysis
The main analyses consisted of comparisons between the
carriers of the genotypes 4G4G, 4G5G, and 5G5G. Discrete
variables are expressed as counts or percentages and com-
pared with the ?2or the Fisher exact test, as appropriate.
Continuous variables are expressed as mean ? SD and com-
pared by means of the unpaired, 2-sided t test or analysis of
variance for ?2 groups. Risk analysis was performed calculat-
ing the odds ratio (OR) and the 95% CIs. The association be-
tween the PAI-1 genotype and restenosis was also assessed
by a multivariate logistic regression analysis including also all
clinical, angiographic and procedural characteristics. Statisti-
cal analyses were performed using S-Plus software (Mathsoft
Inc, Seattle, Wash). Correspondence of the PAI-1 genotype
distribution with the Hardy-Weinberg equilibrium was tested
with the Hardy-Weinberg Diagnostics program, version
1.beta, designed by A Rogatko and M Slifker (Fox Chase Can-
cer Center; http://www.fccc.edu/users/rogatko/hwdiag). A P
value of ?.05 was considered statistically significant.
Results
Patients characteristics
Among the 1850 patients who underwent stenting in
coronary arteries, 572 (30.9%) patients carried geno-
type 4G4G, 908 (49.1%) patients carried genotype
4G5G, and 370 (20.0%) patients carried genotype
5G5G. This distribution complied with the Hardy-
Weinberg equilibrium (P ? .973). The main baseline
clinical characteristics of the patient groups are com-
pared in Table I; lesion and procedural characteristics
are presented in Table II. Among the parameters
shown in Tables I and II, there were no statistically
significant differences between the 3 patient groups.
Acute and subacute thrombotic events after stent
placement
Angiographic stent vessel occlusion occurring within
30 days after stent placement was observed in 1.9% for
4G4G genotype, 1.8% for 4G5G genotype, and 1.4%
for 4G4G genotype (P ? .80). The mortality rate was
1.0% for 4G4G genotype, 1.0% for 4G5G genotype,
and 0.9% for 4G5G genotype (P ? .86). MI was ob-
served in 2.6% for 4G4G genotype, 1.8% for 4G5G ge-
notype, and 1.4% for 4G4G genotype (P ? .41). Ur-
gent target vessel revascularization was required in
4.2% of 4G4G genotype, 1.8% of 4G5G genotype, and
1.4% of 4G4G genotype (P ? .17).
Angiographic restenosis
Of the 1850 patients, 1556 (84.1%) underwent fol-
low-up coronary angiography 6 months after stenting.
Restenosis rate, the primary end point of the study,
was not significantly different between the patient
groups: 32.5% in patients homozygote for 4G, 32.2% in
heterozygote patients, and 35.7% in patients homozy-
gote for 5G (P ? .52) (Table III). All characteristics
shown in Tables I and II were included in a multivari-
ate logistic regression analysis of angiographic resteno-
sis. Upon adjustment, the presence of the 4G allele
was associated with an OR of 0.90 (95% CI 0.68-1.18).
The multivariate logistic regression analysis showed
that lesion complexity (P ? .04), ostial location of the
lesion (P ? .001), lesion length (P ? .004) and post-
procedural minimal lumen diameter (P ? .03) were
independent predictors of angiographic restenosis.
Continuous measures of restenosis were not signifi-
cantly different among the patient groups (P ? .52)
(Table III).
We separately examined the relationship between
the 4G/5G polymorphism and restenosis among smok-
ers and nonsmokers. In smokers, restenosis rate was
Table I. Baseline clinical characteristics of the patients
4G4G
(n ? 572)
4G5G
(n ? 908)
5G5G
(n ? 370)P
Age (y)
Women (%)
Arterial hypertension (%)
Diabetes (%)
Current smoker (%)
Elevated total cholesterol
(%)
Acute myocardial
infarction (%)
Unstable angina (%)
Prior myocardial
infarction (%)
Prior PTCA (%)
Prior bypass surgery (%)
Number of diseased
coronary vessels (%)
1 Vessel
2 Vessels
3 Vessels
Reduced left ventricular
function (%)
62.7 ? 10.2 63.0 ? 10.0 63.5 ? 10.0 .43
21.2 19.8
68.5 67.3
21.921.5
31.829.6
43.242.5
24.3
69.2
18.4
32.2
43.0
.20
.77
.39
.55
.97
21.019.2 21.9.48
24.8
28.8
30.3
25.7
26.5
26.5
.06
.40
24.0
10.0
25.7
11.2
22.7
12.4
.50
.49
.36
29.2
33.2
37.6
29.7
29.1
30.8
40.1
28.2
24.6
34.9
40.5
31.9 .41
Data are proportions or mean ? SD.
