Nob1p is required for cleavage of the 3' end of 18S rRNA.

Abstract

We report the characterization of a novel factor, Nob1p (Yor056c), which is essential for the synthesis of 40S ribosome subunits. Genetic depletion of Nob1p strongly inhibits the processing of the 20S pre-rRNA to the mature 18S rRNA, leading to the accumulation of high levels of the 20S pre-rRNA together with novel degradation intermediates. 20S processing occurs within a pre-40S particle after its export from the nucleus to the cytoplasm. Consistent with a direct role in this cleavage, Nob1p was shown to be associated with the pre-40S particle and to be present in both the nucleus and the cytoplasm. This suggests that Nob1p accompanies the pre-40S ribosomes during nuclear export. Pre-40S export is not, however, inhibited by depletion of Nob1p.

Full text

Page 1

MOLECULAR AND CELLULAR BIOLOGY, Mar. 2003, p. 1798–1807
0270-7306/03/$08.00?0DOI: 10.1128/MCB.23.5.1798–1807.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Vol. 23, No. 5
Nob1p Is Required for Cleavage of the 3? End of 18S rRNA
Alessandro Fatica,1Marlene Oeffinger,1Mensur Dlakic ´,2and David Tollervey1*
Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR, United Kingdom,1and
Department of Biological Chemistry, The University of Michigan Medical School,
Ann Arbor, Michigan 48109-06062
Received 7 October 2002/Returned for modification 26 November 2002/Accepted 2 December 2002
We report the characterization of a novel factor, Nob1p (Yor056c), which is essential for the synthesis of 40S
ribosome subunits. Genetic depletion of Nob1p strongly inhibits the processing of the 20S pre-rRNA to the
mature 18S rRNA, leading to the accumulation of high levels of the 20S pre-rRNA together with novel
degradation intermediates. 20S processing occurs within a pre-40S particle after its export from the nucleus
to the cytoplasm. Consistent with a direct role in this cleavage, Nob1p was shown to be associated with the
pre-40S particle and to be present in both the nucleus and the cytoplasm. This suggests that Nob1p accom-
panies the pre-40S ribosomes during nuclear export. Pre-40S export is not, however, inhibited by depletion of
Nob1p.
Eukaryotic ribosome synthesis takes place largely within the
nucleolus, but the late steps in both pre-40S and pre-60S mat-
uration occur after export of the subunits to the cytoplasm. In
Saccharomyces cerevisiae, this cytoplasmic maturation includes
an endonuclease cleavage at site D, the 3? end of the 18S
rRNA that generates the mature rRNA from the 20S pre-
rRNA (Fig. 1) (27, 37). Around 150 proteins and 80 small
nucleolar RNAs are known to be required for the posttran-
scriptional steps in yeast ribosome synthesis. Despite the iden-
tification of this large number of factors, there are a great
many gaps in our knowledge. Among these are the identities of
the endonucleases that perform several of the pre-rRNA cleav-
ages including that at the 3? end of the mature 18S rRNA (Fig.
1). The pathway of ribosome subunit synthesis in yeast was
initially studied by sucrose gradient centrifugation (16, 36, 38),
leading to the identification of a 90S particle that contains the
35S pre-rRNA, a 66S particle that contains the 27S pre-
rRNAs, and a 43S particle containing the 20S pre-rRNA. Re-
cent analyses have shown that the precursors to the 60S
particle are substantially more complex than was initially pro-
posed, with multiple pre-60S particles containing different
complements of the precursors to the 25S and 5.8S rRNAs and
different protein compositions (6, 13, 28, 31; reviewed in ref-
