Genetic diversity and high proportion of intersubtype recombinants among HIV type 1-infected pregnant women in Kisumu, western Kenya.

Abstract

The high genetic diversity of HIV-1 continues to complicate effective vaccine development. To better understand the extent of genetic diversity, intersubtype recombinants and their relative contribution to the HIV epidemic in Kenya, we undertook a detailed molecular epidemiological investigation on HIV-1-infected women attending an antenatal clinic in Kisumu, Kenya. Analysis of gag-p24 region from 460 specimens indicated that 310 (67.4%) were A, 94 (20.4%) were D, 28 (6.1%) were C, 9 (2.0%) were A2, 8 (1.7%) were G, and 11 (2.4%) were unclassifiable. Analysis of the env -gp41 region revealed that 326 (70.9%) were A, 85 (18.5%) D, 26 (5.7%) C, 9 (2.0%) each of A2 and G, 4(0.9%) unclassifiable, and 1 (0.2%) CRF02_AG. Parallel analyses of the gag-p24 and env-gp41 regions indicated that 344 (74.8%) were concordant subtypes, while the remaining 116 (25.2%) were discordant subtypes. The most common discordant subtypes were D/A (40, 8.7%), A/D (27, 5.9%), C/A (11, 2.4%), and A/C (8, 1.7%). Further analysis of a 2.1-kb fragment spanning the gag-pol region from 38 selected specimens revealed that 19 were intersubtype recombinants and majority of them were unique recombinant forms. Distribution of concordant and discordant subtypes remained fairly stable over the 4-year period (1996-2000) studied. Comparison of amino acid sequences of gag-p24 and env-gp41 regions with the subtype A consensus sequence or Kenyan candidate vaccine antigen (HIVA) revealed minor variations in the immunodominant epitopes. These data provide further evidence of high genetic diversity, with subtype A as the predominant subtype and a high proportion of intersubtype recombinants in Kenya.

Full text

Page 1

AIDS RESEARCH AND HUMAN RETROVIRUSES
Volume 20, Number 5, 2004, pp. 565–574
© Mary Ann Liebert, Inc.
Genetic Diversity and High Proportion of Intersubtype
Recombinants among HIV Type 1-Infected Pregnant
Women in Kisumu, Western Kenya
CHUNFU YANG,1MING LI,1YA-PING SHI,2,3JORN WINTER,1ANNA M. VAN EIJK,3JOHN AYISI,3
DALE J. HU,1RICHARD STEKETEE,2BERNARD L. NAHLEN,4and RENU B. LAL1
ABSTRACT
The high genetic diversity of HIV-1 continues to complicate effective vaccine development. To better under-
stand the extent of genetic diversity, intersubtype recombinants and their relative contribution to the HIV
epidemic in Kenya, we undertook a detailed molecular epidemiological investigation on HIV-1-infected women
attending an antenatal clinic in Kisumu, Kenya. Analysis of gag-p24 region from 460 specimens indicated that
310 (67.4%) were A, 94 (20.4%) were D, 28 (6.1%) were C, 9 (2.0%) were A2, 8 (1.7%) were G, and 11 (2.4%)
were unclassifiable. Analysis of the env-gp41 region revealed that 326 (70.9%) were A, 85 (18.5%) D, 26 (5.7%)
C, 9 (2.0%) each of A2 and G, 4(0.9%) unclassifiable, and 1 (0.2%) CRF02_AG. Parallel analyses of the gag-
p24 and env-gp41 regions indicated that 344 (74.8%) were concordant subtypes, while the remaining 116
(25.2%) were discordant subtypes. The most common discordant subtypes were D/A (40, 8.7%), A/D (27,
5.9%), C/A (11, 2.4%), and A/C (8, 1.7%). Further analysis of a 2.1-kb fragment spanning the gag–pol region
from 38 selected specimens revealed that 19 were intersubtype recombinants and majority of them were unique
recombinant forms. Distribution of concordant and discordant subtypes remained fairly stable over the 4-
year period (1996–2000) studied. Comparison of amino acid sequences of gag-p24 and env-gp41 regions with
the subtype A consensus sequence or Kenyan candidate vaccine antigen (HIVA) revealed minor variations in
the immunodominant epitopes. These data provide further evidence of high genetic diversity, with subtype A
as the predominant subtype and a high proportion of intersubtype recombinants in Kenya.
565
INTRODUCTION
H
inate the global AIDS epidemic.1–3The group M has been di-
vided into nine distinct lineages, termed as subtypes (A–D, F–H,
J, and K). More recently, genomes containing sequences de-
rived from two or more subtypes and associated with different
populations and geographic distributions have been found.4–6
The main causes of this high variability are the recombination
of heterogeneous genomes by coinfection of cells, and the er-
ror-prone reverse transcriptase that can switch between tem-
plates during proviral synthesis.7,8There are at least 15 circu-
lating recombinant forms (CRFs) identified based on complete
UMAN IMMUNODEFICIENCY VIRUS TYPE 1 (HIV-1) group M
consists of the great majority of HIV-1 viruses that dom-
genome sequences derived from at least three epidemiologically
unrelated individuals.6Thus, genotypic analysis has provided a
better understanding of the dynamics of viral spread and mo-
lecular epidemiology of HIV-1.
The greatest genetic diversity of HIV-1 has been found in
sub-Saharan Africa where all known HIV-1 subtypes and many
of the CRF were identified.1,6As in many other sub-Saharan
countries, the HIV epidemic in Kenya is having a devastating
effect on public health. Of Kenyans, 2.5 million were infected
with HIV by the end of 2001 and HIV prevalence in the adult
population was 15%.9Molecular epidemiological studies have
indicated the presence of diverse HIV-1 subtypes and unique
recombinants.10–16More recent studies have also documented
the presence of subsubtype A2 and A2-containing recombi-
1Division of AIDS, STD, and TB Laboratory Research, National Center for HIV, STD and TB prevention and 2Division of Parasitic Diseases,
National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30333.
3Center for Vector Biology and Control Research, Kenya Medical Research Institute, Kisumu, Kenya.
4Roll-back Malaria Program, World Health Organization, Geneva, Switzerland.

