Role of Candida albicans transcription factor Upc2p in drug resistance and sterol metabolism.

Abstract

In Candida albicans, drug resistance to clinically important antifungal drugs may be regulated through the action of transcription factors in a manner that may or may not be similar to regulation in Saccharomyces cerevisiae. A search of the C. albicans genome identified a single homolog of the S. cerevisiae transcription factor genes UPC2 (ScUPC2) and ECM22 (ScECM22) that have been associated with regulation of ergosterol biosynthesis. Sequence analysis of this C. albicans UPC2 (CaUPC2) gene identifies two domains, an anchoring transmembrane domain and a transcription factor region containing multiple nuclear localization signals and a fungal Zn(2)-Cys(6) binuclear cluster domain. Heterozygous deletion, homozygous deletion, and reconstructed strains of CaUPC2 as well as the parental strain were tested against several antifungal drugs, including ergosterol biosynthesis inhibitors. The CaUPC2 homozygous deletion strain showed marked hypersusceptibility to most drugs, compared to the parental and reconstructed strains. The deletion strains accumulate significantly less radiolabeled cholesterol, suggesting reduced ergosterol scavenging in those strains. When grown under azole drug pressure, the parental, heterozygous deletion and reconstructed strains of CaUPC2 upregulate the ERG2 and ERG11 ergosterol biosynthesis genes, while the homozygous deletion strain shows no such upregulation. Consistent with these results, CaUPC2 deletion strains show reduced ergosterol levels, which may explain the increased susceptibilities of the CaUPC2 deletion strains. Thus, it appears that CaUPC2 acts as a transcription factor involved in the regulation of ergosterol biosynthetic genes and as a regulator of sterol uptake across the plasma membrane.

Full text

Page 1

EUKARYOTIC CELL, Dec. 2004, p. 1391–1397
1535-9778/04/$08.00?0
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Vol. 3, No. 6
DOI: 10.1128/EC.3.6.1391–1397.2004
Role of Candida albicans Transcription Factor Upc2p in Drug
Resistance and Sterol Metabolism
Peter M. Silver,1,2Brian G. Oliver,1,2and Theodore C. White1,2*
Department of Pathobiology, University of Washington,1and Seattle Biomedical Research Institute,2
Seattle, Washington
Received 21 July 2004/Accepted 4 August 2004
In Candida albicans, drug resistance to clinically important antifungal drugs may be regulated through the
action of transcription factors in a manner that may or may not be similar to regulation in Saccharomyces
cerevisiae. A search of the C. albicans genome identified a single homolog of the S. cerevisiae transcription factor
genes UPC2 (ScUPC2) and ECM22 (ScECM22) that have been associated with regulation of ergosterol bio-
synthesis. Sequence analysis of this C. albicans UPC2 (CaUPC2) gene identifies two domains, an anchoring
transmembrane domain and a transcription factor region containing multiple nuclear localization signals and
a fungal Zn(2)-Cys(6) binuclear cluster domain. Heterozygous deletion, homozygous deletion, and recon-
structed strains of CaUPC2 as well as the parental strain were tested against several antifungal drugs,
including ergosterol biosynthesis inhibitors. The CaUPC2 homozygous deletion strain showed marked hyper-
susceptibility to most drugs, compared to the parental and reconstructed strains. The deletion strains accu-
mulate significantly less radiolabeled cholesterol, suggesting reduced ergosterol scavenging in those strains.
When grown under azole drug pressure, the parental, heterozygous deletion and reconstructed strains of
CaUPC2 upregulate the ERG2 and ERG11 ergosterol biosynthesis genes, while the homozygous deletion strain
shows no such upregulation. Consistent with these results, CaUPC2 deletion strains show reduced ergosterol
levels, which may explain the increased susceptibilities of the CaUPC2 deletion strains. Thus, it appears that
CaUPC2 acts as a transcription factor involved in the regulation of ergosterol biosynthetic genes and as a
regulator of sterol uptake across the plasma membrane.
