Radiation hybrid map, physical map, and low-pass genomic sequence of the canine prcd region on CFA9 and comparative mapping with the syntenic region on human chromosome 17.

Abstract

Progressive rod-cone degeneration (prcd) is a canine retinal disease that maps to the centromeric end of CFA9 in a region of synteny with the distal part of HSA17q. As such, prcd has been postulated as the only animal model of RP17, a human retinitis pigmentosa locus that maps to 17q22. In an effort to establish more detailed regions of synteny between dog CFA9 and the HSA17q-ter region, we created a robust gene-enriched CFA9-RH08(3000) map with 34 gene-based markers and 12 microsatellites, with the highest resolution and number of markers for the centromeric end of CFA9. Furthermore, we built an approximately 1.5-Mb physical map containing both GRB2 and GALK1, genes so far identified by meiotic linkage analysis as being closest to the prcd locus, and generated about 1.2 Mb low-pass (3.2x) canine sequence. Canine to human comparative sequence analysis identified 49 transcripts that had been previously mapped to the HSA17q25 region. The generated low-pass canine sequence was annotated with a working draft of human sequence from HSA17q25, and we used this scaffold to order and orient the canine sequence against human. This order and orientation are preliminary, as high-throughput genomic sequencing of HSA17q-ter has not been fully completed.

Full text

Page 1

Radiation hybrid map, physical map, and low-pass genomic sequence
of the canine prcd region on CFA9 and comparative mapping
with the syntenic region on human chromosome 17?
D.J. Sidjanin,aB. Miller,aJ. Kijas,aJ. McElwee,aJ. Pillardy,bJ. Malek,cG. Pai,c
T. Feldblyum,cC. Fraser,cG. Acland,aand G. Aguirrea,*
aJames A. Baker Institute for Animal Health, College of Veterinary Medicine, Cornell University, Ithaca, NY 14853, USA
bComputational Biology Service Unit, Cornell Theory Center, Cornell University, Ithaca, NY 14853, USA
cThe Institute for Genomic Research, Rockville, MD 20850, USA
Received 19 August 2002; accepted 8 November 2002
Abstract
Progressive rod–cone degeneration (prcd) is a canine retinal disease that maps to the centromeric end of CFA9 in a region of synteny
with the distal part of HSA17q. As such, prcd has been postulated as the only animal model of RP17, a human retinitis pigmentosa locus
that maps to 17q22. In an effort to establish more detailed regions of synteny between dog CFA9 and the HSA17q–ter region, we created
a robust gene-enriched CFA9-RH083000map with 34 gene-based markers and 12 microsatellites, with the highest resolution and number
of markers for the centromeric end of CFA9. Furthermore, we built an approximately 1.5-Mb physical map containing both GRB2 and
GALK1, genes so far identified by meiotic linkage analysis as being closest to the prcd locus, and generated about 1.2 Mb low-pass (3.2?)
canine sequence. Canine to human comparative sequence analysis identified 49 transcripts that had been previously mapped to the
HSA17q25 region. The generated low-pass canine sequence was annotated with a working draft of human sequence from HSA17q25, and
we used this scaffold to order and orient the canine sequence against human. This order and orientation are preliminary, as high-throughput
genomic sequencing of HSA17q–ter has not been fully completed.
© 2003 Elsevier Science (USA). All rights reserved.
Keywords: Bacterial artificial chromosome; Contig mapping; Dog; Genome sequencing; Nucleotide sequence; Physical mapping; Progressive retinal atrophy;
Progressive rod–cone degeneration; Radiation hybrid mapping; Retinitis pigmentosa; Rod photoreceptors; Synteny
Retinitis pigmentosa (RP) is a clinically and genetically
heterogeneous group of blinding disorders that primarily
affect the retinal rod photoreceptors [1]. RP is among the
most common inherited forms of blindness affecting ap-
proximately 1 in every 4000 people [2]. Genetic studies in
humans have identified 13 dominant, 21 recessive, and 5
X-linked loci, and mutations were identified in 12 dominant,
15 recessive, and 2 X-linked genes associated with heredi-
tary RP [3].
The dog is an excellent model for molecular and cellular
studies of RP. From the clinical aspect, the canine equiva-
lent of human RP has been termed progressive retinal atro-
phy (PRA) and, like RP, is fundamentally a disease of rod
photoreceptors. In the dog eight distinct autosomal loci
[4–9] and one X-linked [10,11] locus have been identified
as associated with photoreceptor degenerations; of these,
mutations have been identified in 6 genes [7–9,11–13].
The canine PRA models are especially valuable when the
canine disease is a true homolog of the human disorder that
can aid in identifying a novel gene(s) and metabolic path-
ways essential for photoreceptor function and viability in
both humans and dogs. One of the canine PRA loci, pro-
? Sequence data from this article have been deposited with the EMBL/
GenBank Data Libraries under Accession Nos. AY178785, AY178786,
AY178787, AY178788, AY178789,
AY178792.
* Corresponding author. Fax: ?1-607-256-5689.
E-mail address: gda1@cornell.edu (G. Aguirre).
AY178790,AY178791, and
R
Available online at www.sciencedirect.com
Genomics 81 (2003) 138–148 www.elsevier.com/locate/ygeno
0888-7543/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved.
doi:10.1016/S0888-7543(02)00028-9

