Genomic interrogation of the dassie bacillus reveals it as a unique RD1 mutant within the Mycobacterium tuberculosis complex.

Abstract

Despite their remarkable genetic homology, members of the Mycobacterium tuberculosis complex express very different phenotypes, most notably in their spectra of clinical presentation. For example, M. tuberculosis is regarded as pathogenic to humans, whereas members having deleted RD1, such as Mycobacterium microti and Mycobacterium bovis BCG, are not. The dassie bacillus, an infrequent variant of the M. tuberculosis complex characterized as being most similar to M. microti, is the causative agent of tuberculosis (TB) in the dassie (Procavia capensis). Intriguingly, the dassie bacillus is not pathogenic to rabbits or guinea pigs and has never been documented to infect humans. Although it was identified more than a half-century ago, the reasons behind its attenuation are unknown. Because large sequence polymorphisms have presented themselves as the most obvious genomic distinction among members of the M. tuberculosis complex, the DNA content of the dassie bacillus was interrogated by Affymetrix GeneChip to identify regions that are absent from it but present in M. tuberculosis H37Rv. Comparison has led to the identification of nine regions of difference (RD), five of which are shared with M. microti (RDs 3, 7, 8, 9, and 10). Although the dassie bacillus does not share the other documented deletions in M. microti (RD1(mic), RD5(mic), MID1, MID2, and MID3), it has endured unique deletions in the regions of RD1, RD5, N-RD25, and Rv3081-Rv3082c (virS). RD1(das), affecting only Rv3874-Rv3877, is the smallest natural deletion of the RD1 region uncovered and points to genes within this region that are likely implicated in virulence. Newfound deletions from the dassie bacillus are discussed in relation to their evolutionary and biological significance.

Full text

Page 1

JOURNAL OF BACTERIOLOGY, Jan. 2004, p. 104–109
0021-9193/04/$08.00?0DOI: 10.1128/JB.186.1.104–109.2004
Vol. 186, No. 1
Genomic Interrogation of the Dassie Bacillus Reveals It as a Unique
RD1 Mutant within the Mycobacterium tuberculosis Complex
Serge Mostowy,1Debby Cousins,2and Marcel A. Behr1*
McGill University Health Centre, Montreal, Canada H3G 1A4,1and Australian Reference Laboratory
for Bovine Tuberculosis, Department of Agriculture, South Perth 6151, Australia2
Received 2 October 2003/Accepted 6 October 2003
Despite their remarkable genetic homology, members of the Mycobacterium tuberculosis complex express very
different phenotypes, most notably in their spectra of clinical presentation. For example, M. tuberculosis is
regarded as pathogenic to humans, whereas members having deleted RD1, such as Mycobacterium microti and
Mycobacterium bovis BCG, are not. The dassie bacillus, an infrequent variant of the M. tuberculosis complex
characterized as being most similar to M. microti, is the causative agent of tuberculosis (TB) in the dassie
(Procavia capensis). Intriguingly, the dassie bacillus is not pathogenic to rabbits or guinea pigs and has never
been documented to infect humans. Although it was identified more than a half-century ago, the reasons behind
its attenuation are unknown. Because large sequence polymorphisms have presented themselves as the most
obvious genomic distinction among members of the M. tuberculosis complex, the DNA content of the dassie
bacillus was interrogated by Affymetrix GeneChip to identify regions that are absent from it but present in M.
tuberculosis H37Rv. Comparison has led to the identification of nine regions of difference (RD), five of which
are shared with M. microti (RDs 3, 7, 8, 9, and 10). Although the dassie bacillus does not share the other
documented deletions in M. microti (RD1mic, RD5mic, MID1, MID2, and MID3), it has endured unique
deletions in the regions of RD1, RD5, N-RD25, and Rv3081-Rv3082c (virS). RD1das, affecting only Rv3874-
Rv3877, is the smallest natural deletion of the RD1 region uncovered and points to genes within this region that
are likely implicated in virulence. Newfound deletions from the dassie bacillus are discussed in relation to their
evolutionary and biological significance.
