The absence of p53 promotes metastasis in a novel somatic mouse model for hepatocellular carcinoma.

Abstract

We have generated a mouse model for hepatocellular carcinoma using somatic delivery of oncogene-bearing avian retroviral vectors to the liver cells of mice expressing the viral receptor TVA under the control of the albumin gene promoter (Alb-TVA mice). Viruses encoding mouse polyoma virus middle T antigen (PyMT) induced tumors, which can be visualized with magnetic resonance imaging, in 65% of TVA-positive animals. While these tumors can exceed 10 mm in diameter, they do not invade locally or metastasize to the lungs. Delivery of PyMT-expressing viruses to Alb-TVA mice lacking an intact p53 gene does not increase tumor incidence. However, the resulting tumors are poorly differentiated, invasive, and metastatic to the lungs. Gene expression microarrays identified over 100 genes that are differentially expressed between tumors found in p53 wild-type and p53 null mice. Some of these genes, such as cathepsin E and Igf2, have been previously implicated in tumor cell migration and invasion. Tumors induced in p53 null, TVA transgenic mice by PyMT mutants with changes in specific tyrosine residues fail to form metastases, indicating that metastasis is dependent on both the oncogene and the absence of p53.

Full text

Page 1

MOLECULAR AND CELLULAR BIOLOGY, Feb. 2005, p. 1228–1237
0270-7306/05/$08.00?0doi:10.1128/MCB.25.4.1228–1237.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 25, No. 4
The Absence of p53 Promotes Metastasis in a Novel Somatic Mouse
Model for Hepatocellular Carcinoma†
Brian C. Lewis,1* David S. Klimstra,2Nicholas D. Socci,3,4Su Xu,5Jason A. Koutcher,5and
Harold E. Varmus1
Cancer Biology and Genetics Program,1Department of Pathology,2Computational Biology Program,3and Department
of Medical Physics,5Memorial Sloan-Kettering Cancer Center, New York, and Department of Pathology, Albert
Einstein College of Medicine, Bronx,4New York
Received 11 June 2004/Returned for modification 30 July 2004/Accepted 18 November 2004
We have generated a mouse model for hepatocellular carcinoma using somatic delivery of oncogene-bearing
avian retroviral vectors to the liver cells of mice expressing the viral receptor TVA under the control of the
albumin gene promoter (Alb-TVA mice). Viruses encoding mouse polyoma virus middle T antigen (PyMT)
induced tumors, which can be visualized with magnetic resonance imaging, in 65% of TVA-positive animals.
While these tumors can exceed 10 mm in diameter, they do not invade locally or metastasize to the lungs.
Delivery of PyMT-expressing viruses to Alb-TVA mice lacking an intact p53 gene does not increase tumor
incidence. However, the resulting tumors are poorly differentiated, invasive, and metastatic to the lungs. Gene
expression microarrays identified over 100 genes that are differentially expressed between tumors found in p53
wild-type and p53 null mice. Some of these genes, such as cathepsin E and Igf2, have been previously implicated
in tumor cell migration and invasion. Tumors induced in p53 null, TVA transgenic mice by PyMT mutants with
changes in specific tyrosine residues fail to form metastases, indicating that metastasis is dependent on both
the oncogene and the absence of p53.
Hepatocellular carcinoma (HCC) exerts a significant toll on
human health worldwide, with more than 250,000 new cases
annually and a 5-year survival rate of less than 5% (36). Cur-
rent treatment modalities are largely unsuccessful: single-agent
and combination chemotherapy regimens have proven to be
ineffective in the treatment of HCC patients (24). Therefore,
surgery remains the only curative option for HCC; however,
for most patients this is not a viable option because of signif-
icant liver cirrhosis or invasive and metastatic disease that has
spread to the lymph nodes, portal vein, or lungs (20).
HCC is strongly associated with chronic infection by hepa-
titis B virus (HBV) and hepatitis C virus (HCV): incidence of
HCC correlates with HBV and HCV infection rates within a
population, and the average age of onset is inversely correlated
with the prevalence of HBV infection (4, 39, 45). Although the
precise mechanisms by which HBV and HCV predispose to
HCC are unclear, the current belief is that the liver damage
and regeneration associated with chronic viral infection pro-
vide a context where oncogenic genetic alterations can occur
and become fixed. The X protein encoded by HBV, through its
regulation of calcium signaling that is critical for HBV repli-
cation, is thought to play an important role in this process (6).
