Long-term persistence of Coxiella burnetii after acute primary Q fever

Q Fever Research Group, Infectious Diseases LAboratories, IMVS and Hanson Institute, Adelaide, South Australia.
QJM: monthly journal of the Association of Physicians (Impact Factor: 2.5). 02/2005; 98(1):7-20. DOI: 10.1093/qjmed/hci009
Source: PubMed


Long-term persistence of C. burnetii in infected animals was established in the 1950s and 60s, but the implications for human Q fever are not fully explored.
To compare the prevalence of markers of infection in a cohort of Q fever patients in Australia (up to 5 years after infection) with those in the 1989 Birmingham cohort (12 years after infection).
Case follow-up study.
C. burnetii was tested for by: (i) antibodies to Phase 1 and 2 antigens in the three immunoglobulin classes; (ii) detection of DNA in bone marrow and peripheral blood mononuclear cells by PCR assays directed against several different targets in the genome; and (iii) attempts to isolate coxiellas in cell culture or mice from PCR-positive samples. Amplicon specificity was verified by fluorometric probing and by sequencing. Cross-contamination was excluded by extensive use of non-template controls, and in particular by the use of certain IS1111a target sequences.
Irrespective of clinical state, both groups remained seropositive, principally exhibiting medium levels of IgG antibody against C. burnetii Phase 2 antigen. C. burnetii genomic DNA was detected by PCR in 65% of bone marrow aspirates from Australian patients and approximately 88% of Birmingham patients. No coxiella were isolated from PCR positive samples.
We propose a provisional model for persistence. In Q fever without sequelae, the process is largely confined to the bone marrow. In Q fever fatigue syndrome (QFS), it is modulated by the patient's immunogenetic background to give higher levels of coxiella genomes in bone marrow and increased shedding into the peripheral blood. In Q fever endocarditis, late pregnancy, or during iatrogenic or other immunosuppression, the multiplication cycle is prolonged, and a potential source of live organisms.