erences 7 and 41). Equivalent analyses of the pre-40S ribo-
somes have not yet been reported, but a high-throughput pro-
teomic analysis of yeast protein interactions identified three
complexes that potentially represented such particles (8; re-
viewed in reference 7), one of which was associated with tan-
dem affinity purification (TAP)-tagged Nob1p (Yor056c).
Each of these complexes contained Tsr1p, which is required
for 20S-to-18S processing (9), and one also contained the dim-
ethylase Dim1p, which modifies the 20S pre-rRNA, probably
in the cytoplasm, and is additionally required for nucleolar
pre-rRNA processing (4, 19, 22). Rrp10p (Rio1p) is also re-
quired for 20S-to-18S processing (39) but was not identified in
these putative pre-40S particles.
Nob1p (for “Nin one binding protein”) was initially reported
to interact in a two-hybrid screen with Nin1p/Rpn12p, a sub-
unit of the 19S regulatory particle of the yeast 26S proteosome
(34), and is required for proteosome biogenesis (35). Immu-
noprecipitation of Nob1-TAP did not detect the interaction
with Nin1p (8), but Nob1p was copurified with each of the
putative pre-40S complexes. Sequence analyses indicated that
Nob1p is an evolutionarily conserved protein with a predicted
RNA-binding domain at the C terminus and an N-terminal
PIN domain (24), a motif proposed to be associated with
RNase activity (5). These features made suggested that it
might be the long-sought 18S rRNA 3? endonuclease, and its
role in ribosome synthesis was therefore assessed. Here we
report that Nob1p is indeed a component of pre-40S ribosomal
particles and is strictly required for cleavage of the 20S pre-
rRNA to generate the mature 18S rRNA.
MATERIALS AND METHODS
Strains and microbiological techniques. Standard techniques were employed
for growth and handling of yeast. The yeast strains used in this work were:
BMA64 (MATa ade2-1 his3-11,15 leu2-3,112 trp1-? ura3-1), YAF34 (MATa
ade2-1 his3-11,15 leu2-3,112 trp1-? ura3-1 KAN::GAL::HA-NOB1), BMA38
(MATa his3-?200 leu2-3,112 ura3-1 trp1-? ade2-1), YAF36 (MATa his3-?200
leu2-3,112 ura3-1 trp1-? ade2-1 NOB1-TAP::TRP1). Strain YAF34 was created
from strain BMA64 by use of a one-step PCR strategy as previously described
(20, 23). TAP tagging of Nob1p was performed as described previously (29).
RNA extraction, Northern hybridization, and primer extension. For depletion
of the Nob1p protein, cells were harvested at intervals following a shift from
RSG medium (2% galactose, 2% sucrose, 2% raffinose), or YPGal medium
containing 2% galactose, to YPD medium containing 2% glucose. Otherwise
strains were grown in YPD medium. RNA was extracted as described previously
(17). Northern hybridizations and primer extensions were as described previously
(17). Standard 1.2% agarose–formaldehyde and 6% acrylamide–urea gels were
used to analyze the high- and low-molecular-weight RNA species, respectively.
Oligonucleotides. For RNA hybridization and primer extension, the following
oligonucleotides were used: 001 (5?-CCAGTTACGAAAATTCTTG), 002 (5?-G
CTCTTTGCTCTTGCC), 003 (5?-TGTTACCTCTGGGCCC), 004 (CGGTTTT
AATTGTCCTA), 005 (5?-ATGAAAACTCCACAGTG), 006 (5?-GGCCAGCA
ATTTCAAGTTA), 007 (5?-CTCCGCTTATTGATATGC), 008 (5?-CATGGCT
TAATCTTTGAGAC), 013 (5?-GCGTTGTTCATCGATGC), 020 (5?-TGAGA
AGGAAATGACGCT), 029 (TAATGATCCTTCCGCA), 033 (5?-CGCTGCTC
* Corresponding author. Mailing address: Wellcome Trust Centre
for Cell Biology, Swann Building, King’s Buildings, University of Ed-
inburgh, Edinburgh EH9 3JR, United Kingdom. Phone: 44 131 650
7092. Fax: 44 131 650 7040. E-mail: d.tollervey@ed.ac.uk.
1798