Candida albicans is an opportunistic fungal pathogen that
exists as a commensal in immunocompetent individuals. In
persons with diminished immune function, such as the elderly
or individuals with AIDS, C. albicans can cause oral candidiasis
(16). In neutropenic populations, such as transplant and che-
motherapy patients, C. albicans is the leading cause of blood-
stream fungal infections (25). C. albicans infections are typi-
cally treatedwith azoles,which
biosynthetic pathway, or with polyenes that bind to ergosterol
in the membrane. Resistance to the azole and polyene class
drugs has been documented clinically (18). Azole resistance
has been causally associated with mutations in the gene encod-
ing the target of the azoles, ERG11, and upregulation of the
efflux pump genes MDR1, CDR1 and CDR2 as well as ERG11
(28). It is not known whether the upregulation of these genes
in C. albicans is due to alteration in their promoters, altered
recruitment of transcriptional machinery due to changes in
enhancers or repressors, increased mRNA stability, or an up-
regulation of relevant transcription factors.
Saccharomyces cerevisiae transcription factors that regulate
the expression of genes homologous to the C. albicans drug
resistance-associated genes have been identified (8, 15). The S.
cerevisiae transcription factor gene ROX1 represses transcrip-
tion of hypoxia-controlled genes, such as ERG11, in the pres-
ence of oxygen through recruitment of the Ssn6-Tup1 core-
pressor complex (10, 12). In the absence of ROX1 repression,
targettheergosterol
ERG11 expression is upregulated and cells are up to 16-fold
less susceptible to azole drugs (8).
ScUPC2 encodes a transcription factor originally character-
ized as a sterol regulatory gene, upregulating ERG2 and ERG3
in the ergosterol biosynthetic pathway in response to ergos-
terol starvation (27). ScUPC2 is a member of a family of fungal
Zn(2)-Cys(6) binuclear cluster transcription factors that are
highly conserved among fungal species but share no homology
to the analogous mammalian sterol regulatory element binding
proteins (SREBPs), which regulate cholesterol synthesis (27).
ScUpc2p possesses a carboxy-terminal transmembrane domain
that may act as a membrane anchor, keeping the protein in the
cytoplasm. Under inducing conditions, the protein is internally
cleaved, releasing an amino-terminal head group containing
the transcription factor domain that translocates to the nucleus
(27) (Fig. 1). Deletion of ScUPC2 alters susceptibility to lova-
statin and amphotericin B (27). Deletion of ScUPC2 has been
associated with lowered uptake of cholesterol across the
plasma membrane (4)
ScECM22, a paralog of ScUPC2, was originally character-
ized in a screen for mutants hypersusceptible to the cell wall
perturbing agent calcofluor white. It has been shown to regu-
late ERG2 and ERG3 in a manner similar to ScUPC2.
ScECM22 is also a member of the fungal Zn(2)-Cys(6) binu-
clear cluster family and has similar transmembrane and nu-
clear localization domains (Fig. 1).
ScUPC2 and ScECM22 regulate expression of genes in the
sterol biosynthetic pathway, binding to an 11-bp sterol re-
sponse element (SRE) in the promoters of ERG2 and ERG3 in
response to ergosterol starvation conditions, such as drug pres-
sure (27).
* Corresponding author. Mailing address: Seattle Biomedical Re-
search Institute, 307 Westlake Ave. N, Suite 500, Seattle, WA 98109-
5219. Phone: (206) 256-7344. Fax: (206) 256-7229. E-mail: ted.white
@sbri.org.
1391

Page 2

Deletion of either gene in Saccharomyces is nonlethal. How-
ever, deletion of ScECM22 and ScUPC2 together has been
reported to be viable (27) or nonviable (http://www.yeastgenome
.org/), perhaps related to strain differences.
This study identifies and characterizes the Candida albicans
UPC2 gene that is related to both ScUPC2 and ScECM22. A
set of CaUPC2 deletion and reconstructed strains were used to
analyze the effect of the gene on drug susceptibility, sterol
accumulation, ergosterol levels, and ergosterol biosynthesis
gene expression.