9 Reads
    • "A portion of the extracted DNA was subjected to the real-time PCR assay using published primers that amplify the outer membrane protein com1gene unique to C. burnetii , namely com1 forward AATCGCAATACGCTGCCAAA and com1 reverse AGCAGCGCGTCG TGGAA (Marmion et al., 2005 and Cooper et al., 2007; OIE, 2014b). Reaction conditions for the real-time PCR assay were modified from the original description by Marmion et al. (2005). Each reaction consisted of 19 ImmoMix (Bioline, Alexandria, NSW, Australia), 0.3 lM forward primer, 0.3 lM reverse primer, 0.01 mM SYTO-9 (Invitrogen, Mulgrave, Victoria, Australia) and molecular grade water (ddH 2 O) (Sigma- Aldrich Pty. "
    [Show abstract] [Hide abstract]
    ABSTRACT: In 1964, Brucella was isolated from rodents trapped in Wooroonooran National Park (WNP), in Northern Queensland, Australia. Genotyping of bacterial isolates in 2008 determined that they were a novel Brucella species. This study attempted to reisolate this species of Brucella from rodents living in the boundary area adjacent to WNP and to establish which endo- and ecto-parasites and bacterial agents were being carried by non-indigenous rodents at this interface. Seventy non-indigenous rodents were trapped [Mus musculus (52), Rattus rattus (17) and Rattus norvegicus (1)], euthanized and sampled on four properties adjacent to the WNP in July 2012. Organ pools were screened by culture for Salmonella, Leptospira and Brucella species, real-time PCR for Coxiella burnetii and conventional PCR for Leptospira. Collected ecto- and endo-parasites were identified using morphological criteria. The percentage of rodents carrying pathogens were Leptospira (40%), Salmonella choleraesuis ssp. arizonae (14.29%), ectoparasites (21.42%) and endoparasites (87%). Brucella and C. burnetii were not identified, and it was concluded that their prevalences were below 12%. Two rodent-specific helminthic species, namely Syphacia obvelata (2.86%) and Nippostrongylus brasiliensis (85.71%), were identified. The most prevalent ectoparasites belonged to Laelaps spp. (41.17%) followed by Polyplax spp. (23.53%), Hoplopleura spp. (17.65%), Ixodes holocyclus (17.64%) and Stephanocircus harrisoni (5.88%), respectively. These ectoparasites, except S. harrisoni, are known to transmit zoonotic pathogens such as Rickettsia spp. from rat to rat and could be transmitted to humans by other arthropods that bite humans. The high prevalence of pathogenic Leptospira species is of significant public health concern. This is the first known study of zoonotic agents carried by non-indigenous rodents living in the Australian wet-tropical forest interface. © 2015 Blackwell Verlag GmbH.
    Transboundary and Emerging Diseases 04/2015; DOI:10.1111/tbed.12360 · 2.94 Impact Factor
  • Source
    • "can persist in cells of the mononuclear phagocyte system such as the bone marrow, lymph nodes, spleen and liver [14]. Similarly, chronic infection and long-term persistence of C. burnetii has been identified in the bone marrow and liver of humans many years after primary bacteremia [15,16]. It is presumed that a similar pathogenesis exists in marine mammals, but this has not been substantiated. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Background The northern fur seal (Callorhinus ursinus) is an important cultural and nutritional resource for the Aleut community on St. Paul Island Alaska. In recent years, an increasing number of zoonotic pathogens have been identified in the population, but the public health significance of these findings is unknown. To determine the prevalence of Coxiella burnetii and Brucella spp. in northern fur seal tissues, eight tissue types from 50 subsistence-harvested fur seals were tested for bacterial DNA by real-time polymerase chain reaction.FindingsOf the 400 samples tested, only a single splenic sample was positive for Brucella spp. and the cycle threshold (ct) value was extremely high suggesting a low concentration of DNA within the tissue. C. burnetii DNA was not detected.Conclusions Findings suggest that the risk of humans contracting brucellosis or Q fever from the consumption of harvested northern fur seals is low.
    Acta Veterinaria Scandinavica 10/2014; 56(1):67. DOI:10.1186/s13028-014-0067-x · 1.38 Impact Factor
  • Source
    • "After acute Coxiella infection, DNA and antigen can be detected for a long time in several tissues, in particular in bone marrow where even in the absence of serological evidence for chronic infection, DNA can be detected up to decades after infection [7,8]. Animal experiments showed that the DNA-positive bone marrow is not infectious in susceptible mice [8]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: After the largest outbreaks of Q fever ever recorded in history occurred in the Netherlands, concern arose that Coxiella may be transmitted via donated tissues of latent or chronically infected donors. The Dutch Health Council recently advised to screen tissue donors, donating high risk tissues, for Coxiella infection. After validation of an enzyme immunoassay (EIA) test for IgG antibodies against phase 2 of C. burnetii for use on post-mortem samples, serum samples of 1033 consecutive Dutch post-mortem tissue donors were tested for IgG antibodies against phase 2 of C. burnetii. Confirmation of reactive results was done by immunofluorescence assay (IFA). All available tissues (corneas, heart valves, skin and bone marrow) from donors with IgG reactivity were tested for presence of Coxiella DNA by PCR. Risk factors for IgG reactivity were investigated. After validation of the tests for use on post-mortem samples, 50/1033 donors (4.8%) screened positive for phase 2 anti-Coxiella IgG by EIA, and 31 were confirmed by IFA (3.0%). One donor showed a serological profile compatible with chronic infection. All tested tissues (25 corneas, 6 heart valves, 4 skin and 3 bone marrow) from donors with IgG reactivity tested negative for the presence of Coxiella DNA. Except for living in a postal code area with a high number of Q fever notifications, no risk factors for IgG reactivity were found. The strong correlation between notifications and seroprevalence confirms that the used assays are sufficiently specific for use on post-mortem samples, although one has to be aware of differences between batches. Thus, this study provides a validated method for screening tissue donors for infection with Coxiella burnetii that can be used in future outbreaks.
    BMC Infectious Diseases 01/2014; 14(1):6. DOI:10.1186/1471-2334-14-6 · 2.61 Impact Factor
Show more

Similar Publications