The Mycobacterium tuberculosis complex is classically de-
fined by the closely related species M. tuberculosis, Mycobacte-
rium africanum, Mycobacterium microti, and Mycobacterium bo-
vis. Significantly, coding sequences of M. tuberculosis complex
members share more than 99.9% DNA identity, with single-
nucleotide polymorphisms thought to occur only once every
several thousand base pairs (19, 20, 43). Sequencing efforts
involving species of the M. tuberculosis complex (M. tuberculo-
sis, M. microti, and M. bovis) (5, 8, 16, 19) have all highlighted
the significance of large sequence polymorphisms (LSPs) de-
leted from M. tuberculosis as a primary source of genomic
variability within the complex (6, 31). Despite their genetic
homology, members differ in a number of phenotypes, includ-
ing their host ranges. Generally speaking, M. tuberculosis
causes tuberculosis (TB) in humans and rarely causes disease
in other animals. M. bovis characteristically infects cattle but
appears to have a much broader host range, including nonbo-
vine reservoirs (34). Strains not conforming to the above-men-
tioned species have been isolated from other mammals, such as
“Mycobacterium caprae” from goats (2, 3), Mycobacterium pin-
nipedii from seal lions and fur seals (11, 14), and the dassie
bacillus from small mammals commonly found in South Africa
and the Middle East called the hyrax or dassie (Procavia cap-
ensis) (12).
First reported in the late 1950s as the causative agent of TB
in the dassie (49), the morphology and growth requirements of
the dassie bacillus are classified as being very similar to those
of M. microti (42), the causative agent of TB in voles (Microtus
agrestis). The history and laboratory phenotypes are described
elsewhere (12, 13). Certain laboratory characteristics of the
dassie bacillus concur with those of M. microti, such as results
of most biochemical tests and susceptibility to thiophen-2-
carboxylic acid hydrazide. Notably, a number of in vitro char-
acteristics distinguish the dassie bacillus from M. microti, in-
cluding different growth preferences and bacillary morphology
under microscropy. Never documented to have infected hu-
mans, the dassie bacillus should have been discriminated from
M. tuberculosis if it was isolated from humans in the past, since
it is more difficult to grow and generally requires longer times
than does M. tuberculosis (12, 49). Furthermore, if the isolate
was previously cultured from humans and tested, spacer oligo-
nucleotide typing (spoligotyping) databases should have iden-
tified the discrepancy, as has been the case for human isola-
tions of M. microti (48). In tests for pathogenicity, the dassie
bacillus was reported to have a very low level of virulence in
rabbits and guinea pigs (12) and was originally described as an
attenuated strain of M. microti (49). Virulence studies per-
formed in the labs of Wagner and Cousins demonstrate re-
duced virulence compared to M. tuberculosis, M. bovis, and M.
microti (12, 49). In brief, rabbits and guinea pigs inoculated
with a suspension of the dassie bacillus remained well, and
when sacrificed, no lesions were detected in any of the tissues,
and no Mycobacterium species were isolated after culture of
the injection site, lung, or liver. The reasons for the attenuated
phenotype of the dassie bacillus have not previously been ex-
plored, but genomic studies of other attenuated strains of the
* Corresponding author. Mailing address: Division of Infectious
Diseases and Medical Microbiology, A5-156, Montreal General Hos-
pital, 1650 Cedar Ave., Montreal, QC H3G 1A4, Canada. Phone: (514)
934-1934, ext. 42815. Fax: (514) 934-8423. E-mail: marcel.behr
@mcgill.ca.
104

Page 2

M. tuberculosis complex have suggested the role of LSPs such
as RD1, whose deletion has been linked to the attenuated
phenotype of BCG vaccines and M. microti (5, 29, 36).