MATERIALS AND METHODS
Strains. The Candida albicans strains used in this study are BWP17 (ura3?::
?434/ura3?::?imm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG) and its deriva-
tives S-7, D-6, EC-7, and EC-2 (see Table 1 for UPC2 genotype). Strains S-7 and
D-6 were constructed through successive transformation of BWP17 with a PCR
product containing 50-mer regions of homology to the UPC2 locus flanking
either the URA3 or ARG4 marker genes as described previously (29). Strains
EC-7 and EC-2 were constructed through transformation of the D-6 strain with
a fragment containing the UPC2 locus and the HIS1 selection marker and
subsequent integration at either allele.
Media. Yeast extract-peptone-dextrose (YEPD) medium contains 20 g of
dextrose, 20 g of Bacto peptone, and 10 g of Difco yeast extract per liter. It was
supplemented with 20 mg of uridine/ml, 50 mg of arginine/ml, and 20 mg of
histidine/ml for nonselective propagation of C. albicans strains. Selective prop-
agation of C. albicans strains was done in YAD-CSM defined medium containing
1.77 g of yeast nitrogen base without amino acids or ammonium sulfate, 5 g of
ammonium sulfate, 20 g of dextrose, and the appropriate CSM medium (Qbio-
gene, Carlsbad, Calif.) lacking the marker amino acids. The lipophilic dye me-
dium consisted of YEPD medium supplemented with 7 mg of phloxine B/ml or
200 ?g of Congo red/ml. Plates also contain 10 g of agar/liter.
Plasmids. Plasmids pGEM-URA3 and pRS-ARG4?Spe1 (29) were used for
construction of C. albicans strains S-7 and D-6. These plasmids contain a select-
able marker, URA3 or ARG4, flanked by a polyclonal region. Oligonucleotides
UPC2 5? KO (5? CTTTTTTCTTTCCCTTTTTCTTTAATTTATTACTACATC
AAGTTTATTTATTTCCCAGTCACGACGTT 3?) and UPC2 3? KO (5? GCG
AAACACCTTCTAAAAACCATACTTTGTCTTTCATTTCGGTTGTAAAC
TGTGGAATTGTGAGCGGATA 3?), with 50 bp of homology to the UPC2
locus linked to 18-mers with homology to the polyclonal region, were used to
amplify marker genes from pGEM-URA3 or pRS-ARG4?Spe1 as described
previously (29). Plasmid pTU-1 was constructed by ligation of a PCR fragment
containing the entire UPC2 locus (797 bp upstream of the ATG to 291 bp
downstream of the stop codon, amplified by PCR using oligonucleotides UPC2
upstream (5? ATGGATGTTGGTATATCAGG 3?) and UPC2 downstream (5?
AACTGTATCTTTTTCCCACT 3?) into the pCR-Topo vector. pTU-1 was then
digested with BamHI and ApaI, and the fragment containing the UPC2 locus was
ligated to pGEM-HIS1 at the ApaI and BamHI sites. This plasmid, containing
both the UPC2 locus and the HIS1 marker gene, was designated pHU-1.
C. albicans transformation. Competent C. albicans cells were electroporated
according to previously described methods (6, 26). One to five micrograms of a
PCR product was used in each transformation. Electroporation was done at 1.6
kV, 25 ?F, and 200 ? in a gene pulser (Bio-Rad, Hercules, Calif.). After
electroporation, 1 ml of 1 M sorbitol was added to the cells and they were plated
immediately on selective medium. Cells were incubated at 30°C for 3 to 5 days.
Single colonies were picked and passaged three times to ensure a homogenous
population.
DNA and protein analysis. Protein analysis was performed by using the
PSORTII program (http://psort.nibb.ac.jp/form2.html). Identification of poten-
tial promoter SREs was accomplished by using the search pattern function
available at http://genolist.pasteur.fr/CandidaDB/genome.cgi. The patterns
searched were TCGTATA and TATACGA, the seven essential base pairs iden-
tified in S. cerevisiae (27).
