The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3',3'-dimethylsuccinyl}-betulinic acid.

Abstract

Despite the effectiveness of currently available antiretroviral therapies in the treatment of HIV-1 infection, a continuing need exists for novel compounds that can be used in combination with existing drugs to slow the emergence of drug-resistant viruses. We previously reported that the small molecule 3-O-{3',3'-dimethylsuccinyl}-betulinic acid (DSB) specifically inhibits HIV-1 replication by delaying the processing of the CA-SP1 junction in Pr55Gag. By contrast, SIVmac239 replicates efficiently in the presence of high concentrations of DSB. To determine whether sequence differences in the CA-SP1 junction can fully account for the differential sensitivity of HIV-1 and SIV to DSB, we engineered mutations in this region of two viruses and tested their sensitivity to DSB in replication assays using activated human primary CD4+ T cells.
Substitution of the P2 and P1 residues of HIV-1 by the corresponding amino acids of SIV resulted in strong resistance to DSB, but the mutant virus replicated with reduced efficiency. Conversely, replication of an SIV mutant containing three amino acid substitutions in the CA-SP1 cleavage site was highly sensitive to DSB, and the mutations resulted in delayed cleavage of the CA-SP1 junction in the presence of the drug.
These results demonstrate that the CA-SP1 junction in Pr55Gag represents the primary viral target of DSB. They further suggest that the therapeutic application of DSB will be accompanied by emergence of mutant viruses that are highly resistant to the drug but which exhibit reduced fitness relative to wild type HIV-1.

Full text

Page 1

Page 1 of 10
(page number not for citation purposes)
Retrovirology
Research
The sequence of the CA-SP1 junction accounts for the differential
sensitivity of HIV-1 and SIV to the small molecule maturation
inhibitor 3-O-{3',3'-dimethylsuccinyl}-betulinic acid
Jing Zhou1, Chin Ho Chen2 and Christopher Aiken*1
Address: 1Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN, USA and 2Department of
Pathology, Duke University Medical Center, Durham, NC, USA
Email: Jing Zhou - jing.zhou@vanderbilt.edu; Chin Ho Chen - chc@duke.edu; Christopher Aiken* - chris.aiken@vanderbilt.edu
* Corresponding author
Abstract
Background: Despite the effectiveness of currently available antiretroviral therapies in the
treatment of HIV-1 infection, a continuing need exists for novel compounds that can be used in
combination with existing drugs to slow the emergence of drug-resistant viruses. We previously
reported that the small molecule 3-O-{3',3'-dimethylsuccinyl}-betulinic acid (DSB) specifically
inhibits HIV-1 replication by delaying the processing of the CA-SP1 junction in Pr55Gag. By contrast,
SIVmac239 replicates efficiently in the presence of high concentrations of DSB. To determine
whether sequence differences in the CA-SP1 junction can fully account for the differential
sensitivity of HIV-1 and SIV to DSB, we engineered mutations in this region of two viruses and
tested their sensitivity to DSB in replication assays using activated human primary CD4+ T cells.
Results: Substitution of the P2 and P1 residues of HIV-1 by the corresponding amino acids of SIV
resulted in strong resistance to DSB, but the mutant virus replicated with reduced efficiency.
Conversely, replication of an SIV mutant containing three amino acid substitutions in the CA-SP1
cleavage site was highly sensitive to DSB, and the mutations resulted in delayed cleavage of the CA-
SP1 junction in the presence of the drug.
Conclusions: These results demonstrate that the CA-SP1 junction in Pr55Gag represents the
primary viral target of DSB. They further suggest that the therapeutic application of DSB will be
accompanied by emergence of mutant viruses that are highly resistant to the drug but which exhibit
reduced fitness relative to wild type HIV-1.
Background
The advent of highly active antiretroviral therapy has had
a tremendous impact on the treatment of HIV infection.
Combinations of drugs targeting the viral reverse tran-
scriptase and protease enzymes allow for potent inhibi-
tion of viral replication to undetectable levels in many
infected individuals. Despite these successes, the continu-
ous administration of these drugs over many years leads
to eventual treatment failure, and the drugs are often
poorly tolerated. Novel inhibitors targeting additional
steps in the viral life cycle could prove to be useful addi-
tions to the current arsenal of HIV therapies.
Retroviruses must undergo proteolytic maturation at a
late step of replication (for a review, see [1]. For HIV-1, the
viral protease (PR) cleaves the Gag precursor Pr55Gag into
Published: 29 June 2004
Retrovirology 2004, 1:15doi:10.1186/1742-4690-1-15
Received: 09 June 2004
Accepted: 29 June 2004
This article is available from: http://www.retrovirology.com/content/1/1/15
© 2004 Zhou et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all
media for any purpose, provided this notice is preserved along with the article's original URL.