In an earlier study employing deletions distinguishing M.
tuberculosis from M. bovis, the dassie bacillus was revealed to
lack the regions RD7, RD8, RD9, and RD10, phylogenetically
clustering together with M. microti, M. pinnipedii, and isolates
of M. africanum (31). Subsequently, the genomic content of M.
microti OV254 has been compared to that of M. tuberculosis
H37Rv via construction of bacterial artificial chromosome li-
braries to reveal deletions specific to M. microti (5). Because
LSPs have presented themselves as the most obvious genomic
distinction among members of the M. tuberculosis complex, the
DNA content of the dassie bacillus was interrogated by Af-
fymetrix GeneChip to identify regions that are absent from it
but present in M. tuberculosis H37Rv. Because the dassie ba-
cillus has already been categorized as an organism similar to M.
microti, this investigation focused on establishing a genomic
identity for the dassie bacillus by contrasting its genomic con-
tent with the genomic content of M. microti.
MATERIALS AND METHODS
Bacterial isolates. Seven DNA samples representing members of the M. tu-
berculosis complex were provided from the lab of D. Cousins. Based on classical
tests of the M. tuberculosis complex (21) and the host from which they were
isolated, isolates were classified as M. microti (n ? 3) or dassie bacillus (n ? 4)
(Table 1). Supporting citations (12, 13) describe the origin of dassie isolates. All
of these samples have been genotyped by restriction fragment length polymor-
phism (10, 12, 13) using the molecular epidemiologic markers IS6110 (46),
polymorphic GC-rich sequences (PGRS) (38), direct repeat (DR) (22), and
spoligotyping (1, 25). Samples classified as dassie bacillus represented a total of
three different IS6110 genotypes, two different PGRS genotypes, two different
DR genotypes, and two different spoligotypes. Cousins et al. (12) previously
reported IS6110 restriction length fragment polymorphism with PvuII, BclI, and
BstEII and PGRS (referred to as ptBN12) using AluI digests. Spoligotype pat-
terns for the dassie bacillus have been published by Mostowy et al. (31). Of note,
the origins of the SP70 isolates are diverse, one having been taken from a dassie
in South Africa in 1959 and the other from a suricat in a Swedish zoo (which
presumably originated in South Africa) in 1993. There are two spacer differences
between SP70 and SP71. M. microti isolates studied had three different IS6110
genotypes, a single PGRS genotype, at least two different DR genotypes, and a
single spoligotype. None of the epidemiological markers typed the dassie bacillus
together with M. microti.
GeneChip analysis. Bacillus originally isolated from a 3.5-year-old male dassie
from the Perth Zoo was selected for GeneChip analysis. DNA was extracted
after approximately 3 weeks of stationary growth using a procedure involving
lysozyme and proteinase K (47). Eight micrograms of dassie bacillus DNA was
prepared and hybridized to the GeneChip as previously described (39). Fluores-
cence intensities were recorded by a scanner, and data were analyzed manually
to suggest candidate deleted regions. Because of the remarkable genetic homol-
ogy within the M. tuberculosis complex, results could be analyzed via manual
inspection of the data file to potentially suggest candidate deleted regions.
PCR amplification and sequencing across deletions. In silico deletion calls
made by GeneChip analysis were pursued with primers targeting the flanking
region, designed to amplify regions harboring the putative deletion and M.
tuberculosis H37Rv. Because their genomic content has already been analyzed
via GeneChip, M. tuberculosis H37Ra (26) and BCG Pasteur (39) were used as
DNA controls for each experiment. PCR amplicons were run on a 2% agarose
gel with the expectation that any ambiguity in amplicon size may be indicative of
variable genomic sequence. Amplicons that did not represent the expected base-
pair size of H37Rv were sequenced by dideoxy terminal sequencing at the McGill
University and Genome Quebec Innovation Center. Sequence results were com-
pared by BLAST analysis with sequence of M. tuberculosis H37Rv using Tuber-
culist (http://genolist.pasteur.fr/Tuberculist/index.html) to verify whether the am-
plified dassie bacillus DNA aligned to wild-type sequence or revealed a deleted
segment of DNA.