Southern blot analysis. Genomic DNA of each transformant was prepared by
glass bead lysis as described previously (9). DNA was digested with BglII, sep-
arated in a 0.8% agarose gel, blotted, and hybridized with an end-labeled UPC2
5? KO oligonucleotide as described previously (3, 13, 23).
Northern analysis. Total RNA was prepared by using a glass bead phenol
extraction as described previously (3, 13). Two 25-ml cultures were inoculated for
each strain from overnight cultures to a starting optical density (OD) of 0.2 and
grown for 4 to 8 h to an OD of between 0.8 and 1.0. One culture from each strain
was grown in the presence of 5 ?g of fluconazole/ml. RNA was blotted as
described previously (13, 20) and probed with an end-labeled oligonucleotide,
UPC2-AS (5? GCTGGAAATGCAAATATACGTAAAATAAAGTCAGACTT
GTATCTCTCCTT 3?), ERG2-AS (5? GACCTTCAGTCCCAATTGCTGTAC
CGAAAAAAATCAAATATTCAGAAATT 3?), or ERG11-Coding (5? CTAA
GGGACAAAAAATAATTAATGCCATCAATGACAGTTTCAACAATAGC
CATGATTGATAATTATTTGA 3?), with homology to the gene of interest.
mRNA signals were quantified by using a Storm Phosphorimager and Image-
Quant software (Molecular Dynamics, Sunnyvale, Calif.). All Northern signals
were normalized to mRNA from the housekeeping gene ACT1 (5? ATTTGAGTC
ATCTTTTCTCTGTTGGATTTTGGATTCATTGGAGCTTCGGT 3?), which al-
lows for comparison of specific mRNA levels in reference to total mRNA.
MIC analysis. Drug susceptibility was determined by using the standard
NCCLS broth microdilution protocol that determines the MIC of drug needed to
inhibit 80% of cell growth (14). Strains were grown in a 96-well plate containing
a gradient of drug, typically eightfold above the MIC to eightfold below the MIC,
by using serial twofold dilutions of drug. Etest strips (AB Biodisk, N.J.), plastic
strips impregnated with gradients of drug, were used per the manufacturer’s
instructions. Each strip is placed onto an agar plate containing a lawn of cells,
and growth inhibition is measured directly off the plate after 24 or 48 h.
Aerobic cholesterol accumulation. An assay of total cholesterol accumulation
with radiolabeled [14C]cholesterol (58.0 mCi/mmol) was performed as described
previously (22) with the following modifications. Strains were grown in 5 ml of
defined RPMI 1640 medium (Sigma-Aldrich, St. Louis, Mo.) supplemented with
50 mg of arginine/ml, 20 mg of histidine/ml, and 20 mg of uridine/ml in a 50-ml
conical tube for 48 h. The media contained14C-labeled cholesterol (5 nCi/ml).
After 48 h of growth, the cells were pelleted, washed, and lyophilized overnight.
Pellet weight was measured, each pellet was resuspended in 1 ml of scintillation
fluid, and counts per minute were determined.
Ergosterol levels. Ergosterol levels were measured by using a protocol de-
scribed previously (2) with the following modifications. All strains were grown in
YAD-CSM medium supplemented with 20 mg of uridine/ml, 50 mg of arginine/
FIG. 1. Alignment of C. albicans and S. cerevisiae proteins. Regions
of significant homology are boxed in dark gray. The percent identity in
the box near the amino terminus of CaUPC2 with both ScUPC2 and
ScECM22 is 66%. The percent identity in the box near the carboxy
terminus of CaUPC2 with both ScUPC2 and ScECM22 is 64%. The
solid bars above the proteins near the amino termini designate Zn(2)-
Cys(6) binuclear cluster transcription factor domains. The solid bars
above the proteins near the carboxy termini designate transmembrane
domains. Black arrowheads and asterisks identify nuclear localization
signals (NLS). *, five NLS in this region and eight total NLS for
CaUPC2. **, three NLS signals in this region and five total NLS for
ScUPC2. ***, four NLS signals in this region and five total NLS for
ScECM22.
TABLE 1. C. albicans strains used in this study
Strain
Identification
no.