Page 2

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 2 of 10
(page number not for citation purposes)
the mature processed proteins MA, CA, SP1, NC, SP2, and
p6. Cleavage occurs in a temporally regulated fashion,
with processing between CA and SP1 representing the
final step. Release of SP1 is essential for proper capsid
condensation and function: mutations that prevent
release of SP1 result in noninfectious virions containing
unstable cores [2].
We and others have recently described the mechanism of
action of 3-O-{3',3'-dimethylsuccinyl}-betulinic acid
[DSB; referred to as YK-FH312 and PA-457 in other stud-
ies [3,4]], a small molecule inhibitor of HIV-1 replication
[4,5]. The compound acts at a late stage of the HIV-1 rep-
lication cycle and results in the accumulation of an inter-
mediate in the processing of Pr55Gag due to delayed
cleavage at the CA-SP1 junction. Although DSB potently
inhibits HIV-1 replication, SIV is fully resistant to the
drug, and a chimeric SIV virus encoding the CA and SP1
regions of HIV-1 was sensitive to the compound [5]. Point
mutations in the CA-SP1 junction resulted in limited
resistance to DSB, further underscoring its novel mecha-
nism of action [4,5]. Here we report an analysis of the
effects of additional substitutions in the CA-SP1 cleavage
site on DSB sensitivity. As few as two mutations in the
HIV-1 cleavage site were found to confer strong resistance
to the drug, while three substitutions in this region of SIV
rendered the virus highly sensitive to DSB.
Results
We previously reported that DSB specifically inhibits HIV-
1 replication by delaying the processing of the CA-SP1
junction by the viral PR [5]. By contrast, SIVmac239 was
completely resistant to the drug, while the chimeric virus
SIV(HIV CA-p2) was sensitive. Additional studies demon-
strated that DSB inhibited HIV-1 and SIV(HIV CA-p2)
with equal potency (our unpublished results). HIV-1 and
SIVmac239 exhibit a limited number of differences in the
CA-SP1 junction (Fig. 1), suggesting that differences
between these sequences may underlie the differential
sensitivity of the two viruses to DSB. To test this hypothe-
sis, we designed and constructed HIV-1 and SIV mutants
containing the corresponding residues of the opposite
virus. Obvious differences were the identities of the resi-
dues at the P2 and P1 positions; we therefore created an
HIV-1 mutant (HIVm2) containing a substitution of L and
M for the V and L residues found at these positions. In
addition, we made the reciprocal substitutions in SIV
(SIVm2). Finally, to determine whether an additional sub-
stitution in SIV might be required for conferring sensitiv-
ity to DSB, we added the corresponding substitution at the
P4' position (SIVm3). Full-length proviral clones contain-
ing these mutations were constructed to facilitate produc-
tion of virus stocks for analysis of DSB sensitivity.
An HIV-1 mutant containing two substitutions at the CA-
SP1 junction is highly resistant to DSB
Mutations in the SP1 region have been reported to inhibit
HIV-1 assembly [6]. To produce virus stocks and to deter-
mine whether the mutations affected virus assembly, the
mutant and wild type proviral clones were transfected into
239T cells and the culture supernatants were quantified
for virus content by p24 ELISA (HIV-1 stocks) or reverse
transcriptase (RT) activity (SIV stocks). In all cases, the
mutations were found to have only minimal effects on
virus assembly and release, and in the case of the HIVm2
and SIVm3 mutants, moderate enhancements of particle
production were observed (Fig. 2, panels A and C). Immu-
noblot analysis using CA-specific antisera revealed that, in
the absence of DSB, the CA-SP1 junction was processed
efficiently for wild type and mutant viruses (Fig. 3A). As
previously reported [3-5], in wild type HIV-1 particles pro-
duced in the presence of DSB, cleavage of CA-SP1 was
impaired, resulting in reduced infectivity (Fig. 3). By con-
trast, the infectivity of the HIVm2 virus was slightly
enhanced by the drug, indicating that alterations of P2
and P1 residues to those of SIV rendered HIV-1 resistant
to DSB (Fig. 3B). Accordingly, immunoblot analysis fur-
ther revealed no accumulation of CA-SP1 in HIVm2 parti-
cles produced in the presence of DSB (Fig. 3A). As a
control for the immunoblotting experiments, we analyzed
HIV-1 containing the L363F previously shown to render
Comparison of HIV-1 and SIVmac239 CA-SP1 Gag cleavage sites, and substitution mutants analyzed in this study
Figure 1
Comparison of HIV-1 and SIVmac239 CA-SP1 Gag cleavage
sites, and substitution mutants analyzed in this study. The
HIVm2 mutant contains the P2 and P1 residues of SIV, while
the SIVm2 and SIVm3 mutants contain substitutions of the
corresponding HIV-1 amino acids. HIV-1 and SIV mutants
were created in the pNL4-3 and pBR239E full-length molecu-
lar clones, respectively.