Analysis of deletions. To search for the presence or absence of the deleted
regions, we subjected each of our seven isolates to a three-primer PCR as
described by Talbot and colleagues (44). For each deleted region, we designed
one pair of PCR primers beyond the region (forward and reverse) that would
amplify only if the bordered genomic region is absent. A third primer (reverse)
was designed within the putative deleted region. Amplification resulting from
this primer and the forward primer would result in a PCR product of a different
size, indicating that the genomic region was present. The list of these primers
used to amplify deletions from the dassie bacillus is provided in Table 2. Impor-
tantly, any amplicon suggesting the absence of a specific region was sequence
confirmed for every isolate to make sure that the exact same genomic event was
being identified for all isolates (31). Subsequently, deletion events could be
allotted to the previously assigned bacterial isolates. To determine the distribu-
tion of described deletions from M. microti in the dassie bacillus, primers de-
signed to detect deletions from M. microti (MID1, MID2, and MID3) were also
tested across all isolates (5). Open reading frames (ORFs) affected by deletion
events and their assigned gene function were determined using Tuberculist.
RESULTS
Application of dassie bacillus genomic DNA to the Af-
fymetrix GeneChip demonstrated strong hybridization signals
for the great majority of probes. As expected, for regions of M.
tuberculosis known as being deleted from the dassie bacillus
(RDs 7, 8, 9, and 10), there was a weak hybridization signal,
called “absent” by the Affymetrix Microarray Suite. Further-
more, a previously described phage, phiRv1 or RD3 (30), was
also observed as missing. These results provide internal vali-
dation of the analytical tools. Apart from these five deleted
regions, the dassie bacillus did not reveal any deleted regions
with junctions matching those previously described (4, 5, 6, 17,
33, 39). Analysis by GeneChip revealed another four LSPs in
TABLE 1. Characteristics of bacterial isolatesa
SampleName
Description or
host
Origin or designationIS6110 RFLPPGRS RFLP DR RFLP Spoligotype
47
48
49
50
59
60
63
BCG
H37Ra
Dassie bacillus
Dassie bacillus
Dassie bacillus
Dassie bacillus
M. microti
M. microti
M. microti
BCG Pasteur
M. tuberculosis
Dassie
Suricat
Dassie
Dassie
Vole
Ref strain
Vole
Ref strain
Ref strain
South Africa
Sweden (courtesy G. Bolske)
Australia (animals from South Africa)
Australia (animals from South Africa)
Courtesy T. Jenkins
NCTC 08710
Courtesy T. Jenkins
France
TMC
IS24
IS25
IS23
IS23
IS28
IS27
IS81
IS01
ND
PG122
PG122
PG121
PG121
PG123
PG123
PG123
PG120
ND
DR63
DR63
DR38
DR38
DR56
DR64
ND
DR24
ND
Sp70
Sp70
Sp71
Sp71
Sp67
Sp67
Sp67
Sp07
ND
aSample number, name, host, and origin for isolates. Each isolate is associated to various molecular epidemiological markers: IS6110-based RFLP, PGRS-based
RFLP, DR-based RFLP, and spoligotyping. Also included are the control samples (BCG Pasteur 1173 and M. tuberculosis H37Ra ATCC 25177), placed at the bottom
of the table. ND, not done. Ref, reference.
VOL. 186, 2004GENOMIC DELETIONS IN THE DASSIE BACILLUS 105

Page 3

the dassie bacillus, which we call RD5das, RDVirsdas,
N-RD25das, and RD1das(Table 3). Each newfound region of
deletion follows the nomenclature of the region upon which it
overlaps.