UPC2 genotype
Source or
reference
BWP17 TW14901UPC2/UPC2 Wilson et al.
(29)
This study
This study
This study
This study
S-7
D-6
EC-7
EC-2
TW14902
TW14903
TW14904
TW14905
UPC2/upc2::URA3
upc2::URA3/upc2::ARG4
upc2::URA3/upc2::UPC2-HIS1
upc2::ARG4/upc2::UPC2-HIS1
1392 SILVER ET AL.EUKARYOT. CELL

Page 3

ml, and 20 mg of histidine/ml. Strains were grown for 48 h, and 100 ODs of cells
at 600 nm [concentration of cells (OD/ml) ? volume (ml) ? 100 OD] were used
in a heptane extraction of ergosterol. Ergosterol levels were determined on a
spectrophotometer scanning from 230 to 310 nm.
RESULTS
C. albicans UPC2 homolog. A search of the C. albicans ge-
nome database maintained at Stanford University was per-
formed by using the ScUPC2 and ScECM22 sequences. Both
ScUPC2, a gene associated with uptake of ergosterol across the
plasma membrane and regulation of ERG2, and ScECM22, a
gene associated with increased susceptibility to the chitin-dis-
rupting drug calcofluor white, have homology (e?112and
2e?87, respectively) to a single open reading frame (ORF) in
C. albicans, ORF 19.391 (with allele ORF 19.8021) (http://
www-sequence.stanford.edu/group/candida). The C. albicans
ORF will be referred to subsequently as UPC2 (CaUPC2 for
clarity in this publication).
The amino acid homology between these proteins is highly
conserved within two regions, with 66% identity in the amino-
terminal transcription factor domain and 64% identity in the
carboxy-terminal transmembrane domain (Fig. 1). The amino
head region of these proteins contains a highly conserved
Zn(2)-Cys(6) DNA binding domain unique to fungi, with over
80 proteins described in this family (22, 27). These zinc finger
domains are flanked by multiple nuclear localization signals in
all three proteins. The carboxy-terminal region of these pro-
teins contains a transmembrane domain proposed to act as a
cytoplasmic anchor for the ScUPC2 protein, allowing the tran-
scription factor domain to translocate to the nucleus only after
cleavage (http://psort.nibb.ac.jp/form2.html) (22).
PCR-based disruption of C. albicans genes. The first step in
the analysis of the C. albicans UPC2 gene was a deletion of
both alleles. BWP17, a strain with a triple auxotrophy (lacking
Uri, Arg, and His), was used for the removal of two alleles and
later complementation. The heterozygous deletion strain S-7
(UPC2/upc2::URA3) was generated through homologous re-
combination with a disruption amplicon containing the URA3
gene flanked by 50-mer regions of homology to the UPC2 gene.
Colonies grew on plates lacking Uri and were confirmed by
Southern blotting to have a UPC2 deletion (Fig. 2). The ho-
mozygous deletion strain D-6 (upc2::URA3/upc2::ARG4) was
constructed through transformation of S-7 with an amplicon
containing the ARG4 gene flanked by the same 50-mer regions
of homology. Colonies grew on plates lacking Uri and Arg and
were confirmed by Southern blotting to contain a deletion of
the second allele. The genotypes of these strains are summa-
rized in Table 1. To restore the gene, the entire UPC2 locus
(797 bp upstream of the ATG to 291 bp downstream of the
stop codon) was cloned into the pGEM-HIS1 vector upstream
of the HIS1 gene at the BamHI and ApaI sites and confirmed
by sequencing. A PCR amplification of the UPC2-HIS1 region
was then used to transform the homozygous deletion strain
D-6. Colonies grew on the medium lacking His, replacing the
allele containing the ARG4 gene and the allele containing the
URA3 gene at equal rates as measured by Southern blotting
and growth on selective media. Figure 2 shows a Southern blot
of genomic DNA from the strain constructs, illustrating the
deletion of two UPC2 alleles and their reconstruction at the
UPC2 locus.
