Polymorphisms in the osteopontin promoter affect its transcriptional activity

Baylor College of Medicine, Houston, Texas, United States
Physiological Genomics (Impact Factor: 2.37). 04/2005; 20(1):87-96. DOI: 10.1152/physiolgenomics.00138.2004
Source: PubMed


Understanding the molecular mechanisms that underlie regulation of transcription of the human osteopontin encoding gene (OPN) may help to clarify several processes, such as fibrotic evolution of organ damage, tumorigenesis and metastasis, and immune response, in which OPN overexpression is observed. With the aim to evaluate variants with functional effect on transcription, we have analyzed the promoter region and focused our investigation on three common variants present in the first 500 bp upstream of the transcription start site. Transfection of constructs carrying the four most frequent haplotypes relative to variants at -66, -156, and -443 fused to the luciferase reporter gene in a panel of different cell lines showed that one haplotype conferred a significantly reduced level of reporter gene expression in all tested cell lines. We describe that the -66 polymorphism modifies the binding affinity for the SP1/SP3 transcription factors, the -156 polymorphism is included in a yet uncharacterized RUNX2 binding site, and the -443 polymorphism causes differential binding of an unknown factor. The finding of differential effects of various combination of variants in haplotypes may contribute to explain data of association studies reported in several already published articles. Future association studies using haplotypes instead of single OPN variants will allow to achieve more accurate results referable to differential expression of OPN in several common diseases, in which OPN is considered a candidate susceptibility gene.

13 Reads
  • Source
    • "OPN was identified as a candidate gene by correlating DMD functional and gene expression data. Confidence in OPN's relevancy was provided by (1) an established high rate of spontaneous human polymorphisms (Giacopelli et al. 2004) and their association with disease (Chiocchetti et al. 2004), (2) the influence that the same polymorphism had on normal human muscle mass, and (3) the association of increased OPN expression with disease in the mdx mouse. Therapeutic strategies to target OPN, both nonspecifically as with NF-κB inhibition and, potentially, with humanized antibodies, could have benefit in DMD. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Duchenne muscular dystrophy (DMD) is an X-linked human disorder in which absence of the protein dystrophin causes degeneration of skeletal and cardiac muscle. For the sake of treatment development, over and above definitive genetic and cell-based therapies, there is considerable interest in drugs that target downstream disease mechanisms. Drug candidates have typically been chosen based on the nature of pathologic lesions and presumed underlying mechanisms and then tested in animal models. Mammalian dystrophinopathies have been characterized in mice (mdx mouse) and dogs (golden retriever muscular dystrophy [GRMD]). Despite promising results in the mdx mouse, some therapies have not shown efficacy in DMD. Although the GRMD model offers a higher hurdle for translation, dogs have primarily been used to test genetic and cellular therapies where there is greater risk. Failed translation of animal studies to DMD raises questions about the propriety of methods and models used to identify drug targets and test efficacy of pharmacologic intervention. The mdx mouse and GRMD dog are genetically homologous to DMD but not necessarily analogous. Subcellular species differences are undoubtedly magnified at the whole-body level in clinical trials. This problem is compounded by disparate cultures in clinical trials and preclinical studies, pointing to a need for greater rigor and transparency in animal experiments. Molecular assays such as mRNA arrays and genome-wide association studies allow identification of genetic drug targets more closely tied to disease pathogenesis. Genes in which polymorphisms have been directly linked to DMD disease progression, as with osteopontin, are particularly attractive targets.
    ILAR journal / National Research Council, Institute of Laboratory Animal Resources 06/2014; 55(1):119-49. DOI:10.1093/ilar/ilu011 · 2.39 Impact Factor
  • Source
    • "MCP and OPN promoters were amplified by using specific primer MCP forward 5 í® í° -CCGAGATGTTCCCAGCACAG-3 í® í° and MCP reverse: 5 í® í° -CTGCTTTGCTTGTGCCTCTT-3 í® í° [16]. OPN forward 5 í® í° ATTACAATTCGTGACTGCCTGCC3 í® í° OPN reverse 5 í® í° TGTACCTTGGTCGGCGTTTG3 í® í° [25]. Amplified DNA was sequenced by employing automated sequencer (Macrogen , Seoul, Korea). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Carotid intima media thickness (CIMT) is clearly associated with atherosclerosis. Studies in ischemic stroke patients reveal that there is a significant association between CIMT with monocyte chemoattractant protein-1 (MCP-1) and osteopontin (OPN) promoter polymorphism. This research aims to explain the effect of MCP-1 and OPN promoter polymorphism toward CIMT changes identified in Javanese Indonesian children. Subjects were 54 children: 27 were from parents with ischemic stroke (cases), and 27 were from healthy parents (controlled). The CIMT was examined by utilizing high resolution B-mode ultrasound. Physical examination and genotyping analysis of MCP-1 promoter were conducted by employing PCR method. Research results indicate that two polymorphisms were obtained, that is, A-2138T and G-2464A, respectively. A-2138T polymorphism was found in 5% of case children and in 14.3% of controlled children. G-2464A polymorphism was found in 5% of case children. CIMT of case children was significantly different from that of controlled children (0.61 ± 0.012 mm versus, 0.52 ± 0.015 mm, P = 0.021). Subjects with MCP-1 promoter polymorphism have 1.471 times higher tendency to have thicker CIMT than subjects with no polymorphism in MCP1 promoter. OPN promoter T-66G was also studied but it did not indicate occurrence of polymorphism in samples.
    Neurology Research International 04/2014; 2014:176535. DOI:10.1155/2014/176535
  • Source
    • "The minor G allele caused an 80% reduction in baseline luciferase expression in transfected cells compared with the ancestral T allele (Fig. 1A). These results correspond to established data that suggest that the G allele causes a significant reduction in OPN expression (3). "
    [Show abstract] [Hide abstract]
    ABSTRACT: A promoter polymorphism of the osteopontin (OPN) gene (rs28357094) has been associated with multiple inflammatory states, severity of Duchenne muscular dystrophy (DMD) and muscle size in healthy young adults. We sought to define the mechanism of action of the polymorphism, using allele-specific in vitro reporter assays in muscle cells, and a genotype-stratified intervention in healthy controls. In vitro reporter constructs showed the G allele to respond to estrogen treatment, whereas the T allele showed no transcriptional response. Young adult volunteers (n = 187) were enrolled into a baseline study, and subjects with specific rs28357094 genotypes enrolled into an eccentric muscle challenge intervention [n = 3 TT; n = 3 GG/GT (dominant inheritance model)]. Female volunteers carrying the G allele showed significantly greater inflammation and increased muscle volume change as determined by magnetic resonance imaging T1- and T2-weighted images after eccentric challenge, as well as greater decrement in biceps muscle force. Our data suggest a model where the G allele enables enhanced activities of upstream enhancer elements due to loss of Sp1 binding at the polymorphic site. This results in significantly greater expression of the pro-inflammatory OPN cytokine during tissue remodeling in response to challenge in G allele carriers, promoting muscle hypertrophy in normal females, but increased damage in DMD patients.
    Human Molecular Genetics 03/2014; 23(15). DOI:10.1093/hmg/ddu118 · 6.39 Impact Factor
Show more