Other factors that predispose to the occurrence of HCC are
prolonged exposure to aflatoxin B1, cirrhosis of any etiology,
hemochromatosis, congenital hepatic fibrosis, and biliary atre-
sia (22).
Alterations in the TP53 gene are frequently found in HCC.
Further, the absence of TP53 gene alterations in hepatic ade-
nomas suggests that this is a late event in tumor progression
(7). Silencing of the INK4A locus has also been observed in a
majority of HCC patients (7, 26, 28). In addition, several chro-
mosome arms—including 1p, 4q, 6q, 9p, 13q, and 17p—are
deleted in significant subsets of human HCC, suggesting the
presence of important tumor suppressor genes at those loci
(7). Interestingly, deregulation of the Wnt signaling pathway
appears to be an important event in a subset of HCC tumors.
Activating mutations in the positive effector ?-catenin have
been described, as have inactivating mutations in axin, a neg-
ative regulator of the Wnt signaling pathway (7). Furthermore,
amplifications of the c-myc and CCND1 oncogenes, which are
downstream targets of the Wnt signaling pathway, have been
described in HCC patients (1, 32).
Mouse models for HCC have been generated by several
investigators using traditional transgenic approaches and tet-
racycline-regulated transgene expression (5, 8, 9, 18, 27, 31, 42,
44, 48). These models have yielded important information
about HCC but have two very important limitations. First, the
transgene is expressed in all of the target cells, creating a field
effect in which every hepatocyte within the liver has altered
gene expression. Indeed, in some of the published models mice
die shortly after birth with hepatic defects and atypical liver
architecture (42). Second, it is very expensive and time con-
suming to cross these models to generate models with combi-
nations of genetic lesions. This has prevented direct compari-
son of different mouse models for HCC. Clearly, a mouse
model in which the effects of different oncogenes could be
directly compared would represent a significant advance in the
field. Recently, Harada et al. have described an HCC mouse
model that bypasses some of these deficiencies by using ade-
novirus-mediated delivery of Cre recombinase to activate ex-
* Corresponding author. Present address: University of Massachu-
setts Medical School, 364 Plantation St., LRB 521, Worcester, MA
01605. Phone: (508) 856-4325. Fax: (508) 856-4650. E-mail: brian
.lewis@umassmed.edu.
† Supplemental material for this article may be found at http:
//mcb.asm.org/.
1228

Page 2

pression of constitutively active forms of the H-Ras and ?-cate-
nin oncoproteins (14).
We report here the generation of a mouse model for HCC
through the targeted delivery of oncogene-bearing avian leu-
kosis sarcoma virus subgroup A (ALSV-A)-based RCAS vec-
tors (replication-competent ALSV retroviral vectors) into
transgenic mice in which expression of the ALSV-A receptor
TVA is regulated by the albumin gene promoter and enhancer
sequences. Mammalian cells are normally resistant to infection
by ALSV and ALSV-based vectors (49). However, expression
of the ALSV-A receptor, TVA, renders mammalian cells sus-
ceptible to infection by ALSV-A and ALSV-A-based vectors
(3, 51). Delivery of avian cells that produce RCAS viruses
encoding mouse polyoma virus middle T antigen (PyMT) in-
duces the formation of liver adenomas with high levels of
penetrance. The induced tumors display increased prolifera-
tion, low apoptotic rates, induction of angiogenesis, and acti-
vation of downstream effectors of PyMT, including Akt and
Erk (extracellular signal-regulated kinase). Delivery of RCAS-
PyMT producer cells to TVA-expressing mice deficient for the
tumor suppressor protein p53 induces progression to invasive
carcinomas that metastasize to the lung. Introduction of phos-
phorylation site mutants of PyMT into TVA-positive, p53 null
mice demonstrates that the activity of the oncogene is critical
for the invasive and metastatic behavior of tumors in p53 null
mice. Finally, utilizing gene expression microarrays, we have
identified several potential mediators of the metastatic tumor
behavior. Thus, we have generated a somatic model for HCC
that can be utilized to dissect the molecular pathways involved
in the initiation and progression of this malignancy.