Increased susceptibility in UPC2 deletion strains. Because
the ScECM22 gene was initially identified in a screen for in-
creased susceptibility to calcofluor white (1), and because the
ScUPC2 deletion has been associated with altered sterol accu-
mulation and regulation of sterol biosynthesis genes (27), it
was of interest to test the C. albicans UPC2 deletions against a
panel of antifungal drugs (Table 2). For the azole drugs keto-
conazole, itraconazole, and fluconazole, which target the prod-
uct of the ERG11 gene, there was a marked increase in the
susceptibility of the UPC2 deletion strains (8-, 8-, and 11-fold,
respectively). The UPC2 deletion strains were also tested
against drugs that act on ergosterol biosynthesis at sites up-
stream and downstream of ERG11, including terbinafine,
which targets the product of the ERG1 gene (squalene epoxi-
dase), fenpropimorph, which targets the product of the ERG2
gene (C-8 sterol isomerase), and lovastatin, which targets the
product of the HMG1 gene (HMG-CoA reductase) and is used
clinically as an anticholesterol drug. For each of these drugs,
an increase in susceptibility was observed (800-, 25-, and 16-
fold, respectively). Drugs that act to disrupt the synthesis or
deposition of chitin in the cell wall, such as nikkomycin Z and
calcofluor white, were also tested with the UPC2 deletions
strains. The strains showed an increased susceptibility to the
drugs (21- and 32-fold). As shown in Table 2, the reconstructed
strains (EC-7 and EC-2) consistently returned drug suscepti-
bility to that of the single allele or wild-type (WT) level.
Altered drug susceptibility for CaUPC2 deletion strains to
all drugs was not observed. Amphotericin B, which binds di-
rectly to ergosterol in the plasma membrane, resulting in cell
lysis, showed no change in susceptibility between BWP17 and
the UPC2 deletion strains. Cycloheximide, a potent inhibitor of
protein synthesis, also showed no difference in its effect on
parental and UPC2 deletion strains of C. albicans. For several
compounds (e.g., sodium dodecyl sulfate [SDS] and dithiothre-
FIG. 2. Southern blot analysis of CaUPC2 strains. DNA from
UPC2 deletion strains and the parental was digested with BglII, run on
an agarose gel, blotted onto a nitrocellulose membrane, and then
probed with the radiolabeled UPC2 5? KO oligonucleotide (see Ma-
terials and Methods). The blot shows the replacement of a UPC2 allele
with URA3 in strain S-7 and then the replacement of the remaining
allele with ARG4 in strain D-6, confirming the disruption of both
UPC2 alleles. Strains EC-7 and EC-2 are single-allele reconstructions
replacing either the URA3 or ARG4 locus with a UPC2-HIS1 fragment.
The additional lower band in the EC-7 lane is the result of the plasmid
constructs.
VOL. 3, 2004CANDIDA ALBICANS TRANSCRIPTION FACTOR Upc2p1393

Page 4

itol [DTT]) known to have a general effect on cell wall struc-
ture, there was no change in susceptibility between BWP17 and
the UPC2 deletion strains. Similarly, no change in growth was
observed for cells grown at high salt concentrations (2.5 M
NaCl) or under osmotic stress (2 M sorbitol) (data not shown).
Ergosterol levels are lower in UPC2 deletion strains. In S.
cerevisiae, the UPC2 gene has been associated with regulation
of sterol uptake across the plasma membrane. To investigate
whether the C. albicans gene was behaving in a similar manner,
accumulation of [14C]cholesterol was measured (Fig. 3). Each
strain was incubated in radioactive cholesterol for 48 h under
aerobic conditions, and total accumulation of [14C]cholesterol
was measured. The WT strain BWP17 and one reconstructed
strain, EC-2, exhibited comparable cholesterol accumulation.
The heterozygous deletion, S-7, and the reconstructed strain
EC-7 had similar intermediate levels of cholesterol accumula-
tion. The homozygous deletion strain, D-6, exhibited the low-
est level of [14C]cholesterol accumulation.
