Angiotensin II increases the expression of lectin-like oxidized low-density lipoprotein receptor-1 in human vascular smooth muscle cells via a lipoxygenase-dependent pathway.

Abstract

Lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) is a membrane protein that can act as a surface endocytosis receptor for oxidized LDL (ox-LDL). As increased cellular uptake of ox-LDL by macrophages and activated smooth muscle cells may transform these cells into foam cells, potential interactions among LDL oxidation, ox-LDL uptake, and regulators of vascular smooth muscle cell function are of obvious interest. The objective of this study was to examine the effect of angiotensin II (AII) on the expression of LOX-1 and ox-LDL degradation in human vascular smooth muscle cells (VSMC) METHODS: We performed in vitro experiments in a human VSMC line (T/G HA-VSMC) derived from normal aortic VSMC, using standards methods.
We found that AII (10(-7) mol/L) increased the expression of LOX-1 (approximately 2.5-fold, P < .0001) in association with higher degradation of ox-LDL by HA-SMC (from 4019 +/- 529 ng/mg cell protein to 6207 +/- 287 ng/mg cell protein; P = .0033). AII also increased the expression of 12-lipoxygenase (12-LO) and 15-lipoxygenase (15-LO) by approximately 2.2-fold (P = .03) and approximately 3-fold (P = .006), respectively. In addition, AII (10(-7) mol/L) increased the release of 12- and 15-hydroxyeicosatetraenoic acid from VSMC within 10 min approximately 3-fold (P = .03) and 50% (P < .05), respectively.
Our study findings provide evidence that angiotensin II upregulates LOX-1 and 12-LO and 15-LO expression in human VSMC, thereby potentially providing mechanisms for both accelerated LDL oxidation within the cell and the internalization of exogenous ox-LDL, two processes that could increase the susceptibility of human VSMC to further transformation into foam cells.