MATERIALS AND METHODS
Transgenic mice and animal care. The albumin-tv-a transgene was constructed
with pBluescript SK(?) by fusing a 2.2-kb DNA fragment containing albumin
gene promoter-enhancer sequences, consisting of 200 bp of proximal albumin
gene promoter sequence fused to 2 kb of enhancer sequence located 8 kb
upstream, to a 1.2-kb BamHI fragment containing the 800-bp tv-a cDNA fused
to a simian virus 40 intron and polyadenylation sequences (gift of G. Fisher) (3,
38). The 3.4-kb transgene was isolated from vector sequences by digestion with
NotI and XhoI, gel purified, and resuspended in Tris-EDTA for pronuclear
injection. Albumin-tv-a animals were maintained on a CBA/CAJ ? C57BL/6J
mixed genetic background. p53 null mice with a Sv129 ? C57BL/6 mixed genetic
background have been previously described (17). Animals were kept in specific
pathogen-free housing with abundant food and water under guidelines approved
by the Memorial Sloan-Kettering Cancer Center Institutional Animal Care and
Use Committee and Research Animal Resource Center.
Virus delivery. The RCAS-green fluorescent protein (GFP), RCAS-PyMT, and
RCAS–c-myc vectors have been previously described (12, 16, 35). DF1 chicken
fibroblasts (15, 43) transfected with RCAS vectors were maintained in Dulbec-
co’s modified Eagle medium supplemented with 10% fetal bovine serum in
humidified 37°C incubators under 5% CO2. Cells to be injected were harvested,
washed once with phosphate-buffered saline (PBS), and resuspended in PBS at
a final concentration of 2 ? 105cells/?l. A total of 5 ?l of the cell suspension was
delivered by injection into the liver parenchyma of 2- or 3-day old animals with
Hamilton syringes attached to 26-gauge needles.
Tumor harvest and histology. Animals were sacrificed with a lethal dose of
CO2per institutional guidelines. Tumors, liver tissue, and lungs were removed
and either fixed in 10% buffered formalin overnight at room temperature or
snap-frozen in liquid nitrogen. Fixed tissues were paraffin embedded, and 5-?m
sections were placed on sialynated slides at Histoserv, Inc. (Gaithersburg, Md.).
Magnetic resonance imaging. Mice were assessed individually by magnetic
resonance imaging (MRI) for tumor establishment. Images were obtained on a
1.5T General Electric LX Echo Speed Signa scanner (General Electric Medical
Systems, Milwaukee, Wis.) with homemade foil solenoid coils (inner diameter,
27 mm). The mice were anesthetized with isofluorane throughout image acqui-
sition. Images were acquired with a two-dimensional spin-echo pulse sequence.
Initially, the animal was positioned in the coil in a holder, and sagittal scout T1
weighted spin-echo images and axial scout T2 weighted spin-echo images were
obtained to localize the region of interest. For tumor detection, high-quality T1
and T2 (spin-spin relaxation time) weighted fast spin-echo transverse images
were obtained with in-plane resolution of 156 by 156 ?m or 156 by 208 ?m and
1.5-mm-thick slices.
Immunohistochemistry. Paraffin sections were deparaffinized and rehydrated
by passage through Clear-Rite 3 and a graded alcohol series. Endogenous per-
oxidase activity was inactivated by treatment with 3% hydrogen peroxide, after
which antigen retrieval was performed utilizing heated citric buffer. Slides were
blocked for 1 h and then incubated with a rabbit anti-Ki67 antibody (Novocastra)
at a dilution of 1:1,000 for 1 h at room temperature. After being washed with
PBS, slides were incubated with secondary antibody according to the manufac-
turer’s instructions (Vector Labs, Burlingame, Calif.). Substrate incubation and
color development were performed according to the manufacturer’s instructions
(Vector Labs).
