Microdeletion of LIT1 in Familial Beckwith-Wiedemann Syndrome

Predoctoral Program in Human Genetics, Johns Hopkins University School of Medicine, Baltimore, MD, USA.
The American Journal of Human Genetics (Impact Factor: 10.93). 12/2004; 75(5):844-9. DOI: 10.1086/425343
Source: PubMed


Beckwith-Wiedemann syndrome (BWS), which causes prenatal overgrowth, midline abdominal wall defects, macroglossia, and embryonal tumors, is a model for understanding the relationship between genomic imprinting, human development, and cancer. The causes are heterogeneous, involving multiple genes on 11p15 and including infrequent mutation of p57(KIP2) or loss of imprinting of either of two imprinted gene domains on 11p15: LIT1, which is near p57(KIP2), or H19/IGF2. Unlike Prader-Willi and Angelman syndromes, no chromosomal deletions have yet been identified. Here we report a microdeletion including the entire LIT1 gene, providing genetic confirmation of the importance of this gene region in BWS. When inherited maternally, the deletion causes BWS with silencing of p57(KIP2), indicating deletion of an element important for the regulation of p57(KIP2) expression. When inherited paternally, there is no phenotype, suggesting that the LIT1 RNA itself is not necessary for normal development in humans.

Download full-text


Available from: Kazuhiro Murakami,
  • Source
    • "This study is important for both clinicians involved in counseling for BWS and for researchers interested in imprinting control. Methylation within IC1 was unaltered by the presence of the KCNQ1 deletion, consistent with previous reports [11], [12], [25], however we were not able to examine allelic IGF2 expression directly due to the lack of IGF2 transcripts in peripheral blood. The cancer risk in KCNQ1 deletion cases of BWS is presently unknown due to the low number of affected individuals however BWS patients with isolated loss of methylation within IC2 are at risk for hepatoblastoma and other tumours including rhabdomyosarcoma, gonadoblastoma and thyroid carcinoma [6]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: We report a three generation family with Beckwith Wiedemann syndrome (BWS) in whom we have identified a 330 kb deletion within the KCNQ1 locus, encompassing the 11p15.5 Imprinting Centre II (IC2). The deletion arose on the paternal chromosome in the first generation and was only associated with BWS when transmitted maternally to subsequent generations. The deletion on the maternal chromosome was associated with a lower median level of CDKN1C expression in the peripheral blood of affected individuals when compared to a cohort of unaffected controls (p<0.05), however was not significantly different to the expression levels in BWS cases with loss of methylation (LOM) within IC2 (p<0.78). Moreover the individual with a deletion on the paternal chromosome did not show evidence of elevated CDKN1C expression or features of Russell Silver syndrome. These observations support a model invoking the deletion of enhancer elements required for CDKN1C expression lying within or close to the imprinting centre and importantly extend and validate a single observation from an earlier study. Analysis of 94 cases with IC2 loss of methylation revealed that KCNQ1 deletion is a rare cause of loss of maternal methylation, occurring in only 3% of cases, or in 1.5% of BWS overall.
    PLoS ONE 12/2011; 6(12):e29034. DOI:10.1371/journal.pone.0029034 · 3.23 Impact Factor
  • Source
    • "KvDMR1 marks an imprinting control centre [imprinting centre 2 (IC2)] and KvDMR1 LOM is associated with loss of maternal allele CDKN1C expression, biallelic expression of the untranslated RNA KCNQ1OT (usually only expressed from the paternal allele) and, in some cases, biallelic expression (loss of imprinting) of IGF2 (Lee et al., 1999; Smilinich et al., 1999; Diaz-Meyer et al., 2003). Rarely KvDMR1 LOM may result from a germline maternal allele deletion, but in most KvDMR1 LOM results from an IC2 epimutation (Niemitz et al., 2004). Although IC2 epimutations represent the most common cause of BWS, little information is available regarding the aetiology of IC2 epimutations. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Beckwith-Wiedemann syndrome (BWS) is a model imprinting disorder resulting from mutations or epigenetic events affecting imprinted genes at 11p15.5. Most BWS cases are sporadic and result from imprinting errors (epimutations) involving either of the two 11p15.5 imprinting control regions (IC1 and IC2). Previously, we and other reported an association between sporadic BWS and assisted reproductive technologies (ARTs). In this study, we compared the clinical phenotype and molecular features of ART (IVF and ICSI) and non-ART children with sporadic BWS. A total of 25 patients with post-ART BWS were ascertained (12 after IVF and 13 after ICSI). Molecular genetic analysis revealed an IC2 epimutations (KvDMR1 loss of methylation) in 24 of the 25 children tested. Comparison of clinical features of children with post-ART BWS to those with non-ART BWS and IC2 defects revealed a lower frequency of exomphalos (43 versus 69%, P = 0.029) and a higher risk of neoplasia (two cases, P = 0.0014). As loss of methylation at imprinting control regions other than 11p15.5 might modify the phenotype of BWS patients with IC2 epimutations, we investigated differentially methylated regions (DMRs) at 6q24, 7q32 and 15q13 in post-ART and non-ART BWS IC2 cases (n = 55). Loss of maternal allele methylation at these DMRs occurred in 37.5% of ART and 6.4% of non-ART BWS IC2 defect cases. Thus, more generalized DMR hypomethylation is more frequent, but not exclusive to post-ART BWS. These findings provide further evidence that ART may be associated with disturbed normal genomic imprinting in a subset of children.
    Human Reproduction 03/2009; 24(3):741-7. DOI:10.1093/humrep/den406 · 4.57 Impact Factor
  • Source
    • "Real-time Q-PCR for CDKN1C expression was performed using the primer and Taqman probe combination described in Niemitz et al [48]. These were p57 1044F 5′ GCGGCGATCAAGAAGCTG 3′ and p57 1124R 5′ CGACGACTTCTCAGGCGC 3′ with probe p57 1069T FAM 5′ CTCTGATCTCCGATTTCTTCGCCAAGC 3′ TAMRA. "
    [Show abstract] [Hide abstract]
    ABSTRACT: SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to loss of SMARCB1, and that this hypothesis if proven could provide a biological rationale for testing epigenetic therapies in this disease. We used an inducible expression system to show that the imprinted cell cycle inhibitor CDKN1C is a downstream target for SMARCB1 and is transcriptionally activated by increased histone H3 and H4 acetylation at the promoter. We also show that CDKN1C expression induces cell cycle arrest, CDKN1C knockdown with siRNA is associated with increased proliferation, and is able to compete against the anti-proliferative effect of restored SMARCB1 expression. The histone deacetylase inhibitor (HDACi), Romidepsin, specifically restored CDKN1C expression in rhabdoid tumor cells through promoter histone H3 and H4 acetylation, recapitulating the effect of SMARCB1 on CDKNIC allelic expression, and induced cell cycle arrest in G401 and STM91-01 rhabdoid tumor cell lines. CDKN1C expression was also shown to be generally absent in clinical specimens of rhabdoid tumor, however CDKN1A and CDKN1B expression persisted. Our observations suggest that maintenance of CDKN1C expression plays a critical role in preventing rhabdoid tumor growth. Significantly, we report for the first time, parallels between the molecular pathways of SMARCB1 restoration and Romidepsin treatment, and demonstrate a biological basis for the further exploration of histone deacetylase inhibitors as relevant therapeutic reagents in the treatment of rhabdoid tumor.
    PLoS ONE 02/2009; 4(2):e4482. DOI:10.1371/journal.pone.0004482 · 3.23 Impact Factor
Show more