American Heart Journal
Volume 146, Number 5
Bo ¨ttiger et al 857

Page 4

32.9% in 4G4G carriers, 30.5% in 4G5G carriers, and
31.7% in 5G5G carriers (P ? .88). Thus, there was no
significant difference among the groups. The analysis
of nonsmokers did not show a significant difference
either, with 32.3% restenosis rate in 4G4G carriers,
32.9% in 4G5G carriers, and 37.7% in 5G5G carriers (P
? .38). No statistically significant differences were
achieved concerning late loss, either.
Clinical outcome at 1 year
Table IV shows the adverse events observed over 1
year. There was only a trend toward a higher mortality
among 5G allele carriers, but the numbers were small
and the study was not sufficiently powered for the
analysis of this event. The incidence of nonfatal MI
was similar in the 3 groups (P ? .41). Target vessel
revascularization was required in 21.3% of patients
with 4G4G genotype, 19.6% of patients with 4G5G
genotype, and 20.6% of patients with 5G5G genotype
(P ? .72). In total, the occurrence of a major adverse
Table II. Lesion and procedural characteristics at the time of intervention
4G4G
(n ? 572)
4G5G
(n ? 908)
5G5G
(n ? 370)P
Target coronary vessel (%)
Left main
LAD
LCx
RCA
ACVB
Complex lesion (%)
Restenotic lesion (%)
Chronic occlusion (%)
Ostial lesion (%)
Before stenting
Reference diameter (mm)
Minimal lumen diameter (mm)
Diameter stenosis (%)
Lesion length (mm)
Procedural data
Measured balloon diameter (mm)
Maximal balloon pressure (atm)
Balloon to vessel ratio
Stented segment length (mm)
Number of stents
Periprocedural abciximab therapy (%)
Immediately after stenting
Minimal lumen diameter (mm)
Diameter stenosis (%)
Acute lumen gain (mm)
.19
1.1
40.0
23.4
28.7
6.8
73.4
23.8
7.0
5.6
1.4
39.8
18.7
33.2
6.9
74.0
25.1
6.4
7.3
2.2
38.9
17.6
35.4
6.0
78.1
23.0
5.4
7.8
.22
.68
.62
.33
3.05 ? 0.53
0.64 ? 0.51
79.1 ? 15.7
12.0 ? 6.7
3.04 ? 0.53
0.64 ? 0.49
79.0 ? 15.0
11.9 ? 6.8
3.00 ? 0.54
0.65 ? 0.49
78.4 ? 15.4
12.5 ? 6.8
.27
.95
.78
.38
3.25 ? 0.54
13.9 ? 3.3
1.07 ? 0.09
20.3 ? 13.4
1.81 ? 1.15
20.5
3.24 ? 0.53
13.8 ? 3.3
1.07 ? 0.09
19.7 ? 14.4
1.76 ? 1.20
18.3
3.22 ? 0.53
13.8 ? 3.2
1.08 ? 0.11
21.0 ? 13.8
1.85 ? 1.16
21.9
.77
.83
.09
.33
.39
.29
2.95 ? 0.52
5.2 ? 8.0
2.31 ? 0.67
2.93 ? 0.52
5.3 ? 8.7
2.29 ? 0.63
2.91 ? 0.51
5.4 ? 8.0
2.26 ? 0.62
.52
.95
.52
Data are proportions or mean ? SD. LAD, Left anterior descending coronary artery; LCx, left circumflex coronary artery; RCA, right coronary artery; ACVB, aorto-coronary
venous bypass. Complex lesions were defined as ACC/AHA lesion types B2 and C, according to the American College of Cardiology/American Heart Association grading
system.