Page 2

ACCAATGG), 041 (5?-CTACTCGGTCAGGCTC), anti-NOB1 (AACGCCCT
TACATGTGCGGTTTGGTTTTCGGTCAT), and ITS1 (5?-TGGACTC5CCA
TCTCTTGAC5TCTTGCCCAG5AAAAGCTC5CATGCTC5T).
Sucrose gradient analysis and affinity purification. Sucrose gradient centrif-
ugation was performed as described previously (3, 33). RNA was extracted from
each fraction and resolved on a standard 1.2% agarose–formaldehyde gel. Ma-
ture rRNAs and pre-rRNA species were detected by ethidium bromide staining
and Northern hybridization, respectively. Sedimentation of proteins was assayed
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and TAP-tagged
Nob1p was detected by Western immunoblotting with peroxidase-conjugated
rabbit immunoglobulin G (Sigma). Affinity purification of TAP-tagged Nob1p
and analysis of copurified RNAs were performed as previously described (7).
Pulse-chase labeling. Metabolic labeling of RNA was performed as described
previously (6). The strains GAL::HA-nob1 and BMA64 were transformed with a
plasmid containing the URA3 gene, pregrown in galactose medium lacking uracil,
and transferred to glucose minimal medium for 8 h. Cells with an optical density
at 600 nm of 0.3 units were labeled with [5,6-3H]uracil for 1 min; this was
followed by a chase with excess unlabeled uracil for 0, 1, 2.5, 5, 10, and 20 min.
Standard 1.2% agarose–formaldehyde and 6% polyacrylamide–urea gels were
used to analyze the high- and low-molecular-weight RNA species, respectively.
Fluorescence microscopy. Indirect immunofluorescence was performed with
the Nob1-TAP strain as previously described (11). Plasmid pUN100 DsRed-
Nop1 was introduced into yeast cells by transformation and selected on SD-URA
medium (containing 0.67% yeast nitrogen base and 2% glucose and lacking
uracil). Individual transformants were grown in selective medium, fixed by incu-
bation in 4% (vol/vol) formaldehyde for 30 min at 25°C, and spheroplasted. The
TAP fusion was detected with a rabbit anti-protein A antibody (Sigma) and a
secondary goat anti-rabbit antibody coupled to fluorescein isothiocyanate (Sig-
ma) at 1:100 and 1:200 dilutions, respectively. Fluorescent in situ hybridization
was performed with the GAL::nob1 strain as previously described (2) with some
modifications. The probe for the ITS1 5? RNA was a 50-bp oligonucleotide
fluorescently labeled with Cy3. Cells were grown to an optical density of 0.5 to 1.0
unit at 600 nm and fixed with 2% (vol/vol) formaldehyde–5% (vol/vol) acetic acid
for 10 min at 25°C. Samples were hybridized with 100 ng of Cy3-labeled RNA
oligonucleotide for 16 h at 37°C. To stain nuclear DNA, 4?,6-diamidino-2-phe-
nylindole (DAPI) was included in the mounting medium (Vectashield; Vector
Laboratories). Cells were viewed on a Zeiss Axioscop fluorescence microscope, and
pictures were obtained with a Xillix Microimager charge-coupled device camera.
RESULTS
Nob1p is a conserved protein with putative nuclease and
RNA-binding domains. Sequence analyses using BLASTP (1)
revealed that Nob1p has close relatives in higher eukaryotes.
FIG. 1. Pre-rRNA processing pathway. In wild-type cells, the 35S pre-rRNA is cleaved at site A0, producing the 33S pre-rRNA. This molecule
is rapidly cleaved at site A1to produce the 32S pre-rRNA, which is cleaved at site A2releasing the 20S and 27SA2pre-rRNAs. The 20S pre-rRNA
is exported to the cytoplasm, where it is dimethylated by Dim1p and then cleaved at site D, by an unidentified enzyme, to generate the mature
18S rRNA. 27SA2is processed via two alternative pathways. It is either cut at site A3to generate 27SA3, which is then trimmed to site B1S,
producing 27SBS. Alternatively, it can be processed to 27SBLby an as yet unknown mechanism. 27SBSand 27SBLare matured to the 5.8S and
25S following identical pathways. Cleavage at site C2generates the 7S and 26S pre-rRNAs. The 7S pre-rRNA is digested 3? to 5? to 6S pre-rRNA
and then to the mature 5.8S rRNA. The 26S pre-rRNA is digested 5? to 3? to the 25S pre-rRNA and then to the mature 25S rRNA. For a review
on pre-rRNA processing and the known processing enzymes, see reference (40).
VOL. 23, 2003 Nob1p IN 18S rRNA CLEAVAGE1799