In situ hybridization. Freshly generated paraffin sections were rehydrated as
described above. After being blocked for 3 h in prehybridization solution (21),
slides were hybridized to 4 ? 106cpm of33P-labeled antisense RNA probes
specific for PyMT. Washes were performed as previously described (50). Slides
were then dipped in warm photographic emulsion and exposed for 2 weeks
before development.
RNA isolation. Frozen tissue samples were pulverized with a mortar and
pestle, the ground tissue was lysed in Trizol reagent (Invitrogen), and RNA was
extracted according to the manufacturer’s instructions. The isolated RNA was
purified over an RNeasy column (QIAGEN) according to the manufacturer’s
protocol. The RNA concentration was determined by a spectrophotometer,
ethanol precipitated, and resuspended at a final concentration of 1 ?g/?l.
Immunoblotting. DF1 cells were collected in cell-scraping buffer, pelleted, and
lysed in 10% sodium dodecyl sulfate by being boiled for 10 min. Chromatin was
then sheared by passage through a 27-gauge needle. Protein concentration was
determined with the BCA assay kit (Pierce, Rockford, Ill.), and equal amounts
of protein were loaded per lane. Ground frozen tissue samples were lysed in 10%
sodium dodecyl sulfate by being boiled as described above. Protein concentra-
tions were determined as described above, and equal amounts of protein were
loaded per lane. After being transferred to nitrocellulose membranes, primary
antibodies were incubated overnight at 4°C in Tris-buffered saline–1% Tween 20
and the appropriate blocking reagent, according to the manufacturer’s instruc-
tions. After being washed with Tris-buffered saline–0.1% Tween 20, blots were
incubated with the appropriate secondary antibodies (Jackson Immunochemi-
cals) at room temperature for 45 min. Chemiluminescence was performed with
Super Signal reagent (Pierce). Primary antibodies used were as follows: rat
anti-polyoma T antigens, 1:3,000 dilution (gift of Michelle Fluck); rabbit anti-
phosphorylated AKT (anti-p-AKT), 1:1,000 dilution (Cell Signaling); rabbit anti-
p-mitogen-activated protein kinase (anti-p-MAPK), 1:1,000 dilution (Cell Sig-
naling); rabbit anti-Akt, 1:1,000 dilution (Cell Signaling); rabbit anti-MAPK,
1:1,000 dilution (Cell Signaling); mouse anti-?-tubulin, 1:2,000 dilution (Sigma).
Reverse transcription-PCR (RT-PCR). A total of 0.5 ?g of purified total RNA
was utilized for RT-PCR. All RT-PCRs were performed with the Superscript
One-Step RT-PCR kit (Invitrogen). For amplification of cathepsin E, reverse
transcription was performed at 55°C for 30 min, followed by denaturing at 94°C
for 2 min and amplification for 35 cycles with the following parameters: dena-
turing at 94°C for 30 s, annealing at 50°C for 30 s, and extension at 72°C for 1
min. Amplification conditions for insulin-like growth factor 2 (Igf2) and H19
were as above for cathepsin E, except the annealing temperature was 60°C for
Igf2 and 58°C for H19. For ?-actin, reactions were performed under identical
conditions except the amplification was performed for 25 cycles. For tv-a, reac-
tions were performed at an annealing temperature of 55°C for 35 cycles in the
presence of 5% dimethyl sulfoxide.
Primers were as follows: tva5, 5?CTGCTGCCCGGTAACGTGACCGG 3?;
tva31, 5?GCCCTGGGGAAGGTCCTGCCC 3?; cathepsin E F1, 5?ATAAGAG
TTGCTTAAAGTCG 3?; cathepsin E B1, 5?GAGAAATGATTCCCTACCTC
3?; Igf2 F2, 5?TGGTCCCAGAGAGGTTTTAGGTGG 3?; Igf2 B2, 5?ACTTGC
TCCCGCCTGATGTAAC 3?; H19 F1, 5?AGGGGGCCTGGTGAGAAGAA
3?; H19 B1, 5?ATGGGAATGGTGTGTCTGCA 3?; actin F1, 5?GGCTGTATT
CCCCTCCATCG 3?; and actin B1, 5?AGATGGGCACAGTGTGGGTG 3?.