Table III. Results of follow-up angiography
4G4G
(n ? 486)
4G5G
(n ? 762)
5G5G
(n ? 308)P
Minimal lumen
diameter (mm)
Diameter stenosis (%)
Late lumen loss (mm)
Loss index
Restenosis rate (%)
1.73 ? 0.92 1.74 ? 0.93 1.71 ? 0.96 .87
43.6 ? 27.1 43.4 ? 27.5 44.0 ? 28.6 .96
1.21 ? 0.84 1.21 ? 0.85 1.20 ? 0.81 .98
0.56 ? 0.42 0.55 ? 0.40 0.58 ? 0.45 .52
32.5 32.235.7 .52
Data are proportions or mean ? SD.
Table IV. Clinical outcome at 1 year after stent placement
4G4G
(n ? 572)
4G5G
(n ? 908)
5G5G
(n ? 370)P
Death (%)
Nonfatal myocardial
infarction (%)
Target vessel
revascularization (%)
PTCA
ACVB
Major adverse cardiac
events (%)
1.6
1.1
2.4
1.9
4.1
2.0
.06
.41
21.319.620.5 .72
19.2
2.5
24.7
18.5
1.4
23.0
18.6
2.2
26.2
.94
.34
.45
PTCA, Percutaneous transluminal coronary angiography; ACVB, aorto-coronary
venous bypass.
American Heart Journal
November 2003
858 Bo ¨ttiger et al

Page 5

cardiac event (death, nonfatal MI, or target vessel re-
vascularization) was 24.7% in patients carrying 4G4G
genotype, 23.0% in patients carrying 4G5G genotype,
and 26.2% in patients carrying 4G5G genotype (P ?
.45).
Discussion
In this trial, we found no association between the
4G/5G promoter polymorphism of the PAI-1 gene and
angiographic restenosis (primary end point) or clinical
outcome (death, myocardial infarction, target lesion
revascularization) after coronary artery stenting in a
large consecutive cohort of patients. Based on previ-
ous studies indicating an influence of cigarette smok-
ing on PAI-1 levels,26,27we separately examined the
relationship between the 4G/5G polymorphism and
restenosis among the smokers and nonsmokers of our
study cohort. However, we did not find an association,
neither in smokers nor in nonsmokers. This observa-
tion is in contrast to a recent report suggesting that, in
smokers, late lumen loss after coronary artery stenting
was most severe in carriers of the 5G5G genotype,
whereas in nonsmokers, late lumen loss was greatest
among 4G4G carriers.8
Our expectation to find a correlation between the
4G/5G polymorphism of the PAI-1 gene and the risk of
restenosis after coronary artery stenting was based on
a number of experimental and clinical observations.
Because of its regulatory functions in coagulation and
fibrinolysis, PAI-1 is viewed as an important factor in-
volved in thrombosis and myocardial infarc-
tion.2,28–30Studies investigating the relationship be-
tween the 4G/5G polymorphism and coronary artery
disease or myocardial infarction provided conflicting
results.15–17,31–36
The pathophysiologic process resulting in restenosis
after coronary artery stenting parallels wound healing
responses.37The tendency of PAI-1 to maintain the
fibrin clot may result in an extended presence of po-
tent mitogenic substances at the site of vessel injury,
possibly contributing to migration and proliferation of
vascular smooth muscle cells and development of a
neointima resulting in restenosis. However, conflicting
data about the role of PAI-1 in the process of resteno-
sis exists: there are also data that suggest PAI-1 may
facilitate reduction of neointima formation and there-
fore prevent restenosis.10,12,38
A number of trials examined the relationship be-
tween PAI-1 and restenosis after coronary interven-
tions. Predominantly, elevation of PAI-1 protein levels
or activity after percutaneous transluminal coronary
angioplasty has been implicated in restenosis.3–5,7Two
studies investigated the occurrence of restenosis after
percutaneous transluminal coronary angioplasty, both
with or without stenting; one found a positive correla-
tion with PAI-1 activity9while the other found a nega-
tive correlation with PAI-1 protein levels.6The appar-
ently conflicting results of these trials may reflect, at
least in part, the difficulty of assessing the individual
contribution of PAI-1 plasma concentration or activity
to restenosis. For example, there exists a significant
positive correlation between the plasma concentration
and activity of PAI-1 and those of its natural opponents
tPA and uPA, which may cause, by formation of inac-
tive complexes, partial neutralization of their ef-
fects.12,39,40In addition, the plasma level of PAI-1 is
sensitive to diurnal variation and dependent on factors
associated with coronary artery disease (eg, insulin
resistance).41,42
In an effort to overcome this potentially important
problem, we examined a functionally relevant genetic
marker of PAI-1, the 4G/5G polymorphism, to test
whether it is useful as a predictor of restenosis risk
after coronary stent placement. However, our study
provides evidence that this is not the case. The design
of the study (large and consecutive series of patients,
precisely defined phenotype, and adequate and estab-
lished methods to examine the phenotype quantita-
tively) argues against the possibility that this negative
outcome is based on chance. To test the accuracy of
the results obtained with the TaqMan procedure for
genotyping of the 4G/5G polymorphism, we used an
established technique, polymerase chain reaction in
combination with restriction enzyme analysis,21and
found complete concordance of the results. A 4G al-
lele frequency of 0.55, as observed in our patients, is
similar to the data obtained by other groups.15,16,34,43
This supports the validity of our genotyping data.