Page 2

gressive rod–cone degeneration (prcd), has been mapped to
the centromeric end of canine chromosome 9 (CFA9) in a
region that shows conservation of synteny with HSA17q–ter
[5]. In human, retinitis pigmentosa 17 (RP17) is a form of
RP that maps to HSA17q22 [14–16]. Based on clinical
similarities of the diseases, as well as chromosomal loca-
tion, prcd has been proposed as a locus homolog for RP17
and the only animal model for RP17 [5].
Although the syntenic relationships between specific re-
gions of the canine and human genomes have already been
established, there is little specific information on the con-
servation of gene order along a chromosome [17–20]. In the
case of prcd and RP17, there has been a chromosomal
inversion in that the most telomeric genes on HSA17q are
centromeric in dog [17–21]. Understanding the gene order
within conserved segments between the HSA17q–ter and
the centromeric region of CFA9 would allow for compara-
tive mapping between RP17 and prcd regions and would
facilitate identification of positional candidate genes respon-
sible for the disease. To develop these tools for comparative
mapping, we have produced a radiation hybrid (RH) map, a
physical map, and a draft sequence of contigs of the prcd
region; these provide the highest resolution comparison of
the HSA17q–ter and centromeric region of CFA9 to date.
Results
CFA9 RH083000map
To construct an RH083000map of CFA9, we initially
mapped 30 markers that were previously placed onto the
canine-hamster CFA9-RHDF5000 map [20,22]. The results
showed a general agreement in marker assignment and
order between the CFA9-RH083000 and the CFA9-
RHDF5000 maps. The markers in common for CFA9-
RH083000and CFA9-RHDF5000 are indicated in bold on
Fig. 1. In a previous study, the PDE6G gene was shown to
be unlinked to any other marker on CFA9-RHDF5000 [18],
whereas on CFA9-RH083000PDE6G shows linkage to
TIMP2 (LOD ? 2.742) and was placed as the most centro-
meric locus on the CFA9-RH083000map (Fig. 1). The mi-
crosatellites CO9.891 and CO9.250, previously mapped
only on the canine meiotic map [20], were placed, respec-
tively, centromeric to CO3304 and between DTMT and
ALDOC/CRYBA1 genes.
Fourteen genes that map on HSA17q21–ter were se-
lected (Table 1), and canine-specific markers were devel-
oped from putative UTRs or introns as described under
Materials and methods. All 14 gene-based markers were
found to map to CFA9-RH083000. Together with the mark-
ers previously mapped to CFA9 on the RHDF5000 panel, a
total of 46 markers (34 gene-based and 12 microsatellites)
are now mapped on the CFA9-RH083000panel. This map is
1270 cR3000in length, with an average marker spacing of 1
marker per 27.0 cR3000, with some areas more densely
covered (Fig. 1).
Construction of the BAC contig
To initiate the physical mapping of the prcd region, a
canine GRB2 cDNA probe was used initially to screen the
BAC library. GRB2 was selected because a polymorphic
marker associated with the GRB2 gene was identified with
the highest lod score (LOD ? 6.6 (? ? 0.0)) in the 0
recombinant region of a canine backcross pedigree previ-
ously set up to segregate for the prcd mutation (G. Aguirre
et al., unpublished). Following the initial characterization of
BACs containing the GRB2 gene, BACs were end se-
quenced, and BAC end-STSs were used to extend the BAC
contig. Subsequently, 10 successive bidirectional walks
were performed using probes derived from BAC-end STSs.
In total, 50 BAC clones were characterized, and 49 new
STSs were generated and assembled into a contig having an
average depth of 6.4 BACs per STS marker (Fig. 2).
Sequence development and analysis
From the contig, 10 BACs were selected to create a
minimal tiling path, sized, and determined to cover ?1.5
Mb. Eight of these BACs, comprising 1.2 Mb of additive
BAC sizes, were sequenced and a total of 3,916,500 bp of
sequence was obtained, thus providing at least 3.2? cover-
age of the region. The generated sequence was run through
phrap/phred analysis that assembled the sequence data into
40–71 unordered and unoriented contigs within each BAC;
this totaled 443 contigs for the region. The contigs were
subsequently masked for repetitive elements using Repeat-
Masker and run against nonredundant (nr), EST (dbEST),
and high-throughput genomic sequence (htgs) GenBank nu-
cleotide databases using BLAST@CBSU software [23].
Of 443 canine contigs analyzed, 132 contigs matched 49
transcribed sequences, 62 contigs had significant matches
only with human genomic sequences, and 249 contigs had
no matches in any database. The 49 transcribed human
sequences that matched 132 canine contigs have been pre-
viously identified as genes (37) or hypothetical genes (7),
and 5 were described as EST clusters (Table 2). Of 49
transcribed human sequences identified, 47 were found in
the three adjacent working draft sequence contigs from
HSA17q25 (NT_010677, NT_033292, and NT_010641).
However, the remaining 2 genes, KIAA0195 and CASKIN2,
were identified in a low-pass human sequence clone
AC100787. This clone contains a partial genomic sequence
of the LLGL2 gene that is also identified in NT_033292. In
addition, the AC100787 clone contains sequences matching
the EST cluster Hs.244353, also identified in NT_010677.
139
D.J. Sidjanin et al. / Genomics 81 (2003) 138–148