Page 3

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 3 of 10
(page number not for citation purposes)
HIV-1 partially resistant to DSB[5]. As expected, this
mutant also exhibited efficient cleavage of CA-SP1 junc-
tion in the presence or absence of DSB.
Mutations at the CA-SP1 junction render SIV sensitive to
DSB
To determine whether sequences at the CA-SP1 junction
can result in SIV sensitivity to DSB, we produced the
Effects of CA-SP1 cleavage site substitution mutations on virus particle production and sensitivity to DSB
Figure 2
Effects of CA-SP1 cleavage site substitution mutations on virus particle production and sensitivity to DSB. A and C: wild type
and mutant virions were produced by transfection of 293T cells, and particles were harvested and quantified by p24 ELISA (A)
or reverse transcriptase assays (C). Mean values of five (panel A) or four (panel C) independent determinations are shown. B
and D: assays of viral infectivity. HIV-1 and SIV were assayed for infectivity on P4-CCR5 indicator cells. Shown are the mean
values of triplicate determinations after normalizing for p24 (HIV-1) or RT (SIV) in the virus stocks. Error bars represent one
standard deviation.

Page 4

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 4 of 10
(page number not for citation purposes)
SIVm2 and SIVm3 virions in 293T cells in the presence
and absence of DSB. Production of the triply substituted
mutant SIVm3 in the presence of DSB resulted in a small
but significant accumulation of uncleaved CA-SP1, while
this effect was not observed in wild type SIV (Fig. 4A). The
infectivity of SIVm3 was less than wild type SIV (Fig. 2D),
and was reduced by approximately 70% when the parti-
cles were produced in the presence of DSB (Fig. 4B). These
results suggest that sequences in the CA-SP1 region of Gag
determine the sensitivity of HIV-1 and SIV to DSB. In
additional experiments, we tested whether the two substi-
tutions at the P2 and P1 positions were sufficient to confer
DSB sensitivity. The SIVm2 mutant virus was unaffected
by DSB, both in single-cycle infectivity assays (Fig. 4B)
and in immunoblot analyses (Fig. 4A). However, SIVm2
was found to be incapable of maintaining a spreading
infection in CEMx174 and primary T cells (data not
shown), possibly due to a reduced efficiency of particle
production (Fig. 2C). Therefore this mutant was not ana-
lyzed in studies of virus replication.
Mutations at the CA-SP1 junction render HIV-1 resistant to DSB, as revealed by single-cycle infection assays
Figure 3
Mutations at the CA-SP1 junction render HIV-1 resistant to
DSB, as revealed by single-cycle infection assays. Viruses
were harvested from transfected 293T cells cultured in the
presence of the indicated concentrations of DSB. Panel A:
immunoblot analysis of viral lysates. Viral supernatants (1 ml)
were pelleted, lysed, and subjected to SDS-PAGE and immu-
noblotting using polyclonal antisera to HIV-1 CA. Panel B:
effects of DSB on HIV-1 infectivity. Viral supernatants were
assayed for infection of P4-CCR5 indicator cells. Infectivity
was calculated after normalizing for the p24 content of the
inocula. Values shown are normalized against the infectivity
of the respective vehicle-treated virus. The absolute infectiv-
ity values of the control viruses are shown in Fig. 2B. Results
are representative of two independent experiments.
Mutations at the CA-SP1 junction confer DSB sensitivity to SIV, as revealed by single-cycle infection assays
Figure 4
Mutations at the CA-SP1 junction confer DSB sensitivity to
SIV, as revealed by single-cycle infection assays. Wild type
and mutant SIV viruses were harvested from transfected
293T cells cultured in the presence of the indicated concen-
trations of DSB. Panel A: immunoblot analysis of viral lysates
using a monoclonal antibody specific for SIV CA. Panel B:
effects of DSB on SIV infectivity. Viral supernatants were
assayed for infection of P4-CCR5 indicator cells. Infectivity
was calculated after normalizing for the RT content of the
SIV inocula. Values shown are normalized against the infectiv-
ity of the vehicle-treated virus stock. The absolute infectivity
values of the control viruses are shown in Fig. 2D. The
results are representative of two independent experiments.