RD5dasdeletes 9,852 bp, affecting Rv2349c to Rv2355, and
has inverted IS6110 insertion sequence in its place. RD5dasis
larger than RD5 deleted from M. bovis/BCG isolates, which
truncates Rv2346c to Rv2353c (4, 17), and RD5mic, which
affects Rv2349c to Rv2353c in vole isolates of M. microti (5).
This apparent deletion hotspot reinforces the proposed
IS6110-mediated deletion of RD5 (5, 23).
RDVirsdasdeletes 1,185 bp, truncating Rv3081 and deleting
Rv3082c in its entirety. The deletion of Rv3082c (virS), anno-
tated as a virulence-regulating transcriptional regulator, is at-
tractive in light of the observation that the dassie bacillus has
been characterized as more attenuated than M. microti (49).
N-RD25dasdeletes 1,941 bp, disrupting Rv3737 and deleting
the entire Rv3738c. N-RD25dasis different from N-RD25,
known to be deleted from M. caprae, M. bovis and BCG, which
affects Rv3738c to Rv3740c (31, 39). Although never impli-
cated in virulence, the deletion of the N-RD25 region is ob-
served as missing from isolates only having deleted RD5, sug-
gesting interplay among these regions.
Finally, the dassie bacillus is also missing part of the RD1
region, revealing itself as another RD1 mutant within the M.
tuberculosis complex. RD1dasdeletes 4,132 bp, affecting only
Rv3874 to Rv3877, and therefore represents the smallest nat-
ural deletion of the RD1 region uncovered to date. In com-
parison, RD1 deleted from all BCG strains affects Rv3871 to
Rv3879c (4, 17, 30), and RD1micdeletes Rv3864 to Rv3876 (5).
Together, the shared region of deletion among these three
attenuated RD1 mutants includes only three ORFs, Rv3874
(cfp10), Rv3875 (esat6), and Rv3876 (Fig. 1).
To assess whether these newfound deletions are specific to
the dassie bacillus, the deletions were tested for across a panel
of isolates (Table 4). These four new deletions are not ob-
served in isolates of M. microti, reinforcing the notion that
these deletions and their junction points are unique to the
dassie bacillus. Although a variant of RD5dasis deleted from
all dassie isolates tested, its downstream junction could be
sequence confirmed in only two of four isolates. We have been
able to confirm the presence of genes flanking RD5dasat either
end (Rv2348c and Rv2356). Primers designed to amplify
unique sequence upstream of RD5daswith IS6110 sequence
produced the same amplicon for all four isolates. However,
primers designed to amplify IS6110 sequence with unique se-
quence downstream of RD5dasfailed to amplify for two iso-
lates. Furthermore, long-range PCR, designed to amplify kilo-
base pairs of DNA (40), also failed to bridge the deletion in
these same isolates using primers known to amplify in the
isolates upstream or downstream of RD5das. The fact that all
four isolates share a common upstream junction (position
2,627,067 of the H37Rv genome) suggests that certain dassie
bacillus strains have endured a genomic event(s) aside from
the deletion of RD5das, potentially IS-mediated recombination
events. Finally, regions corresponding to deletions specific to
M. microti (MID1, MID2, and MID3) were called “present” in
the dassie bacillus via the Affymetrix Microarray Suite, and
their junction regions were PCR confirmed only for isolates of
M. microti.
TABLE 2. Sequence of the primers used to detect deleted regions in the dassie bacillus relative to M. tuberculosis H37Rva
Primer
Sequence
RD5das
RDVirSdas
N-RD25das
RD1das
Forward
AAGAGGCAAAAGCACGTTGT
GATCACCCATTCCTGCATGT
GATCGGCCTTACCCATTTG
AGGAGCGTGAAGAAGACGAC
Reverse
AACGTAGGACGTCTCGGTGA
TAGCGGAACAAGTCCCAGGT
GCTGAGTGCGGAGTATGCTT
CCTATACGTGTTCCCCATCG
Reverse within
CCTACCCGTGGGATTTCAT
GACAGAAGCGGTTCGCATT
ACCAAGGTCATCCCAGACAG
TATCGTCCGGAGCTTCCATA
aForward and reverse primers amplify if the dassie-specific deletion has occurred. Forward and reverse-within primers amplify if the region is intact, as seen in M. tuberculosis H37Rv reference. All primers are listed
in the 5?-to-3? orientation.