Gene expression array analysis. The quality of RNA was ensured before
labeling by analysis of 20 to 50 ng of each sample with the RNA 6000 NanoAssay
and a Bioanalyzer 2100 (Agilent). Samples with a 28S/18S ribosomal peak ratio
of 1.8 to 2.0 were considered suitable for labeling. For samples meeting this
standard, 5 ?g of total RNA was used for cDNA synthesis with an oligo(dT)-T7
primer and the SuperScript Double-Stranded cDNA Synthesis kit (Invitrogen).
VOL. 25, 2005ABSENCE OF p53 PROMOTES METASTASIS IN MOUSE MODEL 1229

Page 3

Synthesis, linear amplification, and labeling of cRNA were accomplished by
transcription in vitro with the MessageAmp cRNA Kit (Ambion) and biotinyl-
ated nucleotides (Enzo Diagnostics). Ten micrograms of labeled and fragmented
cRNA was then hybridized to the murine genome array U74A, version 2.0
(Affymetrix), which contains ?12,000 oligonucleotide-based probe sets, at 45°C
for 16 h. Automated washing and staining were performed with the Affymetrix
Fluidics Station 400 according to the manufacturer’s protocols, and probe inten-
sities were measured with the argon laser confocal GeneArray scanner (Hewlett-
Packard). Raw expression data were analyzed with Microarray Analysis 5.0
software (Affymetrix). Data were normalized to a target intensity of 500 to
account for differences in global chip intensity. The data were then clustered
both by genes and by samples. For gene clustering, the data were filtered with the
P value from a Wilcoxon test between tumor and normal samples. The genes
selected in this manner were then clustered with the angle correlation metric and
a variant of the k means-clustering algorithm (46). For the clustering of samples,
the genes were first filtered to include only those that scored present in at least
four of the samples. The correlation metric was used with average linkage
hierarchical clustering. To assess the robustness of the clustering results, a
parametric bootstrapping procedure was done. The data was resampled and
clustered 1,000 times, and a final tree was built by the consensus tree method
(11). In addition, to find genes that discriminated between the tumor classes (p53
wild type versus p53 null) a variant of the t test was used. In this t test, the
variance was regularized by a term that depended on the overall intensity of the
samples (2).
RESULTS
Generation of albumin-tv-a transgenic mice. We sought to
develop a new mouse model for HCC through the somatic
introduction of oncogenes into hepatocytes. We therefore gen-
erated transgenic animals in which the receptor for ALSV-A,
TVA, was produced specifically within the liver. This approach
has been successfully utilized in previously described mouse
models (25, 34). We fused promoter and enhancer sequences
from the albumin gene, previously demonstrated to direct liv-
er-specific expression (38), upstream of a cDNA encoding the
glycosylphosphatidylinositol-anchored isoform of TVA (3, 51).
Attempts to identify the presence of the receptor in liver tissue
sections from albumin-tv-a transgenic mice by immunostaining
failed (data not shown). We have, however, detected TVA by
immunostaining in transgenic mice designed to express the
receptor in other tissues (25, 34). Despite the absence of visible
staining in the liver, the tv-a transcript could be readily iden-
tified by RT-PCR within the liver but not in other organs
tested, including the lung (Fig. 1, top). Three independent
transgenic lines showed liver-specific expression of tv-a by RT-
PCR. One of these lines, line B, was subsequently used for
tumor induction studies.
RCAS vectors are replication-competent ALSV retroviral
vectors. Like other oncoretroviruses, RCAS viruses require
division of target cells for integration of the reverse-tran-
scribed viral genome into the host genome (30, 40). We there-
fore assayed the proliferation status of liver cells in newborn
mice and 6-week-old adults. Staining for the proliferation
marker Ki67 demonstrated high rates of cell division in the
livers of newborn mice, with significantly lower rates in adult
livers (Fig. 1, bottom).
RCAS-PyMT induces liver tumors with high penetrance. To
attempt to induce liver tumors, we injected DF-1 chicken fi-
broblasts producing RCAS viruses encoding PyMT into the
livers of 2- or 3-day-old albumin-tv-a transgenic animals, when
the organ is easily visualized beneath the skin. A pilot exper-
iment was performed on a litter of three tv-a-positive mice.