Page 5

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 5 of 10
(page number not for citation purposes)
Replication of HIVm2 is highly resistant to DSB
The HIV-1 inhibitory effect of DSB is most pronounced in
continuous replication assays, probably because nascent
virions are highly infectious yet most sensitive to the delay
in core maturation induced by the compound [5]. To fur-
ther analyze the effects of the CA-SP1 cleavage site muta-
tions on DSB sensitivity, we assayed the growth of wild
type and mutant viruses in primary CD4+ T cells purified
The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to DSB
Figure 5
The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to DSB. Viruses were harvested
from transfected 293T cells, and equal quantities of p24 were used to inoculate cultures of activated primary CD4+ T cells. Cul-
tures were maintained in the indicated concentrations of DSB and supernatants were monitored periodically for p24 produc-
tion (A and B) or RT activity (C and D). Panel A: wild type HIV-1; Panel B: HIVm2; Panel C: wild type SIV; Panel D: SIVm3. Data
shown are representative of duplicate growth curves. Similar results were obtained in two independent experiments.

Page 6

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 6 of 10
(page number not for citation purposes)
by positive selection from peripheral blood. T cells were
activated using mitomycin C-killed allogeneic PBMCs and
staphylococcal enterotoxin B, and cultured in IL-2-con-
taining medium. As previously reported, HIV-1 replica-
tion in this system is highly efficient and reproducible,
thus reducing the donor-to-donor and sample-to-sample
variability often observed in cultures of PHA-activated
PBMCs [7]. Titration of DSB in cultures inoculated with
the HIVm2 mutant revealed that this virus was not inhib-
ited by DSB at concentrations as high as 100 ng/ml (Fig.
5B). By contrast, DSB potently inhibited the replication of
wild type HIV-1, with an IC50 of approximately 6 ng/ml
(Fig. 5A). Interestingly, low concentrations of DSB actu-
ally resulted in a significant increase in the yields of
HIVm2 virions at the peak of the growth curves, an effect
we previously observed with wild type SIV [5]. Thus, when
the P2 and P1 residues of the HIV-1 CA-SP1 cleavage site
were replaced by the corresponding amino acids of SIV,
the response of HIV-1 to DSB strongly mimicked that of
SIVmac239. Comparison of the untreated control cultures
further demonstrated that the two amino acid substitu-
tions resulted in a significant replication delay relative to
wild type HIV-1, possibly owing to the small but detecta-
ble reduction in infectivity observed for the mutant virus
in single-round infection assays (Fig. 2B). In additional
studies, we observed that HIVm2 replicated efficiently in
the presence of DSB concentrations of up to 1.6 mg/ml,
suggesting that the mutant virus is completely resistant to
the compound, like wild type SIV.
Replication of SIVm3 is potently inhibited by DSB
The modest reduction in infectivity of SIVm3 by DSB
observed in single-round infection assays suggested that
the replication of this virus in primary T cells might also
be inhibited by DSB. To test this hypothesis, we assayed
replication of wild type and mutant SIV in primary T cells
cultured in the presence of a range of DSB concentrations
(Fig. 5, panels C and D). Relative to wild type SIV,
replication of the SIVm3 mutant was delayed by approxi-
mately 8 days, with a markedly reduced virus output at the
peak of replication. However, by contrast to wild type
virus, replication of SIVm3 was inhibited by DSB with an
