SYBR Green-Based Real-Time Quantitative PCR Assay for Detection of West Nile Virus Circumvents False-Negative Results Due to Strain Variability

Department of Microbiology and Immunology, The University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73104, USA.
Journal of Clinical Microbiology (Impact Factor: 3.99). 05/2004; 42(4):1511-8. DOI: 10.1128/JCM.42.4.1511-1518.2004
Source: PubMed


Real-time quantitative PCR is used routinely for the high-throughput diagnosis of viral pathogens, such as West Nile virus
(WNV). Rapidly evolving RNA viruses present a challenge for diagnosis because they accumulate mutations that may render them
undetectable. To explore the effect of sequence variations on assay performance, we generated every possible single point
mutation within the target region of the widely used TaqMan assay for WNV and found that the TaqMan assay failed to detect
47% of possible single nucleotide variations in the probe-binding site and was unable to detect any targets with more than
two mutations. In response, we developed and validated a less expensive assay with the intercalating dye SYBR green. The SYBR
green-based assay was as sensitive as the TaqMan assay for WNV. Importantly, it detected 100% of possible WNV target region
variants. The assay developed here adds an additional layer of protection to guard against false-negative results that result
from natural variations or drug-directed selection and provides a rapid means to identify such variants for subsequent detailed

Download full-text


Available from: Wolfgang R Vahrson,
  • Source
    • "Viral load was determined by RT-qPCR as per our published procedures [51] with primers: WNV Env F: 5′-TCAGCGATCTCTCCACCAAAG-3′; WNV Env R: 5′-GGGTCAGCACGTTTGTCATTG-3′. The following oligo was diluted to generate a standard curve to determine copy number: WNV Env Oligo: TCAGCGATCTCTCCACCAAAGCTGCGTGCCCGACCATGGGAGAAGCTCACAATGACAAACGTGCTGACCC. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The innate immune response to West Nile virus (WNV) infection involves recognition through toll-like receptors (TLRs) and RIG-I-like receptors (RLRs), leading to establishment of an antiviral state. MiRNAs (miRNAs) have been shown to be reliable biomarkers of TLR activation. Here, we sought to evaluate the contribution of TLR3 and miRNAs to the host response to WNV infection. We first analyzed HEK293-NULL and HEK293-TLR3 cells for changes in the innate immune response to infection. The presence of TLR3 did not seem to affect WNV load, infectivity or phosphorylation of IRF3. Analysis of experimentally validated NFκB-responsive genes revealed a WNV-induced signature largely independent of TLR3. Since miRNAs are involved in viral pathogenesis and the innate response to infection, we sought to identify changes in miRNA expression upon infection in the presence or absence of TLR3. MiRNA profiling revealed 70 miRNAs induced following WNV infection in a TLR3-independent manner. Further analysis of predicted gene targets of WNV signature miRNAs revealed genes highly associated with pathways regulating cell death, viral pathogenesis and immune cell trafficking.
    PLoS ONE 08/2014; 9(8):e104770. DOI:10.1371/journal.pone.0104770 · 3.23 Impact Factor
  • Source
    • "The resulting threshold cycle (Ct) is then compared with standard samples or results of reference genes. Both procedures are well accepted for the quantification of specific genes (Papin et al. 2004; Vargas and James 2006). "
    [Show abstract] [Hide abstract]
    ABSTRACT: The production of microcystin toxins by cyanobacteria is an intrapopulation feature and the toxic and nontoxic genotypes can be separated only through molecular analyses targeting the mcy markers. Quantitative real-time PCR (qPCR) is a procedure that has been established, not only to detect but to specifically quantify these genotypes. In the present work, primers were designed for the mcyD region to estimate the number of cyanobacteria that are potential microcystin producers. Laboratory tests to verify the efficiency and the specificity of the primers were performed. The methodology was first established for single strain cultures and thereafter was applied in environmental water samples, from a reservoir located in the Brazilian savannah (“cerrado”). The results were very satisfactory, demonstrating the high efficiency and the specificity of the primers used, and their ability to detect different cyanobacteria genera. Of particular interest were the results showing a high proportion of toxic strains (as high as 100 %) in the environmental samples, as previously reported in another tropical system. Furthermore, the occurrence of a smaller fraction of toxic strains at high cyanobacteria densities, and of more toxic populations when fewer cyanobacteria were present, deserves further investigation. Although records of cyanobacteria blooms are very common in the tropics and suggest an increasing incidence of toxic populations, the present research is one of the few applying qPCR in a tropical environment. The results obtained here, by a technique that allows a more precise quantification and in situ follow-up of changes in toxicity, will make possible new observations of seasonal and spatial dynamics in these environments.
    Journal of Applied Phycology 10/2013; 25(5):1545. DOI:10.1007/s10811-013-9996-4 · 2.56 Impact Factor
  • Source
    • "A disadvantage is that SYBR Green will bind to any double-stranded DNA in the reaction, including non-specific PCR products and primer-dimers. Papin et al. developed a SYBR Green based assay [75] that could detect 100% of the different WNV target region variants in their study, whereas a TaqMan assay failed to detect 47% of possible single nucleotide variations in the probe-binding site. Johnson et al. designed a pan-flavivirus RT-PCR utilizing degenerate primers targeting the NS5 gene to allow the detection of a range of flaviviruses including WNV. "
    [Show abstract] [Hide abstract]
    ABSTRACT: ABSTRACT: West Nile virus (WNV) is a positive-stranded RNA virus belonging to the Flaviviridae family, a large family with 3 main genera (flavivirus, hepacivirus and pestivirus). Among these viruses, there are several globally relevant human pathogens including the mosquito-borne dengue virus (DENV), yellow fever virus (YFV), Japanese encephalitis virus (JEV) and West Nile virus (WNV), as well as tick-borne viruses such as tick-borne encephalitis virus (TBEV). Since the mid-1990s, outbreaks of WN fever and encephalitis have occurred throughout the world and WNV is now endemic in Africa, Asia, Australia, the Middle East, Europe and the Unites States. This review describes the molecular virology, epidemiology, pathogenesis, and highlights recent progress regarding diagnosis and vaccination against WNV infections.
    Veterinary Research 03/2012; 43(1):16. DOI:10.1186/1297-9716-43-16 · 2.82 Impact Factor
Show more