Thus, in contrast to associations found between gene
polymorphisms of other candidate genes and resteno-
sis after stenting,44,45the 4G/5G polymorphism of the
PAI-1 gene is not a marker for restenosis risk. How-
ever, this result does not imply that PAI-1 is unimpor-
tant for restenotic mechanisms. Most likely, the func-
tional contribution, if any, of the 4G/5G polymorphism
in processes like wound healing and neointima forma-
tion, does not reach a significant level. Metabolic de-
terminants (eg, the insulin resistance syndrome) may
be more important than the 4G/5G polymorphism in
determining PAI-1 activity and its correlation to reste-
nosis after stenting.46The possibility remains that ex-
amination, not of a single variation, but of different
combinations of several polymorphisms present in the
PAI-1 gene would provide a genetic marker for reste-
nosis after coronary artery stenting.
References
1. Kastrati A, Schomig A, Elezi S, et al. Predictive factors of resteno-
sis after coronary stent placement. JACC 1997;30:1428–36.
2. Kohler HP, Grant PJ. Plasminogen activator inhibitor type 1 and
coronary artery disease. N Engl J Med 2000;342:1792–801.
American Heart Journal
Volume 146, Number 5
Bo ¨ttiger et al 859

Page 6

3. Huber K, Jo ¨rg M, Probst P, et al. A decrease in plasminogen acti-
vator inhibitor-1 activity after successful percutaneous transluminal
coronary angioplasty is associated with a significantly reduced risk
for coronary restenosis. Thromb Haemost 1992;67:209–13.
4. Sakata K, Miura F, Sugino H, et al. Impaired fibrinolysis early af-
ter percutaneous transluminal coronary angioplasty is associated
with restenosis. Am Heart J 1996;131:1–6.
5. Ishiwata S, Tukada T, Nakanishi S, et al. Postangioplasty resteno-
sis: platelet activation and the coagulation-fibrinolysis system as
possible factors in the pathogenesis of restenosis. Am Heart J
1997;133:387–92.
6. Strauss BH, Lau HK, Bowman KA, et al. Plasma urokinase antigen
and plasminogen activator inhibitor-1 antigen levels predict angio-
graphic coronary restenosis. Circulation 1999;100:1616–22.
7. Fornitz GG, Nielsen P, Amtorp O, et al. Impaired fibrinolysis de-
termines the outcome of percutaneus transluminal coronary angio-
plasty (PTCA). Eur J Clin Invest 2001;31:586–92.
8. Ortlepp JR, Hoffmann R, Killian A, et al. The 4G/5G promotor
polymorphism of the plasminogen activator inhibitor-1 gene and
late lumen loss after coronary stent placement in smoking and non-
smoking patients. Clin Cardiol 2001;24:585–91.
9. Prisco D, Fedi S, Antonucci E, et al. Postprocedural PAI-1 activity
is a risk marker of subsequent clinical restenosis in patients both
with and without stent implantation after elective balloon PTCA.
Thromb Res 2001;104:181–6.
10. Carmeliet P, Moons L, Lijnen R, et al. Inhibitory role of plasmino-
gen activator inhibitor-1 in arterial wound healing and neointima
formation: a gene targeting and gene transfer study in mice. Cir-
culation 1997;96:3180–91.