Full text

Page 1

Original Contributions
Angiotensin II Increases the Expression of
Lectin-like Oxidized Low-Density Lipoprotein
Receptor–1 in Human Vascular Smooth Muscle
Cells via a Lipoxygenase-Dependent Pathway
Rona Limor, Marielle Kaplan, Tatsuya Sawamura, Orli Sharon, Shlomo Keidar,
Gary Weisinger, Esther Knoll, Michal Naidich, and Naftali Stern
Background: Lectin-like oxidized low-density li-
poprotein receptor–1 (LOX-1) is a membrane protein that
can act as a surface endocytosis receptor for oxidized LDL
(ox-LDL). As increased cellular uptake of ox-LDL by
macrophages and activated smooth muscle cells may
transform these cells into foam cells, potential interactions
among LDL oxidation, ox-LDL uptake, and regulators of
vascular smooth muscle cell function are of obvious in-
terest. The objective of this study was to examine the
effect of angiotensin II (AII) on the expression of LOX-1
and ox-LDL degradation in human vascular smooth mus-
cle cells (VSMC)
Methods: We performed in vitro experiments in a
human VSMC line (T/G HA-VSMC) derived from normal
aortic VSMC, using standards methods.
Results: We found that AII (10?7mol/L) increased the
expression of LOX-1 (?2.5-fold, P ? .0001) in associa-
tion with higher degradation of ox-LDL by HA-SMC
(from 4019 ? 529 ng/mg cell protein to 6207 ? 287ng/mg
T
converting enzyme (ACE) is present in sclerotic aortic
valves where it colocalizes with angiotensin II (AII).1
Circulating low-density lipoprotein (LDL) may carry and
deliver ACE to atherosclerotic lesions.1AII increases the
synthesis of proteoglycans with enhanced LDL binding
capacities.2Both native LDL and oxidized LDL (ox-LDL)
increase the expression of the AII type 1 receptor (AT1R),
which mediates most of the recognized cardiovascular
cell protein; P ? .0033). AII also increased the expression
of 12-lipoxygenase (12-LO) and 15-lipoxygenase (15-LO)
by ?2.2-fold (P ? .03) and ?3-fold (P ? .006), respec-
tively. In addition, AII (10?7mol/L) increased the release
of 12- and 15-hydroxyeicosatetraenoic acid from VSMC
within 10 min ?3-fold (P ? .03) and 50% (P ? .05),
respectively.
Conclusions: Our study findings provide evidence
that angiotensin II upregulates LOX-1 and 12-LO and
15-LO expression in human VSMC, thereby potentially
providing mechanisms for both accelerated LDL oxidation
within the cell and the internalization of exogenous ox-
LDL, two processes that could increase the susceptibility
of human VSMC to further transformation into foam cells.
Am J Hypertens 2005;18:299–307 © 2005 American
Journal of Hypertension, Ltd.
Key Words: 12-LO, 15-LO, LOX-1, human smooth
muscle cells.
here is growing evidence for interaction among
blood pressure, the renin–angiotensin system, and
lipid metabolism at the vasculature. Angiotensin-
effects of AII.3–5On the other hand, AII also activates
several lipoxygenase (LO) enzymes, products of which
(such as 12-hydroxyeicosatetraenoic acid [HETE]) have
been implicated in cell signaling controlling contraction,
growth, migration, and proliferation of VSMC.6–8The LO
enzymes are also involved in LDL oxidation,9and these
effects are subject to acceleration by AII in macro-
phages.10ox-LDL deposited at the vessel walls can de-
crease the generation of nitric oxide (NO) and cause
endothelial dysfunction11–14and also induce apoptosis in
endothelial cells and VSMC.15,16The uptake of ox-LDL in
Received May 27, 2004. First decision July 14, 2004. Accepted Septem-
ber 13, 2004.
From the Institute of Endocrinology, Metabolism and Hypertension
(RL, OS, GW, EK, NS), Tel Aviv Sourasky Medical Center, Tel Aviv,
Israel; Lipid Research Laboratory (MK, SK), Rambam Medical Center,
Haifa, Israel; National Cardiovascular Center Research Institute (TS),
Osaka, Japan; and Department of Biochemistry (MN), Tel Aviv Univer-
sity, Tel Aviv, Israel.
Address correspondence and reprint requests to Dr. Naftali Stern,
Institute of Endocrinology, Metabolism and Hypertension, Tel Aviv
Sourasky Medical Center, 6 Weizman St., 64239, Tel Aviv, Israel;
e-mail: stern@tasmc.health.gov.il
AJH2005; 18:299–307
0895-7061/05/$30.00© 2005 by the American Journal of Hypertension, Ltd.
Published by Elsevier Inc.doi:10.1016/j.amjhyper.2004.09.008