106 MOSTOWY ET AL. J. BACTERIOL.

Page 4

In summary, nine deleted regions were found in the dassie
bacillus via GeneChip analysis, involving 48,915 bp and affect-
ing 58 ORFs (Table 3). Of these deletions, five are identical to
deletions from M. microti (RDs 3, 7, 8, 9, and 10) and four are
unique to the dassie bacillus. Two of the deletions specific for
the dassie bacillus overlap with regions deleted from both M.
microti and M. bovis BCG (RD1 and RD5).
DISCUSSION
Using the genomic sequence of M. tuberculosis H37Rv as a
reference, comparative genomic tools have revealed a number
of regions present in H37Rv but absent from isolates of M.
bovis/BCG (4, 17, 39). This information has been used to pro-
pose a phylogeny for the entire M. tuberculosis complex (6, 31)
and to demonstrate the evolution of BCG vaccines after their
first introduction (4, 33). Applying the same methodology, all
major deletions within the dassie bacillus relative to H37Rv
sequence have likely been catalogued. M. africanum and M.
pinnipedii, other M. tuberculosis complex subspecies genetically
clustered together with the dassie bacillus in previous analyses
(31), have also been subjected to GeneChip interrogation.
Although these analyses have revealed subspecies-specific de-
letions beyond RD7, RD8, RD9, and RD10 in these strains,
they do not present the other deletions specific to M. microti
nor those specific to the dassie bacillus (data not shown).
Furthermore, PCR-based interrogation of RD5das, RDVirS,
NRD25das, and RD1das, among M. tuberculosis complex iso-
lates including M. africanum and M. pinnipedii, were amplified
as intact according to the aforementioned criteria (data not
shown). These deletions confirm that the dassie bacillus is
genomically distinct from M. microti and unique within the M.
tuberculosis complex and that a third independent RD1 mutant
has been revealed among members of the M. tuberculosis com-
plex.
The genomic deletion of RD1 is, at least in part, responsible
for the attenuated phenotypes of BCG (29, 36) and M. microti
(36). In the dassie bacillus, there are two attractive candidates
for the attenuated phenotype. virS (Rv3082c) has close simi-
larity with proteins that regulate various functions required for
establishment of disease by several bacterial pathogens, includ-
ing Shigella (45), Yersinia (9), and enterotoxigenic Escherichia
coli (7, 27, 41). Absent from other mycobacterial species, its
deletion putatively affects the expression of genes required by
M. tuberculosis complex subspecies for processes linked to sur-
viving and multiplying in the host (18). The other deletion
likely contributing to its avirulence is RD1das. Since RD1 is the
only genomic region consistently absent from all BCG vaccines
(4, 17, 30), knockout and complementation studies have re-
cently been performed for this entire region, demonstrating
that this deletion, or parts thereof, contributed to the attenu-
FIG. 1. Comparing the RD1 regions. The deletions of RD1 from BCG (RD1bcg) (B), M. microti (RD1mic) (C), and the dassie bacillus (RD1das)
(D) are presented relative to M. tuberculosis H37Rv/H37Ra (A). Panel E depicts the shared genes among all RD1 deletions.