Page 3

140
D.J. Sidjanin et al. / Genomics 81 (2003) 138–148

Page 4

The GenBank DNA map assigns AC100787 between
NT_010677 and NT_033292 [24].
Alignment of homologous sequences
Although sequencing has not been completed for this
region of the human genome, the 3.2? low-pass canine
sequence was annotated to the corresponding draft sequence
of HSA17q25. The Advanced PipMaker software [25] was
used to align canine contigs to the three working-
draft human sequences (NT_010677, NT_033292, and
NT_010641). Fig. 3A shows that contigs from three over-
lapping BACs (429O8, 374D7, and 122J4) could be ordered
and oriented using a human draft sequence (NT_010677) as
a scaffold. An apparent duplication in the region of the ICT1
gene was identified as indicated in Fig. 3A. Similarly, con-
tigs from BACs 169J12 and 298M24, and contigs from
BACs 275K3 and 338A17, could be ordered and oriented
using human draft sequences NT_033292 and NT_010641,
respectively (data not shown). The PipMaker analysis also
revealed high sequence conservation, not only for exonic
regions, but also for noncoding regions in terms of nonex-
onic and nonrepetitive sequence (Fig. 3B). These segments
do not have matches in EST and nonredundant nucleotide
databases and were not predicted in human sequences to be
exons.
Discussion
We previously mapped prcd to the centromeric end of
CFA9 [5]. Examination of known positional candidate
genes in this region failed to identify the gene and disease-
causing mutation. This prompted us to characterize this
chromosomal region in the dog better using a combination
of RH and physical mapping resources. The use of RH
mapping has become possible with the availability of two
(3000 and 5000 rads) whole-genome dog/hamster RH pan-
Fig. 1. RH map of CFA9-RH083000(left) and HSA17q (right). The gene order for all genes from HSA17q, except PDE6G, was generated from the UCSC
Human Genome Project Working Draft [29]. The location for human PDE6G was assigned from the GB4 RH map [42]. The CFA9-RH083000was made using
30 markers previously mapped on CFA9-RHDF5000 (bold) and 2 microsatellites CO9.891 and CO9.250 (underlined) previously mapped to a CFA9 meiotic
map [20] and 14 previously unmapped gene-based markers reported in this study. The boxed genes represent clusters of conserved synteny identified with
HSA17q and one cluster on the telomeric end of CFA9 syntenic with HSA9q34. The shaded area represents genes (SRP68–GALK1–GRB2–FDXR) that were
identified in the same order on the BAC physical map illustrated in Fig. 2.
Table 1
Primer sequences and PCR conditions for 14 gene-based markers mapped on the RH083000panel
Canine locus Primer sequence (5? 3 3?)
TAnn(°C)
MgCl2(mM)
Human locus ID
FDXR
AAGTGGCTGGATGCTTCTGG
AGGACTTGGGGTGTGCAGAT
ATGTGCAGTGATGAGTGATAAT
CCTTACATTTTATACTGACCTGAG
CTCCCATCTTCAGAGTGAATATG
CTTGACTCTTCCCTACCCTC
CAAGCCTGAAGGTCAGCATGG
TGGCCACGTTCTTCAAGAGCC
CAATTGCAGGAGAGTCTGCTGATA
GAACATGGCGCCCAAGCTTTG
GCAGAGTCCATACATTGAATG
GTGTCTCATTCAGTCTGACC
GCTCTAGCTGCCACCTTAGTG
TTCACCACGGGACTCCATGGGCAT
GGAGTGGGGTAATGTGACATTT
ATTGAGGGTTTTACACAGGCAG
CTCAAGGTGGACATCCTGTACAA
AGCAGCGTCCGGATGCCCTT
CAGTCTGAAGACGTGTTCGT
TAGTGAGAAGTCAGGGCATG
ACACCTCCCGAGTTGCCAGGG
TGAGGTCATTCCTGGCAAAGC
CATTTATCCTCCACTGCTCAGGC
TAGATGTCGGGGTTCCAAGGAGTG
CTTCCAGCTGAAGTACATCC
GAGAGATTCAGAGTGATAGTGGC
GAATCCTAAAATCTCAGTGTG
GCTGTGCTTTGTGATTTTTAG
58 1.52232
GRB2
58 1.52885
ITGB3
58 2.03690
MYL4
531.54635
PRKARIA
531.5 5573
PRKCA
50 2.05578
RGS9
531.58787
RPS6KB1
60 1.56198
SCN4A
58 2.06329
SEC14L1
56 2.06397
SSTR2
531.56752
TIMP2
58 1.57077
TK1
531.5 7083
TRAP240
58 1.5 9969
141
D.J. Sidjanin et al. / Genomics 81 (2003) 138–148