Page 2

vascular cells is mediated by scavenger receptors; among
these, the expression of lectin-like oxidized low-density
lipoprotein receptor–1 (LOX-1) is upregulated in VSMC
by high blood pressure.17,18Because oxidative modifica-
tion of LDL plays a role in the initiation and progression
of atherosclerosis,19potential interaction among AII, LOs,
and ox-LDL are of obvious interest. In this study, we
examined the effects of AII on LOX-1 expression in as-
sociation with its effects on LO enzymes in human VSMC.
The results suggest that AII up regulates both LOX-1 and
LO enzyme expression, and that the increase in LOX-1
depends on LO activation and is associated with increased
uptake of ox-LDL in VSMC.
Methods
Cell Culture
A line of human vascular smooth muscle cells T/G HA-
VSMC (VSMC; American Type Culture Collection, Manas-
sas, VA) established from a normal aorta was cultured
in Ham’s F12K medium with 2 mmol/L L-glutamine,
10 mmol/L HEPES, 10 mmol/L N-[Tris(hydroxymethyl)-
methyl]-2-aminoethane-sulfonic acid (TES), 0.05 mg/mL
ascorbic acid, 0.01 mg/mL insulin, 0.01 mg/mL trans-
ferrin, 10 ng/mL sodium selenite, 10% fetal calf serum
(FCS), and 0.03 mg/mL endothelial cell growth supple-
ment. Cells were initially trypsinized, transferred to 10-cm
tissue culture dishes, and re-cultured to subconfluence, at
which time they were used for RNA and protein prepara-
tion. In some experiments, cells were first incubated with
AII (10?7mol/L) or losartan (10?5mol/L), an antagonist
of the AII type 1 receptor (AT1R).
Total RNA Preparation
Before RNA preparation, cultured cells were incubated for
24 h in Ham’s F12K medium containing 0.4% fetal calf
serum, 2 mmol/L L-glutamine, 10 mmol/L HEPES,
FIG. 1. Expression of lectin-like oxidized low-density lipoprotein receptor–1 (LOX-1), human platelet type 12-LO and 15-LO type II in
vascular smooth muscle cells (VSMC) as determined by reverse transcription–polymerase chain reaction (RT-PCR). Total RNA was prepared
from cultured cells after 24 h in serum-free medium. The RNA samples were reverse-transcribed and subjected to PCR with specific primers
(see Table 1). A) Platelet type 12-LO expression. B) 15-LO type II expression. C) Expression of LOX-1.
Table
(in 5=-3= orientation)
1. Oligonucleotides usedforpolymerasechainreactionamplification oftarget segments
Gene Sequence (5=-3=)
Human LOX-15= Primer TTACTCTCCATGGTGGTGCC
3= Primer AGCTTCTTCTGCTTGTTGCC
5= Primer GATGATCTACCTCCAAATATG
3= Primer CTGGCCCCAGAAGATCTG
5= Primer TCCTAAAGCATACGGGTCCTGGCAT
3= Primer CGCTCCATGGCCTCCACAATATTCA
5= Primer AACTCAAGGTGGAAGTACCGGAG
3= Primer ATATAGTTTGGCCCCAGCCATATTC
Human 12-LO platelet type
Human cyclophillin
Human 15-LO type II
LO ? lipoxygenase; LOX-1 ? lectin-like oxidized low-density lipoprotein receptor–1.
300
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 3

10 mmol/L TES, 0.05 mg/mL ascorbic acid, 0.01 mg/mL
insulin, 0.01 mg/mL transferrin, and 10 ng/mL sodium
selenite, without endothelial cell growth supplement. Total
RNA from cultured HA-VSMC was extracted using Trizol
reagent (GibcoBRL, Life Technologies Ltd., Paisley,
United Kingdom).
Amplification of Reverse-
Transcribed RNA by
Polymerase Chain Reaction
All oligonucleotides were synthesized by Sigma-Aldrich
(St. Louis, MO) and were purified by high-performance
liquid chromatography (HPLC). The sequences of nucle-
otides (provided in Table 1) were designed from the re-
ported sequences of the various genes.20A 1-?g quantity
of total RNA underwent reverse-transcription (RT) using a
commercially available kit (Clontech Laboratories, Palo
Alto, CA) and further amplified by polymerase chain
reaction (PCR). The PCR consisted of 40 cycles of 94°C
for 40 sec, 55°C for 1 min and 72°C for 1 min. Human
cyclophyllin primers were used for normalization of the
PCR reaction. Blank reaction controls with no RNA tem-
plate or no Moloney-murine leukemia virus (MMLTV-
RT) were performed through the RT and PCR steps.
Cloning and Sequencing
The PCR products were extracted from the agarose gel
with a commercial kit (Jetsorb, Genomed, GmbH, Bad
Oeynhausen, Germany). The DNA fragments obtained
were PCR-amplified and sequenced at the Weizman Insti-
tute Sequencing Facility (Rehovot, Israel).
Western Immunoblotting
Cultured cells were washed with phosphate-buffered saline
(PBS), scraped and lysed on ice in a lysis buffer consisting of
PBS (7.4), supplemented with 1% Triton X-100, 1 tablet of
Boehringer Proteinase Inhibitors (Boehringer-Mannheim,
Mannheim, Germany), and 0.1% sodium docecyl sulfate
(SDS). This was followed by mild glass homogenization (10
FIG. 2. A) Effect of angiotensin II (AII) (10?7mol/L) on LOX-1 expression. Lanes 1 to 3: control; lanes 4 to 6: AII. B) Densitometric
analysis of LOX-1 mRNA expression in untreated VSMC and of cells treated for 1 h with AII (10?7mol/L) alone or in the presence of losartan
(10?5mol/L) or baicalein (10?7mol/L). Results are expressed in arbitrary units relative to control incubates and are means ? SEM of six
separate experiments. ***P ? .0001 v control; #P ? .05 v AII; ###P ? .0001v AII. Abbreviations as in Fig. 1.
301
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 4