Sacrifice of the litter at 3 months of age identified a single
tumor-bearing animal. Given these findings, we subsequently
injected other litters with RCAS-PyMT and sacrificed the mice
at either 4 or 6 months of age to identify the presence of
tumors. Of the animals analyzed in this fashion, 8 of 11 mice
sacrificed at 4 months of age, and 9 of 15 mice sacrificed at 6
months of age displayed grossly visible liver tumors (Table 1).
Further, tumor formation was dependent on the presence of
TVA, as none of 11 tv-a-negative littermates injected with
RCAS-PyMT developed tumors. In addition, only 1 of 16 tv-
a-positive animals injected with RCAS-GFP and aged for 13
months developed a liver tumor (Table 1). This tumor may
have occurred as a result of insertional mutagenesis, although
we have not assayed for the presence of integrated proviral
DNA.
Examination of tissue sections obtained from the tumors
demonstrated well-circumscribed lesions composed of en-
larged hepatocytes with clear, vacuolated cytoplasm and mod-
erate nuclear atypia (Fig. 2A). The clear cytoplasm is believed
to contain high levels of fat, which was removed during fixation
FIG. 1. Characterization of albumin-tv-a transgenic mice. (Top)
Ethidium bromide-stained agarose gel showing the presence of TVA
mRNA in selected tissues in albumin-tv-a transgenic mice, as detected
by RT-PCR. Amplification of ?-actin mRNA is shown as a control in
the lower panel. (Bottom) Identification of proliferating cells in the
liver of 2-day-old mice (left) and 6-week-old mice (right) by immuno-
histochemical staining for the proliferation-associated marker Ki67.
Original magnification, ?100.
TABLE 1. Tumor induction by RCAS-PyMT in albumin-tv-a
transgenic micea
Albumin-tv-a
transgene
p53
status
Tumor
incidence
Metastasis
?
?
?
?
?/?
?/?
?/?
?/?
0/11
17/26
14/38
18/43
N/A
1/17
1/14
6/16
aIncidence of grossly visible tumors in albumin-tv-a transgenic mice detected
after sacrifice. p53?/?and p53?/?mice were sacrificed at either 4 or 6 months of
age. p53?/?mice were sacrificed at either 4 months of age or upon the detection
of lymphomas or sarcomas, whichever came first. N/A, not applicable.
1230 LEWIS ET AL.MOL. CELL. BIOL.

Page 4

and paraffin embedding, as the tumors were negative after
periodic acid Schiff staining, which detects glycogen (data not
shown). Consistent with this hypothesis, gene expression arrays
demonstrated increased transcripts from several adipocyte-
specific genes in RCAS-PyMT-induced tumors relative to nor-
mal liver tissue (see the supplemental data). In addition to the
morphological changes in the nucleus and cytoplasm, the tu-
mors displayed abnormal tissue architecture, as determined by
a reticulin stain for the basement membrane. While normal
hepatocyte plates are a single cell thick, the plates of the
induced liver tumors were two to three cells thick (Fig. 2B).
Since tumor-bearing animals did not show signs of disease
before sacrifice, we attempted to identify animals with tumors
noninvasively by subjecting a small cohort of animals to MRI at
2- to 3-week intervals. In this way, we observed small tumors,
less than 5 mm in diameter, in two of four animals at 5 months
of age; the presence of the tumors was confirmed by patholog-
ical examination 24 h later (Fig. 2C).
Characterization of PyMT-induced tumors. To confirm that
the tumors in mice exposed to RCAS-PyMT arose from RCAS-
infected cells, we first determined whether the identified tu-
mors expressed PyMT. Protein lysates from tumors and normal
liver tissue were analyzed by immunoblotting with a rat serum
raised against mouse polyoma virus T antigens. PyMT was
readily detected in all tumor samples but not in normal liver
tissue from an uninfected transgenic mouse (Fig. 3A). We then
assayed the activation state of the Akt and Erk kinases, which
are known to act downstream of PyMT-mediated signaling
pathways (13). Western blot analysis showed that both Akt and
Erk are more highly phosphorylated, and presumably more
active, in tumors than in normal tissue (Fig. 3B).