Page 3

FIG. 2. Multiple sequence alignment of Nob1p and related proteins. The full sequences of Nob1p and its putative eukaryotic orthologues were
aligned using T-Coffee and corrected manually where required. Sequences are identified by the SwissProt number and species abbreviation.
Numbers within the sequences indicate residues omitted due to unreliable alignments in these regions. Letters and symbols on the consensus line
are as follows: s, small residues; t, tiny; b, big; h, hydrophobic; a, aromatic; l, aliphatic; p, polar; c, charged; ?, negatively charged; ?, positively
charged. Individual residues with more than 80% identity in the entire alignment are shown as capital letters on the consensus line. Conserved
acidic (Asp/Glu) residues in the PIN domain are denoted by red asterisks above the alignment. Conserved cysteines marked by blue asterisks are
part of the zinc ribbon motif. The figure was prepared using CHROMA (10).
FIG. 3. Nob1p is associated with pre-40S ribosomal particles. (A) The upper panel shows sedimentation of TAP-tagged Nob1p on a 10 to 50%
sucrose gradient. The levels of the Nob1-TAP protein were determined by immunoblot analysis. The lower panel shows Northern analysis of the
levels of the 20S pre-rRNA. Positions of 40S and 60S ribosomal subunits and 80S ribosomes are indicated, as determined by ethidium staining of
the RNA recovered from each fraction (data not shown). (B and C) Northern analysis (B) and primer extension analyses (C) of rRNAs and
pre-rRNAs coprecipitated with Nob1-TAP. RNA was extracted from whole cells (Tot.) and affinity-purified fractions from tagged (? lane) and
nontagged isogenic wild-type strain (? lane). The Northern blot membrane was consecutively hybridized with the probes indicated (see Fig. 6A
for the locations of the probes used). The primer extension stop detected with oligonucleotide 004 is due to the cytoplasmic dimethylation of the
20S pre-rRNA at two consecutive A residues near the 3? end of the 18S rRNA.
1800

Page 4

Each of these aligns with Nob1p over the entire length (Fig. 2),
and they are all confidently predicted to be orthologues. Sub-
sequent searches using PSI-BLAST (1) identified archaeal pro-
teins similar to the N-terminal half of Nob1p. Each of these
proteins shares with Nob1p a region with a compact predicted
structure, termed a PIN domain. This domain was originally
proposed to have a function in signaling (24), but a more
recent analysis has proposed that the PIN domain is associated
with a phosphodiesterase activity (5). This was based on the
predicted structure and the complete conservation of several
acidic residues (denoted by red asterisks in Fig. 2) between the
PIN domain and the 5? exonuclease domain of DNA polymer-
ase I. This degrades double-stranded nucleic acids exonucleo-
lytically but also has a single-stranded DNA “flap” endonucle-
ase activity. PIN domains were identified in several proteins
involved in RNA degradation, including the eukaryotic 3? 3 5?
exonuclease Dis3p/Rrp44p, the worm mRNA turnover factor
Smg5p, and the putative yeast turnover factor Nmd4p (5). In
archaeal proteins, the PIN domain is immediately followed by
a short zinc ribbon module, whereas in eukaryotes, these two
regions are separated by a domain of variable length. Metal-
binding zinc ribbons have four conserved cysteines or histi-
dines (marked by blue asterisks in Fig. 2) and are commonly
found in ribosomal proteins (25). The C-terminal part of
Nob1p is missing in related archaeal proteins but is present
and well conserved in the eukaryotic orthologues. There was,
however, no convincing sequence similarity between this re-
gion of the Nob1p family and known protein domains. We
therefore attempted to identify related domains by fold recog-
nition. The results obtained from the 3D-PSSM server (15;
http://www.sbg.bio.ic.ac.uk/?3dpssm/) indicate that this part of
Nob1p is similar to ribosomal protein L2/L8. The primary
sequence homology is not statistically significant, but its rele-
vance is supported by a good match between predicted and
known secondary-structure elements of these proteins and
raises the possibility that this domain has a function in RNA
binding.
Nob1p associates with pre-40S ribosomal particles. A sys-
tematic high-throughput proteomic analysis (8) identified
Nob1p (Yor056c) in complexes that also included several pro-
teins previously implicated in 40S biogenesis, including Enp1p,
Tsr1p, Rrp12p, Dim1p, and Rio2p, a homologue of Rrp10p
(Rio1p) (9, 12, 21, 30; M. Oeffinger and D. Tollervey, unpub-
lished data). Nob1p was also coprecipitated with overex-
pressed, tagged Tsr1p (14). These observations suggested that
Nob1p might be a component of a pre-40S ribosomal particle.
To monitor the distribution and associations of Nob1p, a
strain expressing a C-terminal TAP tag (29) fusion with Nob1p
under the control of its own promoter was constructed using of
a one step-PCR strategy (20). The fusion construct supported
wild-type growth, indicating that it was fully functional (data
not shown). To assess the association of Nob1p with pre-ribo-
somal particles, a sucrose gradient analysis was performed with
a lysate from the Nob1-TAP strain. The sedimentation of
Nob1-TAP was determined by Western blotting with antibod-
ies that recognize the protein A moiety of the TAP tag and was
compared to that of the rRNA species and pre-rRNAs (Fig. 3).
Comparison to the positions of the mature rRNAs detected by
ethidium staining (data not shown) indicated that Nob1-TAP is
enriched in the 40S region of the gradient, with a weaker peak
around 80S to 90S (Fig. 3A). Northern hybridization showed
that the peak of Nob1-TAP coincides with the peak of the 20S
pre-rRNA (Fig. 3A). Consistent with the presence of Nob1p in
purified preribosomal complexes, these analyses indicate that
Nob1p is a component of the pre-40S particles.
RNA species that coprecipitated with Nob1-TAP were ana-
lyzed by Northern hybridization (Fig. 3B) and primer extension
(Fig. 3C). The 20S pre-rRNA was strongly precipitated with
Nob1p, consistent with association with pre-40S particles.
Primer extension showed that 20S pre-rRNA associated with
Nob1p had undergone adenine dimethylation (Fig. 3C). This
modification is performed by Dim1p at two sites, m2
m2
to occur in the cytoplasm (4), suggesting that Nob1p is ex-
ported to the cytoplasm as a component of the pre-40S ribo-
somes. In agreement with the sedimentation data, weaker pre-
cipitation was seen for the 35S pre-rRNA and the U3 snoRNA,
both of which are components of the 90S pre-ribosomes. No
clear precipitation was seen for the mature 18S rRNA or the
27SA and 27SB pre-rRNA components of the pre-60S parti-
cles.
Construction of a conditional NOB1 allele. The NOB1 gene
is essential for viability (34), and a conditional allele was there-
fore constructed. A one-step PCR technique was used to
create a chromosomal N-terminally HA-tagged Nob1p fu-
6A1779and
6A1780, near the 3? end of the 18S rRNA (19) and is reported
FIG. 4. Depletion of Nob1p inhibits growth. (A) Growth rates of
the GAL::HA-nob1 (squares) and wild-type (diamonds) strains follow-
ing a shift from galactose to glucose medium. (B) Western blot analysis
of Nob1p depletion. Whole-cell extracts were prepared from samples
harvested at the indicated times. Equal amount of proteins were sep-
arated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(10% polyacrylamide), and the HA tag on HA-Nob1p was detected by
Western blotting.
VOL. 23, 2003 Nob1p IN 18S rRNA CLEAVAGE1801