C. albicans UPC2 deletion strains also demonstrate an in-
creased susceptibility to ergosterol biosynthetic pathway inhib-
itors as well as to drugs acting at the cell wall (Table 2). To
investigate whether this susceptibility correlates with lower lev-
els of ergosterol in the plasma membrane, an ergosterol ex-
traction where ergosterol was measured as an absorption spec-
tra between 230 nm and 310 nm was performed (Fig. 4). The
parental BWP17 strain had the highest level of ergosterol, the
heterozygous deletion had an intermediate level of ergosterol,
and the homozygous deletion strain had the lowest level of
ergosterol. The reconstructed strains, EC-2 (Fig. 4) and EC-7
(data not shown), had ergosterol levels comparable to that of
the heterozygous disruption strain, S-7.
To determine if the UPC2 gene deletion in C. albicans alters
accumulation of ergosterol specifically or lipophilic molecules
in general, strains were grown on medium containing two li-
pophilic dyes, Congo red and phloxine B (Fig. 5) (5). On each
agar plate, the level of dye accumulation was highest for
BWP17. Dye accumulation was severely reduced in the dele-
FIG. 3. Analysis of [41C]cholesterol uptake in CaUPC2 deletion
strains. All strains were grown aerobically in the presence of
labeled cholesterol for 48 h, washed, and lyophilized. Pellets were then
counted and normalized to weight. Values on the y axis are counts per
minute (CPM)/mg.
14C-
FIG. 4. Analysis of ergosterol in CaUPC2 deletion strains. Wild-
type and UPC2 deletion strains were grown in YAD-CSM medium
supplemented with 20 mg of uridine/ml, 50 mg of arginine/ml, and 20
mg of histidine/ml for 48 h, followed by a heptane extraction and
spectrophotometric scan to detect ergosterol levels. Extracts were
scanned from 230 to 310 nm, and the data were plotted. Strains are
represented as BWP17 (open diamonds), UPC2 heterozygous deletion
strain S-7 (open squares), UPC2 homozygous deletion strain D-6
(open triangles), and reconstructed strain EC-2 (open circles). The
EC-7 strain had levels equivalent to S-7 and EC-2 but was omitted for
clarity (data not shown). Abs., absorption.
TABLE 2. Susceptibility testing of UPC2 disruption strainsa
Drug Drug target
MIC (?g/ml)
Fold changeb
BWP17 S-7 D-6EC-7 EC-2
Fluconazole
Itraconazole
Ketoconazole
Erg11p
Erg11p
Erg11p
2
0.016
0.016
1
0.008
0.008
0.19
0.002
0.002
1.5
0.032
0.016
2
0.016
0.012
11
8
8
Terbinafine
Fenpropimorph
Lovastatin
Erg1p
Erg2p
Hmg1p
1001
6.3
16
0.125
0.25
1
10012.5
12.5
16
800
25
16
6.3
16
6.25
16
Nikkomycin Z
Calcofluor white
Chitin synthetase
Chitin deposition
125
64
3.9
15.6
3.9
3.1
125
64
125
128
32
21
Amphotericin B
Cycloheximide
DTT
SDS
Ergosterol
LSU rRNA
Reducing agent
Plasma membrane
0.19 0.190.19 0.250.191
1
1
2
250250 250250 250
0.5
0.025
1
0.025
1
0.013
1
0.025
1
0.025
aAll strains were grown in RPMI 1640 medium supplemented with arginine, histidine, and uridine for 48 h. Data reflect the MIC80cutoff. MICs for itraconazole
and amphotericin B were determined by Etest. Other MICs were determined by the standard NCCLS microdilution protocol.
bFold change ? WT/D6 (homozygous deletion strain).
1394SILVER ET AL.EUKARYOT. CELL

Page 5

tion strains, especially in the homozygous deletion strain. Dye
accumulation was restored to heterozygous deletion levels in
the reconstructed strain EC-7, while the reconstructed strain
EC-2 restored dye uptake to wild-type levels. Dye accumula-
tion was determined visually by colony color.