We next measured cell proliferation and apoptosis in the
liver tumors. The PyMT-induced liver tumors displayed an
FIG. 2. RCAS-PyMT induces liver tumors in albumin-tv-a transgenic mice. (A) Hematoxylin and eosin (H&E)-stained sections demonstrating
the presence of liver lesions in a 6-month-old albumin-tv-a transgenic animal injected with RCAS-PyMT. Magnification, ?25 (left), ?100 (right).
N, normal liver tissue; T, tumor. (B) Determination of hepatocyte plate size by reticulin staining for basement membrane in normal adult liver
tissue (left) and tumor tissue (right) sections. Green bars indicate widths of hepatocyte plates. Original magnification, ?200. (C) Detection of liver
tumors by MRI. (Left) T2 weighted MRI image demonstrating the presence of liver tumors (red arrows); (right) a photograph of the liver of the
animal after euthanasia 24 h later. Arrows indicate the location of the tumors.
FIG. 3. Characterization of induced liver tumors. (A) Detection of
PyMT by immunoblotting with anti-PyMT serum of protein lysates from
normal adult liver tissue (N) and three representative tumors (T1 to T3).
(B) Increased p-Akt/total Akt, and p-MAPK/total MAPK ratios in
RCAS-PyMT-induced liver tumors in comparison to age-matched adult
liver tissue detected by immunoblotting. (C) Enhanced proliferation in
induced liver tumor (left) in comparison to adjacent normal tissue (right)
as determined by immunohistochemical staining for Ki67.
VOL. 25, 2005 ABSENCE OF p53 PROMOTES METASTASIS IN MOUSE MODEL1231

Page 5

elevated fraction of cells in S phase, compared to surrounding
normal tissue, as determined by Ki67 staining (Fig. 3C). In
addition, the tumors did not display increased levels of apo-
ptosisby terminaldeoxynucleotidyltransferase-mediated
dUTP-biotin nick end labeling staining, consistent with the
antiapoptotic effects of Akt-mediated signaling downstream of
the PyMT oncoprotein (data not shown).
The loss of the TP53 tumor suppressor gene is a common
event in HCC. We therefore sought to determine whether loss
of this tumor suppressor was required for tumor formation.
We analyzed genomic DNA from three tumors induced in
albumin-tv-a mice for the presence of the p53 locus by PCR.
All tumors were positive for the presence of p53. We next
amplified cDNA from four tumors corresponding to nucleo-
tides 719 to 1150 of the p53 coding sequence, which contains
several mutation hotspots found in human tumors, and se-
quenced the PCR products. No mutations were identified in
any of the tumors. Thus, inactivation of p53 does not appear to
be required for tumor formation.
The p19ARFtumor suppressor mediates oncoprotein signal-
ing to p53 (53). We therefore determined whether this tumor
suppressor was inactivated during tumor formation. We per-
formed RT-PCR on RNA isolated from four tumor samples
and four normal liver tissue samples. All tumors displayed
elevated p16 and p19 mRNA levels compared to normal liver
tissue, indicating that the Ink4a locus is intact and not silenced
by gene methylation (data not shown).
The absence of p53 induces lung metastasis. The TP53 tu-
mor suppressor is frequently inactivated in human HCC. We
therefore sought to determine the effect of p53 deficiency on
tumor formation. Albumin-tv-a transgenic mice were bred to
animals null for p53 as a result of gene targeting to generate
cohorts of transgenic mice that were either heterozygous or
null for p53 (17). Newborn mice from these crosses were in-
jected with RCAS-PyMT producer cells and monitored for
tumor formation. Of 38 TVA-positive, p53 heterozygous ani-
mals injected with RCAS-PyMT, 14 were found to have tumors
after sacrifice at either 4 or 6 months of age (Table 1). Simi-
larly, tumor incidence in the injected p53 null littermates was
not increased, with 18 of 43 animals found to have tumors after
sacrifice (Table 1). These data suggest that the absence of p53
does not promote tumor initiation in this model. It should be
noted, however, that some of the p53 null animals were sacri-
ficed as early as 9 weeks of age due to the presence of thymic
lymphomas, sarcomas, or hemangiosarcomas and were main-
tained for no longer than 4 months. The reduced life span of
these mice may have reduced tumor occurrence or detection of
liver tumors.