IC50 of approximately 12 ng/ml. This sensitivity was com-
parable to that of wild type HIV-1. We conclude that as
few as three substitutions in the CA-SP1 cleavage site can
render SIV highly sensitive to DSB.
Mutations at the CA-SP1 junction determine the
differential sensitivity of HIV-1 and SIV to the delay in CA-
SP1 cleavage induced by DSB
We previously demonstrated that DSB results in a signifi-
cant delay in cleavage of the CA-SP1 site in HIV-1 Gag,
and that a single mutation (L363F) at the P1 position pre-
vented the processing impairment and resulted in signifi-
cant level of resistance [5]. To further probe the molecular
basis for the DSB sensitivity of SIVm3, we performed
pulse-chase analysis of Gag processing in particles pro-
duced in the presence and absence of DSB. As shown in
Fig. 6B, DSB had no detectable effect on processing of Gag
in wild type SIV. By contrast, SIVm3 particles exhibited a
modest delay in processing of the CA-SP1 junction when
the drug was present during virion maturation. Phos-
phorimager quantitation of the radioactive proteins on
the gels further confirmed that CA-SP1 cleavage in SIV
particles further confirmed these observations (Fig. 7).
These observations are consistent with the small but
detectable accumulation of CA-SP1 observed in immuno-
blots of the SIVm3 virions, and support the conclusion
that the DSB sensitivity of SIVm3 results from delayed
processing of the CA-SP1 cleavage site in the mutant par-
ticles. In the absence of DSB, SIVm3 was markedly
delayed in CA-SP1 processing relative to wild type SIV,
suggesting that the reduced replicative capacity of this
virus may result from a delay in virus maturation. In an
analogous manner, the DSB-resistant HIV-1 mutant
HIVm2 exhibited moderately delayed kinetics of process-
ing of the CA-SP1 junction relative to wild type HIV-1
(Figs. 6A and 7) and reduced replicative efficiency. How-
ever, CA-SP1 processing was not affected by DSB in these
particles, consistent with results of previous studies of
HIV-1 mutants that exhibit partial resistance to DSB [4,5].
Collectively, these results demonstrate that sequences at
the CA-SP1 junction control the sensitivity of this cleavage
site to DSB-delayed cleavage by PR. They further suggest
that the cleavage sites of HIV-1 and SIV are recognized
optimally by the cognate viral proteases.
Discussion
In this report, we demonstrate that the differential sensi-
tivity of HIV-1 and SIVmac239 to DSB is governed prima-
rily by sequences at the CA-SP1 cleavage site of Pr55Gag.
DSB is a potent inhibitor of HIV-1 replication that acts by
a unique mechanism. However, the mechanism remains
incompletely understood, as a direct binding interaction
between the compound and its putative target has not yet
been detected. Several lines of evidence indicate that DSB
inhibits HIV-1 replication by targeting the CA-SP1 junc-
tion. First, HIV-1 is highly sensitive to the compound,
while SIVmac239 is completely resistant. A chimeric SIV
containing the HIV-1 CA and SP1 coding sequences
exhibited DSB sensitivity equivalent to that of wild type
HIV-1 [5]; Zhou and Aiken, unpublished results),
demonstrating that the determinants of sensitivity map to
the CA and SP1 coding sequences of gag. Second, we show
in the present study that DSB delays the processing of the
CA-SP1 junction when present during HIV-1, but not SIV,
maturation. Finally, selection of HIV-1 for replication in
moderate concentrations of DSB resulted in mutations at
the P1 and P1' positions of this cleavage site, either of
which conferred modest resistance to the compound.