Ergosterol biosynthesis genes are unable to respond to drug
pressure in UPC2 deletion strains. The ScUPC2 and ScECM22
genes have been shown to regulate transcription of the ERG2
and ERG3 genes in the ergosterol biosynthetic pathway in
response to cellular ergosterol levels (27). In order to investi-
gate the effect of a CaUPC2 deletion on the expression of
genes in the ergosterol biosynthetic pathway, strains were
grown under drug pressure and the transcription of the ERG2,
ERG11, and UPC2 genes was measured (Fig. 6A). Parental
and UPC2 deletion strains were grown in culture without drug
and in the presence of 5 ?g of fluconazole/ml. All strains
showed similar baseline levels of expression for the ERG2 and
ERG11 genes in the absence of drug. All strains except the
UPC2 homozygous deletion strain, D-6, showed an increase in
the expression of ERG2 and ERG11 when grown in the pres-
ence of drug (up to 16-fold compared to strain D-6) (Fig. 6B).
As expected, the UPC2 deletion strain, D-6, did not show any
expression of the UPC2 gene when grown with or without drug.
All other strains showed background levels of expression of
UPC2 in the absence of fluconazole and an increase in expres-
sion when exposed to 5 ?g of fluconazole/ml, similar to the
ERG2 and ERG11 genes (Fig. 6A). As UPC2 expression levels
are minimal in the absence of drug, quantification of induction
is difficult for UPC2 (data not shown).
Research on S. cerevisiae has identified an 11-bp sterol re-
sponse element (5? CTCGTATAAGC 3?) upstream of many
ergosterol biosynthesis genes that acts as a binding site for
ScUPC2 and ScECM22 (27). A core of 7 of the 11 bp (TCGT
ATA) appears to be essential for binding in S. cerevisiae. A
search of promoters of C. albicans ergosterol biosynthetic
genes revealed sequences identical to the S. cerevisiae SRE
core upstream of many genes, including ERG1, ERG2, and
ERG11 (Table 3). This SRE core was not found in the pro-
moters of genes not associated with ergosterol biosynthesis,
such as the housekeeping genes ACT1 or ENO1.
DISCUSSION
The effect of a UPC2 deletion in Candida albicans has been
investigated. Deletion strains exhibited a variety of pheno-
types, including increased drug susceptibility; altered gene ex-
pression for ergosterol biosynthesis genes; an altered ergos-
terol profile; and altered accumulation of lipophilic molecules,
including cholesterol.
CaUPC2 is closely related to the paralogs ScUPC2 and
ScECM22 with protein homology BLAST scores of e?112and
2e?87, respectively. There is a single copy of the diploid
CaUPC2 gene (Fig. 1) that corresponds to both ScUPC2 and
ScECM22 genes; this correspondence may be due to the ge-
nome duplication hypothesized to have occurred in S. cerevi-
FIG. 5. Lipophilic dye accumulation in CaUPC2 deletion strains.
All strains were grown on YEPD plates containing the lipophilic dyes
Congo red (A) or phloxine B (B) for 72 h at 30°C and photographed.
FIG. 6. (A) Northern blot analysis of UPC2 strains. BWP17 and
UPC2 deletions strains were grown in minimal medium in the absence
or presence of 5 ?g of fluconazole/ml for 6 h to an OD of 0.8 to 1.0.
Total RNA was harvested, run on an agarose gel, blotted onto a
nitrocellulose membrane, and then probed with radiolabeled oligonu-
cleotides specific for each gene (see Materials and Methods). A probe
of the ACT1 housekeeping gene served as the loading control for each
blot; all strains had equivalent levels of ACT1 mRNA (data not
shown). (B) Quantification of Northern blot results. mRNA levels for
BWP17 and UPC2 deletion strains were measured by using a Storm
Phosphorimager. After normalizing each band to its ACT1 loading
control, a comparison of the relative intensities between strains grown
with and without drug showed a 6- to 16-fold increase in the expression
of ERG2 (light bars) and ERG11 (dark bars) in the presence of 5 ?g
of fluconazole/ml. UPC2 expression changes could not be measured, as
signal in the no-drug lanes was not significantly above background.
VOL. 3, 2004 CANDIDA ALBICANS TRANSCRIPTION FACTOR Upc2p1395