Page 5

els. The ability to map nonpolymorphic gene-based markers
with an RH panel provides a valuable opportunity for com-
parative mapping between dog and other genomes of map-
rich species, particularly human. The current canine inte-
grated linkage and RH maps contain 1800 markers [20]. In
addition, a reproducible system for assignment of canine
genes by FISH has been developed with a mixture of meta-
phase chromosomes from red fox and dog [26]. As a result,
syntenic relationships have been established between spe-
cific regions of the canine and human genomes [20,26,27].
Using previously published markers that mapped to
CFA9 in the RH-5000 panel, and 14 additional canine-
specific gene-based markers that we developed, we have
created a robust gene-enriched CFA9-RH083000map with
34 gene-based and 12 microsatellite markers that span a
length of 1270 cR3000. The results from our CFA9-
RH083000mapping confirm earlier established syntenies be-
tween CFA9 and HSA17q and HSA9q34 [17–21,26,27].
The PDE6G gene, previously unassigned on an RH map, is
now placed as the most centromeric gene on CFA9-
RH083000, a position that is consistent with the canine–
human chromosomal painting as well as linkage mapping
[19,28]. However, conservation of synteny does not neces-
sarily translate into conserved gene order. On the CFA9-
RH083000map, genes were placed into clusters syntenic
with HSA17q–ter and an additional cluster on the telomeric
end of CFA9 that corresponded to HSA9q34. The order of
the clusters, as well as the gene order within each cluster on
CFA9 and HSA17q–ter, differed, suggesting evolutionary
rearrangements. However, more detailed mapping will be
required to precisely define gene order on both CFA9 and
HSA17q, confirm rearrangements, and establish evolution-
ary chromosomal break points.
The present CFA9-RH083000map has significantly in-
creased the resolution and number of markers for the cen-
tromeric end of CFA9 and the prcd region. This region of
the CFA9-RH083000map shows remarkable conservation of
gene content and order relative to the HSA17q25 region.
However, because of the proximity of this region to the TK1
selectable marker used in construction of the canine–ham-
ster RH panel, it is difficult to unequivocally establish order
Fig. 2. Schematic representation of a physical map of 50 BAC clones and
49 new STSs generated and assembled into a contig with an average depth
of 6.4 BACs per STS marker. The primer sequences, PCR conditions, and
GenBank accession numbers are detailed by STS marker name on our Web
page (http://cbsu.tc.cornell.edu/ccgr/djs/index.htm). Clones that form a
minimal tiling path across ?1.5 Mb are shown with a thicker line (not
drawn to scale). Low-pass 3.2? sequence of ?1.2 Mb from 8 BAC clones
(in bold) from the minimal tiling path has been generated and analyzed.
Brackets above the contigs identify BACs in which canine/human se-
quence homologies were identified for genes SRP68, GALK1, GRB2, and
FDXR. The GRB2 gene was identified in two BACs (374D7 and 122J4),
suggesting that canine GRB2 is located in overlapping regions between
them. The gene order for SRP68, GALK1, GRB2, and FDXR on the
physical map confirms the gene order initially established on the CFA9-
RH083000map.
142
D.J. Sidjanin et al. / Genomics 81 (2003) 138–148