Page 7

Retrovirology 2004, 1:15 http://www.retrovirology.com/content/1/1/15
Page 7 of 10
(page number not for citation purposes)
Previous studies reported that single substitutions at the
P1 or P1' positions of the CA-SP1 junction render HIV-1
moderately resistant to DSB (approximately ten fold
increase in the IC50) [4,5]. The highly conserved nature of
the CA-SP1 cleavage site in HIV-1 isolates, together with
the specific differences in the corresponding SIV sequence,
suggested that these sequences might fully account for the
differential sensitivity of HIV-1 and SIV to DSB; this hypo-
thesis proved correct. In the present study, we demon-
strate that two mutations in the C-terminus of CA
rendered HIV-1 fully resistant to DSB. Our data indicate
that differences between the SIV and HIV-1 proteases do
not contribute to the sensitivity to DSB. Our results thus
invalidate other potential models for DSB action, such as
alteration of protease substrate specificity by DSB binding
to the viral protease. Our data further demonstrate that
the differential sensitivity of HIV-1 and SIV to DSB is not
due to intrinsic differences in the rates of processing of the
CA-SP1 junction in these viruses (Fig. 7).
Pulse-chase analysis of Gag processing in wild type and mutant HIV-1 and SIV particles
Figure 6
Pulse-chase analysis of Gag processing in wild type and mutant HIV-1 and SIV particles. Virions were harvested at the indicated
times from provirus-transfected 293T cells that were pulse-labeled with 35S-labeled amino acids and cultured in the presence
and absence of DSB (2.5 µg/ml). Particles were lysed and the Gag proteins immunoprecipitated using CA-specific monoclonal
antibodies, and radioactive proteins in the immunoprecipitates analyzed by SDS-PAGE and autoradiography. Panel A: Analysis
of HIV-1 and HIVm2; Panel B: Analysis of SIV and SIVm3. Similar results were observed in two independent experiments.

Page 8

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 8 of 10
(page number not for citation purposes)
In this study, substitution of three amino acids in the CA-
SP1 cleavage site were sufficient to render SIV replication
highly sensitive to DSB in T cells. Interestingly, processing
of the CA-SP1 junction in the SIVm3 virions was only
moderately affected by DSB as compared to the more pro-
nounced effects of the compound on cleavage of HIV-1
Quantitative analysis of the 35S levels in the CA and CA-SP1 bands in the pulse-chase assays of Gag processing shown in Fig. 6
Figure 7
Quantitative analysis of the 35S levels in the CA and CA-SP1 bands in the pulse-chase assays of Gag processing shown in Fig. 6.
Dried gels were analyzed for radioactivity using a Fuji phosphorimager. Values shown represent the quantity of CA as a per-
centage of the sum of CA plus CA-SP1.