11. Hasenstab D, Forough R, Clowes AW. Plasminogen activator in-
hibitor type 1 and tissue inhibitor of metalloproteinase-2 increase
after arterial injury in rats. Circ Res 1997;80:490–6.
12. Kjøller L, Kanse SM, Kirkegaard T, et al. Plasminogen activator
inhibitor-1 represses integrin- and vitronectin-mediated cell migra-
tion independently of its function as an inhibitor of plasminogen
activation. Exp Cell Res 1997;232:420–9.
13. DeYoung MB, Tom C, Dichek DA. Plasminogen activator inhibitor
type 1 increases neointima formation in balloon-injured rat carotid
arteries. Circulation 2001;104:1972–7.
14. Dawson SJ, Wiman B, Hamsten A, et al. The two allele sequences
of a common polymorphism in the promoter of the plasminogen
activator inhibitor-1 (PAI-1) gene respond differently to interleu-
kin-1 in HepG2 cells. J Biol Chem 1993;268:10739–45.
15. Eriksson P, Kallin B, van’t Hooft FM, et al. Allele-specific increase
in basal transcription of the plasminogen-activator inhibitor-1 gene
is associated with myocardial infarction. Proc Natl Acad Sci USA
1995;92:1851–5.
16. Ye S, Green FR, Scarabin PY, et al. The 4G/5G genetic polymor-
phism in the promoter of the plasminogen activator inhibitor-1
(PAI-1) gene is associated with differences in plasma PAI-1 activity
but not with risk of myocardial infarction in the ECTIM study.
Thromb Haemost 1995;74:837–41.
17. Ossei-Gerning N, Mansfield MW, Stickland MH, et al. Plasmino-
gen activator inhibitor-1 promoter 4G/5G genotype and plasma
levels in relation to a history of myocardial infarction in patients
characterized by coronary angiography. Arterioscler Thromb Vasc
Biol 1997;17:33–7.
18. Scho ¨mig A, Kastrati A, Mudra H, et al. Four-year experience with
Palmaz-Schatz stenting in coronary angioplasty complicated by
dissection with threatened or present vessel closure. Circulation
1994;90:2716–24.
19. Scho ¨mig A, Neumann F-J, Kastrati A, et al. A randomized com-
parison of antiplatelet and anticoagulant therapy after the place-
ment of coronary-artery stents. N Engl J Med 1996;334:1084–9.
20. Livak KJ. Allelic discrimination using fluorogenic probes and the 5?
nuclease assay. Genet Anal 1999;14:143–9.
21. Margaglione M, Grandone E, Cappucci G, et al. An alternative
method for PAI-1 promoter polymorphism (4G/5G) typing.
Thromb Haemost 1997;77:605–6.
22. Ellis SG, Vandormael MG, Cowley MJ, et al. Coronary morpho-
logic and clinical determinants of procedural outcome with angio-
plasty for multivessel coronary disease: implications for patient
selection. Circulation 1990;82:1193–202.
23. Rutherford JD, Braunwald E, Cohn PF. Chronic ischemic heart dis-
ease. In: Braunwald E, editor. Heart disease: a textbook of cardio-
vascular medicine. 3rd ed. Philadelphia: WB Saunders Company;
1988. p. 1314–78.
24. World Health Organization Study Group. Diabetes mellitus. WHO
Tech Rep Ser 1985;727:1–104.
25. Guidelines Subcommittee. 1999 World Health Organization-Inter-
national Society of Hypertension guidelines for the management of
hypertension. J Hypertens 1999;17:151–83.
26. Simpson AJ, Gray RS, Moore NR, et al. The effects of chronic
smoking on fibrinolytic potential of plasma and platelets. Br J
Haematol 1997;97:201–13.
27. Hughes K, Choo M, Kuperan P, et al. Cardiovascular risk factors
in relation to cigarette smoking: a population-based survey among
Asians in Singapore. Atherosclerosis 1998;137:253–8.
28. Eren M, Painter CA, Atkinson JB, et al. Age-dependent spontane-
ous arterial thrombosis in transgenic mice that express a stable
form of human plasminogen activator inhibitor-1. Circulation
2002;106:491–6.
29. Held C, Hjemdahl P, Rehnqvist N, et al. Fibrinolytic variables and
cardiovascular prognosis in patients with stable angina pectoris
and treated with verapamil and metoprolol. Circulation 1997;95:
2380–6.