Page 2

nants, and many more unique recombinants.16–19However, al-
most all the molecular epidemiological studies so far have been
limited to urban settings where HIV-1 genetic diversity has been
well documented in antenatal clinic attendees,10,11,13,16com-
mercial sex workers,12,14,15and blood donors.18There is very
little information about the molecular epidemiology of HIV-1
in rural settings where HIV-1 prevalences are among the high-
est in the country.19,20
Continuing molecular epidemiological studies have proved
to be crucial in vaccine development. For example, molecular
epidemiological studies in Thailand documented the indepen-
dent introduction and spread of two different HIV-1 subtypes,
B and CRF01_AE, and the subsequent predominance of
CRF01_AE over time.21–23This molecular epidemiological in-
formation played a key role in our understanding of the dy-
namics of the Thai epidemic and influenced the decision to in-
troduce a bivalent subtype B/E vaccine in the first HIV-1
vaccine efficacy trial in Thailand.24As HIV-1 vaccine trials are
underway or are currently in the planning stage in Kenya,18,25
and HIV-1 viral evolution is a dynamic process, there is a need
to continue monitoring the extent of HIV-1 genetic diversity in
the infected population in different parts of the country.
MATERIALS AND METHODS
Study site and blood sample collection
Women attending an antenatal clinic in New Nyanza Provin-
cial General Hospital, Kisumu, Kenya were enrolled in the
study.26The study protocol was approved in 1995 by the in-
stitutional review boards of the Kenya Medical Research Insti-
tute (KEMRI), the Centers for Disease Control and Prevention
(CDC) in Atlanta, Georgia, and the Academic Medical Center
(AMC) at the University of Amsterdam, Amsterdam, The
Netherlands; and the participating institutions reviewed the pro-
tocol annually. Routine use of zidovudine or NVP for treatment
of HIV-1 infection was not the policy of the Kenyan Health
Ministry during the study period. Detailed demographic and
clinical information about these participants was presented else-
where.26Blood samples from all mothers were collected at de-
livery, and plasma and peripheral blood mononuclear cells
(PBMCs) were separated, aliquoted, and stored at 270°C un-
til laboratory procedures were performed.
HIV testing
HIV testing of pregnant women was conducted using two
consecutive rapid tests, an initial Serostrip HIV-1/2 test (Saliva
Diagnostic Systems, Pte Ltd, Singapore), followed by a con-
firmatory Capillus HIV-1/HIV-2 test (Cambridge Diagnostics
Laboratory, Rockville, MD) on all samples that tested positive
by Serostrip. Western blot was performed on all discordant sam-
ples.
Reverse transcriptase-polymerase chain reaction
(RT-PCR) and sequencing
RNA extracts from the Amplicor HIV-1 monitor test version
1.0 were used to amplify the gag-p24 and env-gp41 regions by
RT-PCR. The primers and protocols were described in detail
elsewhere.27,28Purified nested PCR products were sequenced
using BigDye terminator (Applied Biosystems, Foster City,
CA) in a 377 DNA sequencer (Applied Biosystems) following
the manufacturer’s protocols. For some specimens with con-
cordant or discordant subtypes in the gag-p24 and env-gp41 re-
gions, a 2.1-kb fragment (nt 1237–3370, HXB2) spanning the
gag–pol region was amplified and sequenced. Briefly, two sets
of overlapping primers were used to amplify the 2.1-kb frag-
ment. These include P24 #1 (59 AGYCAAAATTAYCCY-
ATAGT, nt 1174–1193, HXB2) and DP11 (59 CCATTCCTG-
GCTTTAATTTTACTGGTA, nt 2572–2598), and DP10 (59
CAACTCCCTCTCAGAAGCAGGAGCCG, nt 2198–2223)
and RT-p24R1 (59 TATTTCTGCTATTAAGTCTTTTGATG-
GGTCA, nt 3506–3536). Primers for the nested PCR are p24
YANG ET AL.
566
FIG. 1.
among 460 women in Kisumu, Kenya. (A) Subtype distribu-
tion based on gag-p24 (outer pie) and env-gp41 (inner pie). A,
A2, C, D, G, and U stand for subtypes and unclassifiable, and
X represents other minor subtypes (, 1%). (B) Frequency of
concordant subtypes (A/A. D/D, C/C, G/G, A2/A2) and dis-
cordant subtypes (D/A, A/D, D/C, U/D, C/A, A/C) and all other
combinations in the gag-p24 and env-gp41 regions.
Distribution of subtypes and discordant subtypes
A
B