TABLE 3. Description of deletions from the dassie bacillusa
Deleted sequenceStart EndLength (bp) Affected ORFs
RD10
RD3
RD7
RD9
RD5das
RDVirsdas
RD8
N-RD25das
RD1das
264752
1779276
2208005
2330073
2627067
3447248
4056837
4188298
4352300
266658
1788525
2220725
2332104
2636919
3448433
4062732
4190239
4356432
1,907
9,250
12,720
2,032
9,852
1,185
5,896
1,941
4,132
Rv0221–Rv0223c
Rv1573–Rv1586c
Rv1963c–Rv1977
Rv2072c–Rv2075c
Rv2349c–Rv2355
Rv3081–Rv3082c
Rv3617–Rv3623
Rv3737–Rv3738c
Rv3874–Rv3877
aThe start and end point, length, and affected ORFs are listed for each of the
deleted regions (RDs and N-RD) from the dassie bacillus genome relative to that
of M. tuberculosis H37Rv. Deletions are ranked in terms of their location within
the H37Rv genome.
VOL. 186, 2004GENOMIC DELETIONS IN THE DASSIE BACILLUS107

Page 5

ation of BCG (29, 36, 50). The concordance of RD1daswith other
RD1 deletions suggests three candidate genes that are likely im-
portant for this loss of virulence:cfp10, esat6, and Rv3876 (Fig. 1).
Notably, esat6 and cfp10 encode well-described antigenic proteins
whose neighboring genes have recently been characterized to
encode a secretion apparatus dedicated to their export (37). To-
gether these observations suggest that any disruption of the genes
encoding these antigenic proteins or their export system may
result in the same attenuated phenotype.
Newfound deletions from the dassie bacillus are instructive
both for the phylogenetic lessons about LSPs in general and for
the specific genes that have been lost from these isolates.
Although evolutionary study employing LSPs has been attrac-
tive for describing the unidirectional flow of genomic decay
within the M. tuberculosis complex (6, 31), the independent
deletion of overlapping regions, as is observed here for RD5,
N-RD25, and RD1, highlights the importance of sequence
confirming all genomic events for their use as phylogenetic
markers (31). For instance, the absence of mtp40 (Rv2351c)
had previously been proposed as a marker for M. bovis (15).
Since this gene is located in the highly variable RD5 region, it
is now apparent that absence of this gene may occur due to a
number of different genomic deletions, and thus, isolates other
than M. bovis may lack this gene. Regarding the specific genes
contained within deletions, the RD1 region is most intriguing
because of the association of this region with virulence and
vaccine efficacy (29, 30, 36, 37). The loss of RD1 from labora-
tory-adapted BCG strains can be explained by reasoning that
the production of antigenic proteins is metabolically expensive.
Since antigens are unlikely to provide benefit for in vitro
growth, mutants having eliminated RD1 genes would have had
a selective advantage for in vitro survival (32, 33). However,
the loss of RD1 genes from isolates circulating among mam-
malian hosts appears paradoxical, given recent findings that
implicate this region in the pathogenesis of TB in humans and
laboratory models. Because M. microti and the dassie bacillus
are capable of causing and transmitting disease in their specific
hosts, the absence of RD1 genes apparently does not prevent
disease from occurring in these hosts. If this is true, then the
same forces of selection for the loss of RD1 from BCG in vitro
are at play, and specifically, the production of these genes is
unnecessary for the bacteria to spread, and given the metabolic
expense associated with their production, mutants not making
these genes have gained a survival advantage.
M. tuberculosis complex organisms are currently identified to
the species level based on morphological and phenotypic char-
acteristics, but there has been debate as to whether they should
be retained as distinct species or reclassified as variants of M.
tuberculosis (24). Previous work has demonstrated that TB
bacteria in classical hosts are seemingly specified by the dele-
tions they harbor (6, 31, 35). However, deletion data further
imply that M. tuberculosis complex members extend beyond the
classical species of M. tuberculosis, M. africanum, M. microti,
and M. bovis and that isolates from other animals may ulti-
mately reveal their own unique deletion profiles. Given that
phenotypic descriptions of these variants are likely to result in
indeterminate assignments, genomic deletions may prove an
invaluable tool for deriving the taxonomy and nomenclature in
this increasingly complex scenario. It is expected that a more
accurate representation of total genomic polymorphism be-
tween the dassie bacillus and M. microti, and also among the
entire M. tuberculosis complex, will likely reveal itself from the
sequencing of M. microti OV254, also in progress (www.sanger
.ac.uk). With this information will follow the capacity to spe-
cifically detect the dassie bacillus and other variants in humans
and other hosts (28, 35).