Page 9

Retrovirology 2004, 1:15http://www.retrovirology.com/content/1/1/15
Page 9 of 10
(page number not for citation purposes)
Gag. Relative to wild type SIV, the SIVm3 mutant also
exhibited delayed processing in the absence of DSB, sug-
gesting that the mutations have a deleterious effect on SIV
infectivity and that even a modest delay in cleavage is suf-
ficient to confer high sensitivity to the compound. It is
also possible that additional residues in the HIV-1 CA-SP1
cleavage site, such as the serine residue at the P5' position,
are necessary for optimal DSB binding to its target.
A plausible mechanism for DSB action involves binding
of the compound to the CA-SP1 junction in Pr55Gag dur-
ing HIV-1 assembly. However, we and others have failed
to detect an effect of DSB cleavage on recombinant Gag or
in HIV-1 virus-like particles in vitro [3-5]. These negative
results suggest that DSB may be incorporated into a cavity
formed by associated Gag molecules during HIV-1 particle
assembly, where it subsequently interferes with binding of
PR during maturation. Alternatively, the compound may
be nonspecifically incorporated into virions, and may
associate with a Gag processing intermediate transiently
formed during maturation, such as CA-SP1 or MA-CA-
SP1. Future studies will be aimed at testing these models.
DSB represents an especially promising candidate for anti-
viral therapy. The compound is highly potent against a
variety of HIV-1 isolates, moderately soluble in aqueous
solutions, and nontoxic at high concentrations. Although
DSB-resistant mutant viruses are readily selected in cul-
ture, such mutants are significantly reduced in replication
efficiency, indicating that mutant viruses are less fit than
wild type. This was not unexpected, as the sequence of the
CA-SP1 junction is highly conserved among HIV-1 iso-
lates, and changes in the proximal half of the cleavage site
could also affect the function of the CA protein. DSB acts
through a mechanism that is distinct from currently
approved antiretrovirals, suggesting that the compound is
likely to be useful in combination with other classes of
HIV-1 therapeutics.
Conclusions
Our results demonstrate that the differential sensitivity of
HIV-1 and SIV to inhibition by DSB is determined by
sequences at the CA-SP1 cleavage site in Gag. We conclude
that the CA-SP1 junction represents the primary viral
target of the inhibitor. Our results further demonstrate
that strong resistance to DSB can result from as few as two
amino acid changes in Gag, and that resistance is accom-
panied by a reduction in viral fitness.
Methods
Cells and Viruses
Primary CD4+ T cells were purified from human blood by
positive selection, and were activated and cultured as pre-
viously described [7]. CEMx174 cells were cultured in
RPMI 1640 supplemented with 10% fetal bovine serum
(FBS) and antibiotics. 293T cells were cultured in
Dulbecco's Modified Eagle Medium supplemented with
10% FBS and antibiotics. The wild type full-length HIV-1
and SIV molecular clones pNL4-3 [8] and pBR239E (an
unpublished construct generously provided by Toshiaki
Kodama), respectively, were used for these studies. Viri-
ons were produced by transfection of 293T cells using a
calcium phosphate coprecipitation method, as previously
described [9]. Hela-CD4/LTR-lacZ-CCR+ (P4-R5) cells
were used as target cells in single-cycle infection assays, as
previously described [10]. HIV-1 p24 antigen was quanti-
fied by antigen-capture ELISA [11]. SIV stocks were quan-
tified by reverse transcriptase assays of viral lysates, by a
modification of a previously reported method [12].
Duplicate aliquots of virus supernatants (5 µl) were added
to 20 µl of RT assay cocktail (50 mM Tris-HCl, pH 8.3, 60
mM KCl, 7 mM DTT, 10 µg/ml of poly rA, 5 µg/ml of oligo
dT, 7 mM MgCl2, .07% of Triton X-100, 40 µCi/ml of 3H-
TTP {60 Ci/mmol}). Reactions were incubated at 37°C
for 2 h, and aliquots (5 µl) were spotted on DE-81 paper
(Whatman) in a 96-well array. The filters were washed
thrice in a solution containing 0.3 M NaCl and 30 mM
sodium citrate (2X SSC) for 5 minutes, rinsed with etha-
nol, and dried. Filters were analyzed for radioactivity
using a MATRIX Direct Beta Counter (Packard
BioSciences).
Synthesis of DSB (3-O-{3',3'-dimethylsuccinyl} betulinic
acid)
DSB was synthesized and purified as previously reported
[13]. The identity of the product was confirmed by mass
spectrometry and 1H NMR spectroscopy.
Mutagenesis
Viral mutants were created by PCR segment overlap muta-
genesis and cloned into pNL4-3 or pBR239E. Primers
used to produce the HIVm2 mutant were: CAT-
AAAGCGCGCCTTATGGCTGAAG
primer) and TAAGGCGCGCTTTATGGCCGGG (antisense
mutagenic primer). The PCR product was digested with
SpeI and ApaI and used to replace the corresponding frag-
ment in pNL4-3. Primers used to produce SIVm2 were:
GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG
(sense) and GGCTTCTGCCAGTACTCGAGCCTTC (anti-
sense). Primers used to produce SIVm3 were: GAAG-
GCTCGAGTACTGGCAGAAGCCATGAAAGAG
and TGGCTTCTGCCAGTACTCGAGCCTTTC (antisense).
The PCR products were cleaved with BamHI and SbfI and
used to replace the corresponding fragment in pBR239E.
The PCR-amplified regions of the resulting clones were
sequenced to confirm the presence of the desired muta-
tions and the absence of unwanted substitutions.
(sense mutagenic
(sense)