30. Tho ¨gersen AM, Jansson J-H, Boman K, et al. High plasminogen
activator inhibitor and tissue plasminogen activator levels in
plasma precede a first acute myocardial infarction in both men
and women. Circulation 1998;98:2241–7.
31. Iwai N, Shimoike H, Nakamura Y, et al. The 4G/5G polymor-
phism of the plasminogen activator inhibitor gene is associated
with the time course of progression to acute coronary syndromes.
Atherosclerosis 1998;136:109–14.
32. Margaglione M, Cappucci G, Colaizzo D, et al. The PAI-1 gene
locus 4G/5G polymorphism is associated with a family history of
coronary artery disease. Arterioscler Thromb Vasc Biol 1998;1:
152–6.
33. Gardemann A, Lohre J, Katz N, et al. The 4G4G genotype of the
plasminogen activator inhibitor 4G/5G gene polymorphism is as-
sociated with coronary atherosclerosis in patients at high risk for
this disease. Thromb Haemost 1999;82:1121–6.
34. Ridker PM, Charles HH, Lindpaintner K, et al. Arterial and venous
thrombosis is not associated with the 4G/5G polymorphism in the
promotor of the plasminogen activator inhibitor gene in a large
cohort of US men. Circulation 1997;95:59–62.
35. Anderson JL, Muhlestein JB, Habashi J, et al. Lack of association
of a common polymorphism of the plasminogen activator inhibi-
tor-1 gene with coronary artery disease and myocardial infarction.
J Am Coll Cardiol 1999;34:1778–83.
36. Doggen CJ, Bertina RM, Cats VM, et al. The 4G/5G polymor-
phism in the plasminogen activator inhibitor-1 gene is not associ-
American Heart Journal
November 2003
860 Bo ¨ttiger et al

Page 7

ated with myocardial infarction. Thromb Haemost 1999;82:115–
20.
37. Virmani R, Farb A. Pathology of in-stent restenosis. Curr Opin
Lipidol 1999;10:499–510.
38. Xiaoli M, Wenying H, Mingpeng S. Effects and mechanism of tis-
sue-type plasminogen activator and plasminogen activator inhibi-
tor on vascular smooth muscle cell proliferation. Int J Cardiol
1998;66(1 Suppl):S57–64.
39. Saksela O, Rifkin DB. Cell-associated plasminogen activation: regula-
tion and physiological functions. Ann Rev Cell Biol 1988;4:93–126.
40. Chandler WL, Trimble SL, Loo SC, et al. Effect of PAI-1 levels on
the molar concentrations of active tissue plasminogen activator
(t-PA) and t-PA/PAI-1 complex in plasma. Blood 1990;76:930–7.
41. Angleton P, Chandler WL, Schmer G. Diurnal variation of tissue-
type plasminogen activator and its rapid inhibitor (PAI-1). Circula-
tion 1989;79:101–6.
42. Juhan-Vague I, Pyke SD, Alessi MC, et al. Fibrinolytic factors and
the risk of myocardial infarction or sudden death in patients with
angina pectoris. ECAT study group: European concerted action on
thrombosis and disabilities. Circulation 1996;94:2057–63.
43. Iacoviello L, Burzotta F, Di Castelnuovo A, et al. The 4G/5G poly-
morphism of PAI-1 promoter gene and the risk of myocardial in-
farction: a meta-analysis. Thromb Haemost 1998;80:1929–30.
44. Kastrati A, Scho ¨mig A, Seyfarth M, et al. PlApolymorphism of
platelet glycoprotein IIIa and risk of restenosis after coronary stent
placement. Circulation 1999;99:1005–10.
45. Koch W, Bo ¨ttiger C, Mehilli J, et al. Association of a CD18 gene
polymorphism with a reduced risk of restenosis after coronary
stenting. Am J Cardiol 2001;88:1120–4.
46. Henry M, Tregoue ¨t DA, Alessi MC, et al. Metabolic determinants
are much more important than genetic polymorphisms in determin-
ing the PAI-1 activity and antigen plasma concentrations: a family
study with part of the Stanislas cohort. Arterioscler Thromb Vasc
Biol 1998;18:84–9.
American Heart Journal
Volume 146, Number 5
Bo ¨ttiger et al 861