strokes) and centrifugation at 10,000 g for 10 min at 4°C.
Aliquots of the supernatant were saved for protein estimation
and Western blot analysis. The SDS protein electrophoresis
was performed on a 8% SDS polyacrylamide gel.21For
Western transfer of protein to Protean nitrocellulose (BA85)
(S&S, Dassel, Germany), standard methods were followed
using a human anti LOX-1 antibody (1:1000) generated by
one of the investigators (T.S.).
Extraction and measurement of 12-HETE
Cultured confluent cells were washed twice with medium
and treated with AII (10?7mol/L) for 10 min. The incu-
bation was stopped by adding 4 mL of ice-cold ethanol
(100%) to the dishes at 0°C. For measurement of 12-
HETE, we used a modification of the reverse-phase ultra-
violet (UV)–HPLC method of Eskra et al, which has been
validated by RIA, as previously described.22
Gel Analysis
Aliquots (20 ?L) of the PCR products were subjected to
electrophoresis in 2.0% commercial agarose E-Gel (In-
vitrogen, Carlsbad, CA) and then photographed.
Cellular Uptake of Lipoproteins
The LDL was radioiodinated by the iodine monochloride
method as modified for lipoproteins.23Radioiodinated ox-
idized LDL (Ox-125I-LDL) was prepared from125I-LDL
that was dialyzed against PBS, followed by incubation
with 5 ?mol/L of CuSO4at 37°C for 24 h. The Ox-125I-
LDL (10 mg of protein/L) was incubated with the cells at
37°C for 5 h. Lipoproteins cellular degradation was mea-
sured in the collected medium as the trichloroacetic acid
(TCA)–soluble, nonlipid radioactivity, which was not due
to free iodide.24Lipoprotein degradation in a cell-free
system was measured under identical conditions was min-
imal (?10%) and was subtracted from the total degrada-
tion.
Statistical Analysis
Results are expressed as mean ? SEM. Data were assessed
bytheStudentttestorone-wayanalysisofvariancefollowed
by the Newman-Keuls post hoc analysis as appropriate. Sta-
tistical significance was defined as P ? .05.
FIG. 3. Effect of AII treatment on LOX-1 protein expression. The VSMC were treated with AII for 15 min. A) Western blot performed with a
polyclonal antibody (1:1000). B) Densitometric analysis based on three separate experiments (mean ? SEM). Abbreviations as in Figs. 1 and 2.
302
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 5