ACKNOWLEDGMENTS
Thanks to David Roquis, Carol Dore, Daniel Vincent, Yannick
Fortin, Arek Siwoski, and Pierre LePage at the McGill University and
Genome Quebec Innovation Center for helping with DNA sequencing
and GeneChip experimentation. We thank Goran Bolske, who sup-
plied the suricat isolate, and Tony Jenkins, who supplied a dassie
isolate and M. microti from vole to D.C.
This work was supported by the Canadian Institutes of Health Re-
search (CIHR) grant number MOP 36054. M.A.B. is a New Investi-
gator of the CIHR.
REFERENCES
1. Aranaz, A., E. Lie ´bana, A. Mateos, L. Dominguez, D. Vidal, M. Domingo, O.
Gonzolez, E. F. Rodriguez-Ferri, A. E. Bunschoten, J. D. A. Van Embden,
and D. Cousins. 1996. Spacer oligonucleotide typing of Mycobacterium bovis
strains from cattle and other animals: a tool for studying epidemiology of
tuberculosis. J. Clin. Microbiol. 34:2734–2740.
2. Aranaz, A., E. Lie ´bana, E. Gomez-Mampaso, J. C. Galan, D. Cousins, A.
Ortega, J. Blazquez, F. Baquero, A. Mateos, G. Suarez, et al. 1999. Myco-
bacterium tuberculosis subsp. caprae subsp. nov.: a taxonomic study of a new
member of the Mycobacterium tuberculosis complex isolated from goats in
Spain. Int. J. Syst. Bacteriol. 49:1263–1273.
3. Aranaz, A., D. Cousins, A. Mateos, and L. Dominiguez. Elevation of Myco-
bacterium tuberculosis subsp. caprae to species rank as Mycobacterium caprae
sp. nov. Int. J. Syst. Evol. Microbiol., in press.
4. Behr, M. A., M. A. Wilson, W. P. Gill, H. Salamon, G. K. Schoolnik, S. Rane,
TABLE 4. Large sequence polymorphisms among isolates of the dassie bacillus and M. microtia
SampleName
Distribution of regions
RD5RDVirSN-RD25RD1
47
48
49
50
59
61
63
BCG Pasteur
H37Ra
Dassie bacillus
Dassie bacillus
Dassie bacillus
Dassie bacillus
M. microti
M. microti
M. microti
M. bovis
M. tuberculosis
RD5das*
RD5das*
RD5das
RD5das
RD5mic
RD5mic
RD5mic
RD5bovis
?
RDVirSdas
RDVirSdas
RDVirSdas
RDVirSdas
?
?
?
?
?
N-RD25das
N-RD25das
N-RD25das
N-RD25das
?
?
?
N-RD25bovis
?
RD1das
RD1das
RD1das
RD1das
RD1mic
RD1mic
RD1mic
RD1bcg
?
aDistribution of regions (RDs and N-RD) present or absent in isolates of the dassie bacillus and M. microti. ? indicates that the genomic region in question has
not been deleted relative to sequence of M. tuberculosis H37Rv. The first two columns represent the isolate number and previously assigned name of the isolate being
tested. Control samples (BCG Pasteur 1173 and M. tuberculosis H37Ra ATCC 25177) are placed at the bottom of the table. The asterisk indicates that a variant of
RD5daswas found for these isolates, whose downstream junction could not be sequence confirmed.
108MOSTOWY ET AL.J. BACTERIOL.