Page 5

FIG. 5. Depletion of Nob1p inhibits 18S rRNA synthesis. GAL::HA-Nob1 and the isogenic wild-type (WT) strain were grown at 30°C in
SDGal-URA medium and then transferred to SDGlu-URA for 8 h. The cells were pulse-labeled with [5,6-3H]uracil for 1 min and then chased with
an excess of cold uracil. Total RNA was extracted from cell samples harvested at the indicated time points and resolved on 1.2% agarose–
formaldehyde (A) and 6% acrylamide–urea (B) gels. The positions of mature rRNAs, pre-rRNAs and tRNA species are indicated.
FIG. 6. Depletion of Nob1p impairs pre-rRNA processing. (A) Structure and processing sites of the 35S pre-rRNA. This precursor contains
the sequences for the mature 18S, 5.8S, and 25S rRNAs, which are separated by the two internal transcribed spacers ITS1 and ITS2 and flanked
by the two external transcribed spacers 5?ETS and 3?ETS. The positions of the oligonucleotides probes are indicated. (B to E) Northern analyses
of pre-rRNA processing. The GAL::HA-nob1 and wild-type (WT) strains were growth at 30°C in YPGal and then shifted to YPD. The cells were
harvested at the times indicated, and total RNA was extracted. Equal amounts of RNA (5 ?g) were resolved on a 1.2% agarose–formaldehyde
gel (B to D) or 6% acrylamide–urea gel (E) and transferred to a nylon membrane. (B) Ethidium bromide staining of the gel. (C) Probe
complementary to NOB1 mRNA. (D and E) Probes specific for the mature rRNAs and pre-rRNAs as indicated.
1802 FATICA ET AL.MOL. CELL. BIOL.