Although the absence of p53 appeared to have no effect on
tumor initiation, it greatly influenced tumor behavior. While
only 1 of 17 p53 wild-type and 1 of 14 p53 heterozygous tumor-
bearing mice developed lung metastases, 6 of 16 tumor-bearing
p53 null mice analyzed displayed lung metastases (Table 1).
Furthermore, in p53 null animals bearing primary tumors
larger than 6 mm in diameter, lung metastases were observed
in six of seven animals. By contrast, only one of six p53 wild-
type mice bearing tumors larger than 6 mm in diameter had
lung metastases. On histologic examination, the tumors in p53
null mice were shown to contain regions that resembled the
tumors induced in p53 wild-type mice. However, the tumors
from p53 null animals also contained regions with highly dis-
organized and undifferentiated cells (Fig. 4A). Such regions
were not seen in tumors identified in p53 wild-type or p53
heterozygous animals, including those that exceeded 6 mm in
diameter. Histologically, the pulmonary lesions resembled the
undifferentiated regions identified within the primary tumors,
suggesting that the metastatic cells were derived from these
regions (Fig. 4B).
To confirm that the lung lesions were metastases and not
other tumors arising from uninfected cells within the p53-
deficient animals, we performed in situ hybridizations to detect
PyMT mRNA. The lung metastases but not the surrounding
normal lung tissue showed evidence of hybridization of cellular
RNA to radiolabeled antisense PyMT RNA probes (Fig. 4C).
Furthermore, the hepatic transcription factor hepatocyte nu-
clear factor 1 was detected by immunostaining in the nuclei of
cells within the lung lesions but not in surrounding lung tissue
(data not shown).
p53 null and p53 wild-type tumors display different gene
expression profiles. The difference in metastatic potential dis-
played by tumors in p53 null and wild-type mice raised the
possibility that these effects may be mediated by differences in
gene expression. We therefore determined the gene expression
profiles of a subset of tumors from p53 wild-type and p53 null
mice, as well as normal liver tissue obtained from p53 wild-type
and p53 null adult animals, by Affymetrix oligonucleotide ar-
rays. Unsupervised hierarchical clustering of the expression
array data demonstrated that the tumor samples were readily
distinguished from the normal tissue samples (Fig. 5A). We
used the Wilcoxon rank sum test to find genes that differenti-
ated between normal and tumor samples. Over 500 genes were
identified that differentiated between normal and tumor sam-
ples with a P value of ?0.00067 (see Table S1 in the supple-
mental material). Among the genes more highly expressed in
tumors was the proliferation marker Ki67, reflecting the in-
creased proliferation of the tumor cells compared to normal
cells (Fig. 2C), and JunB, a member of the AP-1 transcription
factor family. We also identified elevated expression of another
AP-1 family member, JunD, by immunohistochemical staining
(data not shown). Interestingly, several proapoptotic genes,
including Bax and 24p3 (lipocalin), were elevated in the tumors
compared to normal tissues. However, increased mRNA levels
were detected for the antiapoptotic gene TIAP (survivin), sug-
gesting a possible mechanism for the absence of increased
apoptosis in the tumors.
Among the genes with lower mRNA levels in the tumors
were genes associated with differentiated liver cells such as
hydroxysteroid dehydrogenase and liver-specific arginase. Fur-
ther, in comparison to normal liver tissue, the tumors had
lower levels of biliary glycoproteins 1 and 2, suggesting that the
tumors were indeed derived from the transformation of hepa-
tocytes and not from cells in the bile ducts.
The gene expression studies further demonstrated that the
tumors with the ability to metastasize have an expression pro-
file that is distinct from that of the nonmetastatic tumors in-
duced in p53 wild-type mice. To identify genes that differenti-
ated between these two groups, a variant t test was used (see
Materials and Methods) which corrects the variance with a
term that depends on the intensity of the samples. (There were
not enough samples in each group to use the Wilcoxon test.)
1232LEWIS ET AL.MOL. CELL. BIOL.