Page 3

#2 (AGRACYTTRAAYGCATGGGT, nt 1237–1265) and
DP17 (59 CTAATGGGAAAATTTAAAGT, nt 2538–2557),
and DP16 (59 CCCTCAAATCACTCTTTGGCA, nt 2252–
2272) and Rev7 (ATCCCTGGATAAATCTGACTTGCCCA,
nt 3345–3370). Protocols for amplification and sequencing were
essentially the same as described previously,27,28except that the
PCR conditions were 94°C for 1 min, 50°C for 1 min, and 72°C
for 2 min. All sequencing was done in both directions.
HIV-1 MOLECULAR EPIDEMIOLOGY IN WESTERN KENYA
567
FIG. 2.
ted) and 38 env-gp41 sequences (B, nt 5 360 bp) from Kenyan women by the neighbor-joining method using subtype reference
strains A, A2, C, D, F, G, H, J, and CRFs (CRF01_AE, CRF02_AG), (boxed). The newly characterized sequences shown in
black and underlined are URFs and in colors (A1, red; A2, pink; C, yellow; D, blue; G, green) are pure subtypes in either re-
gion. Schematic representation of genomic structures of the gag–pol and env-gp41 regions from all 38 women (C). Four are con-
cordant subtypes (three D and one G), 15 are discordant subtypes (seven D/A, five A/D, one each G/D, A/C, and C/A), and 19
were URFs.
Phylogenetic analysis of 34 gag–pol sequences (A, consensus nt 5 1921 bp, 4 sequences with short length were omit-

Page 4

Phylogenetic analysis
We aligned the newly derived sequences, along with selected
reference sequences representing all subtypes and relevant CRFs,
using the CLUSTALW (1.74) multiple-sequence alignment pro-
gram.29,30After manual adjustments using BioEdit31and stripping
all the gap sites, phylogenetic analyses were carried out on 436-
bp consensus sequences for gag-p24 and 360-bp consensus se-
quences for env-gp41 and neighbor-joining trees were constructed
using the Phylip 3.5c package.32The stability of the tree nodes
was assessed by bootstrap analysis using 1000 replicates. Boot-
strap values$70% were considered significant.33Genetic dis-
tances were calculated with the Kimura’s two-parameter method.32
To screen intersubtype recombinants, we first applied the re-
combinant identification program (RIP) (http://linker.lanl.
gov/RIP/RIPsubmit.html) to the newly derived sequences,
YANG ET AL.
568
FIG. 3.
recombinants were determined by RIP and bootscanning analyses as implemented in SimPlot34and were confirmed by subseg-
ment phylogenetic analyses. Subtype designation and bootstrap values $ 70% are indicated.33(B) Phylogenetic analysis of the
16 newly derived recombinants (in red) with published recombinants from Kenya (in black18) and Tanzania (in blue35).
Genomic structures of the 19 unique recombinant forms from Kisumu, Kenya (A). The subtype structures of the 19