Page 10

Retrovirology 2004, 1:15 http://www.retrovirology.com/content/1/1/15
Page 10 of 10
(page number not for citation purposes)
Pulse-chase assays of virus maturation
Provirus-transfected 293T cells were starved for 1 hour in
cysteine- and methionine-free medium containing 10%
dialyzed FBS, and pulse-labeled in the same medium con-
taining 35S-labeled cysteine and methionine (0.2 mCi/ml
Pro-Mix, Amersham Biosciences, Inc.) for 20 min. The
cells were then washed and cultured in nonradioactive
complete medium, and culture supernatants were har-
vested at various times following the chase. Virus samples
were lysed and Gag proteins immunoprecipitated in RIPA
buffer using monoclonal antibodies specific for HIV-1 CA
(183-H12-5C from Bruce Chesebro) and SIV CA (2F12
from Niels Pedersen). Immune complexes were collected
using Protein A/G-conjugated agarose beads (Santa Cruz
Biotechnology), and the labeled proteins separated by
SDS-PAGE and visualized by autoradiography. Radioac-
tivity in protein bands was quantified using a Fuji
phosphorimager.
Competing Interests
None declared.
Authors' Contributions
JZ designed and performed the experiments, CHC pro-
vided DSB and helpful discussions, and CA conceived of
the study and wrote the manuscript. All authors read and
approved the final version of the paper.
Acknowledgements
We thank Chris Lundquist for purification of primary T cells and Toshiaki
Kodama for the full-length SIVmac239 proviral construct. The following
reagents were obtained through the NIH AIDS Research and Reference
Reagent Program: HIV-1 p24 monoclonal antibody from Dr. Bruce Chese-
bro, and SIV p27 monoclonal antibody from Dr. Niels Pedersen.
References
1.Vogt VM: Proteolytic processing and particle maturation. Curr
Top Microbiol Immunol 1996, 214:95-131.
2. Wiegers K, Rutter G, Kottler H, Tessmer U, Hohenberg H, Krauss-
lich H-G: Sequential steps in human immunodeficiency virus
particle maturation revealed by alterations of individual Gag
polyprotein cleavage sites. J Virol 1998, 72:2846-2854.
3. Kanamoto T, Kashiwada Y, Kanbara K, Gotoh K, Yoshimori M, Goto
T, Sano K, Nakashima H: Anti-human immunodeficiency virus
activity of YK-FH312 (a betulinic acid derivative), a novel
compound blocking viral maturation. Antimicrob Agents
Chemother 2001, 45:1225-1230.
4.Li F, Goila-Gaur R, Salzwedel K, Kilgore NR, Reddick M, Matallana C,
Castillo A, Zoumplis D, Martin DE, Orenstein JM, Allaway GP, Freed
EO, Wild CT: PA-457: a potent HIV inhibitor that disrupts
core condensation by targeting a late step in Gag processing.
Proc Natl Acad Sci U S A 2003, 100:13555-13560.
5.Zhou J, Yuan X, Dismuke D, Forshey BM, Lundquist C, Lee KH, Aiken
C, Chen CH: Small-Molecule Inhibition of Human Immunode-
ficiency Virus Type 1 Replication by Specific Targeting of the
Final Step of Virion Maturation. J Virol 2004, 78:922-929.
6.Accola MA, Hoglund S, Gottlinger HG: A putative a-helical struc-
ture which overlaps the capsid-p2 boundary in the human
immunodeficiency virus type 1 Gag precursor is crucial for
viral particle assembly. J Virol 1998, 72:2072-2078.
7.Lundquist CA, Tobiume M, Zhou J, Unutmaz D, Aiken C: Nef-medi-
ated downregulation of CD4 enhances human immunodefi-
ciency virus type 1 replication in primary T lymphocytes. J
Virol 2002, 76:4625-4633.
8.Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Mar-
tin MA: Production of acquired immunodeficiency syndrome-
associated retrovirus in human and nonhuman cells trans-
fected with an infectious molecular clone. J Virol 1986,
59:284-291.
Chen C, Okayama H: High-efficiency tranformation of mam-
malian cells by plasmid DNA. Mol Cell Biol 1987, 7:2745-2752.
Charneau P, Alizon M, Clavel F: A second origin of DNA plus-
strand synthesis is required for optimal human immunodefi-
ciency virus replication. J Virol 1992, 66:2814-2820.
Wehrly K, Chesebro B: p24 antigen capture assay for quantifi-
cation of human immunodeficiency virus using readily avail-
able inexpensive reagents. Methods 1997, 12:288-293.
Daniel MD, Letvin NL, King NW, Kannagi M, Sehgal PK, Hunt RD,
Kanki PJ, Essex M, Desrosiers RC: Isolation of T-cell tropic
HTLV-III-like retrovirus from macaques. Science 1985,
228:1201-1204.
Hashimoto F, Kashiwada Y, Cosentino LM, Chen CH, Garrett PE, Lee
KH: Anti-AIDS agents--XXVII. Synthesis and anti-HIV activ-
ity of betulinic acid and dihydrobetulinic acid derivatives.
Bioorg Med Chem 1997, 5:2133-2143.
9.
10.
11.
12.
13.