Page 5

along with subtype consensus sequences. If a potential recom-
binant was identified, bootscanning analysis was implemented
as in SimPlot34to locate the breakpoints. After gap stripping
of the alignment, we analyzed 500 replicates using a 400-bp
window with a 20-bp increment. We repeated the bootscan anal-
ysis with only the parental subtypes plus one subtype in order
to obtain a clear recombinant breakpoint. After breakpoint iden-
tification, each of the segments on the two sides of the break-
point was subjected to individual phylogenetic analysis.
Identification of amino acid variations in the
immunodominant regions
The newly derived nucleotide sequences were translated into
amino acid sequences and amino acid sequences were aligned.29
The aligned amino acid sequences were compared with the sub-
type A consensus sequence from the HIV database and the
Kenyan candidate vaccine antigen (HIVA)25and epitope vari-
ations were identified.
RESULTS
HIV-1 Subtypes among pregnant women
From the 518 women included in this study, we were able to
amplify gag-p24 from 466 samples and env-gp41 sequences from
468 samples; the remaining samples either had negative RT-PCR
or had ambiguous sequences that could not be used for further
analysis. For the purpose of this study, 460 samples with both
gag-p24 and env-gp41 sequences were used for further analysis.
Analysis of the 460 gag-p24 sequences indicated 310 (67.4%)
were subtype A, 94 (20.4%) were subtype D, 28 (6.1 %) were
subtype C, 9 (2.0%) were subtype A2, 8 (1.7%) were subtype G,
and the remaining 11 (2.4%) were unclassifiable (U). A similar
analysis of the env-gp41 region revealed that 326 (70.9%) were
subtype A, 85 (18.5 %) were subtype D, 26 (5.7%) were subtype
C, 9 (2.0%) each were subtypes A2 and G, 4 (0.9%) were un-
classifiable, and 1 (0.2%) was CRF02_AG (Fig. 1).
Parallel phylogenetic analyses in the gag-p24 and env-gp41
regions to identify discordant subtypes revealed that 344
(74.8%) specimens had the same subtype in both the gag-p24
and env-gp41 regions (270 subtype A, 48 subtype D, 14 sub-
type C, 7 subtype G, and 5 subsubtype A2), while the remain-
ing 116 (25.2%) had discordant subtypes (40 D/A, 27 A/D, 11
C/A, 8 A/C, and 30 with other subtype combinations) (Fig. 1).
Among all subtype combinations (concordants and discor-
dants), A/A was by far the most common one, accounting for
58.7% of all women, followed by D/D (10.4%), D/A (8.7%),
A/D (5.9%), C/C (3%), C/A (2.4%), A/C (1.7%), G/G (1.5%),
U/D (1.3%), A2/A2 (1.1%), and D/C (0.87%); the remaining
20 women (4.3%) had minor discordant subtype combinations
(Fig. 1B). These minor subtype combinations include three
U/A, two each of A/U, A2/A, C/D, and U/A2, and one each of
A/A2, A/G, A/AG, A2/D, A2/U, C/A2, D/G, D/U, and G/D.
Identification of unique recombinant forms
To determine whether the discordant subtypes with mosaic
genomes in the gag-p24 and env-gp41 regions represent infec-
tions with two different subtypes or with intersubtype recom-
HIV-1 MOLECULAR EPIDEMIOLOGY IN WESTERN KENYA
569
FIG. 4.
types based on gag-p24 and env-gp41 gene regions was analyzed in specimens collected from mid 1996–1997 (n 5 114), 1997–1998
(n 5 145), 1998–1999 (n 5 107), and 1999–2000 (n 5 94) and remained fairly stable over this 4–year period.
Temporal relationship of concordant and discordant subtypes over time. The distribution of concordant and discordant sub-