Results
Effect of AII on LOX-1 and
ox-LDL degradation
Using specific oligonucleotides (Table 1), mRNA for
LOX-1, human platelet type 12-LO the long form20and
15-LO type II were consistently detected in VSMC (Fig.
1). After 1 h of incubation with AII (10?7mol/L), mRNA
expression of LOX-1 increased significantly (P ? .0001)
as shown by the housekeeping gene–normalized densito-
metric analyses in Figs. 2A and 2B. Furthermore, the
AII-induced increase in LOX-1 mRNA expression was
blocked by losartan (10?5mol/L), a specific AT1 receptor
blocker and also by baicalein (10?5mol/L), a specific
12-LO blocker (Fig. 2B).
The effect of AII (10?7mol/L) on of LOX-1 protein
expression is depicted in Fig. 3. There was a threefold
increase in of LOX-1 protein expression, which can be
seen in the Western immunoblot of one of the experiments
(Fig. 3A) and in the overall densitometric analysis (n ? 3;
Fig. 3B) (P ? .001).
Treatment of cultured VSMC with AII (10?7mol/L)
for 24 h increased the rate of degradation of radioiodine-
labeled ox-LDL by ?60% (Fig. 4). This effect was inhib-
ited in the presence of the AT1R antagonist losartan (10?5
mol/L).
Effect of AII on Human Platelet
Type 12-LO and 15-LO Type II
Treatment with AII for 1 h significantly increased the
mRNA expression of human platelet type 12-LO and
15-LO type II in VSMC, which was blocked by both
losartan (10?5mol/L) and baicalein (10?5mol/L) (Figs.
5A to 5D). When cultured VSMC were exposed to AII
(10?7mol/L) for 10 min, the release of 12-HETE in-
creased by threefold (Fig. 6A) and the release of 15-HETE
increased by 50% (Fig. 6B).
Discussion
A member of a family of receptors for ox-LDL, LOX-1
has been initially identified in endothelial cells in which
it supports the binding, internalization, and degradation
of ox-LDL.15,16The receptor LOX-1 may play a role
both in the initiation and the progression of atheroscle-
rosis, as it is expressed both in the initial phases of
plaque formation and in established human atheroma-
tous lesions.25–27Activation of LOX-1 leads to the
generation of reactive oxygen species, a decrease in the
release of NO from endothelial cells, and increased
expression of endothelin-1, AT1R, and cell adhesion
molecules,28all of which contribute to both hyperten-
sion and vascular damage. In endothelial cells, LOX-1
expression is subject to regulation by tumor necrosis
factor–? (TNF-?), shear stress, lipopolysaccharide
(LPS), ox-LDL, and AII.29,30–33Although LOX-1 is
apparently expressed in human VSMC also, hyperten-
sion and high cholesterol34,35are currently the only
recognized endogenous factors that appear to regulate
its expression in these cells.
In this study, we provide direct evidence that, in a
cell line of VSMC derived from normal human aortic
smooth muscle cells, AII upregulates LOX-1 expression
in association with increased VSMC degradation of
ox-LDL and stimulation of platelet type 12- LO and
15-LO type II expression and activity. That AII in-
0
1000
2000
3000
4000
5000
6000
7000
Ox-LDL Cellular degradation(ng/mg protein)
Control AII 10-7mol/L Los 10-5mol/L AII 10-7mol/L+
Los 10-5mol/L
**
##
FIG. 4. Effect of AII and losartan on ox-LDL degradation by VSMC. A quantity (10 mg of protein/mL) of Ox-125I-LDL was incubated with
cultured cells at 37°C for 5 h. Lipoproteins degradation was measured as described in Methods. **P ? .001 v control; ##P ? .001 v
AII-treated cells. Abbreviations as in Figs. 1 and 2.
303
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 6

creases 12-LO expression in this line of human VSMC
is consistent with previous reports.36To our knowledge,
however, this is the first evidence that 15-LO type II is
expressed in human vascular cells and is upregulated by
AII. Kim et al identified a leukocyte form of 12-LO in
human aortic VSMC36and this isoform is known to
generate 15- and 12-HETE. In previous studies, we
were unable to identify 15-LO mRNA type I expression
in human umbilical artery smooth muscle cells.20In
contrast, we have now used primers designed to identify
type II 15-LO and have observed AII-inducible expres-
sion of this isoform. Furthermore, 12- and 15-LO
mRNA were induced within 1 h of exposure to AII,
which resembles the early effect of AII on classical
“immediate response genes” such as c-fos, c-myc, and
c-jun as well as on recently identified growth-related
peptides such as the angiogenic factor CYR6137and the
connective tissue growth factor CTGF.38
In a previous report, the AT1R antagonist losartan
was found to reduce LOX-1 expression in aortic neo-
intimal cells of hyperchlesterolemic rabbits,34thus in-
directly suggesting that AII may be involved in
increased LOX-1 expression in proliferating VSMC
comprising atheromatous lesions. The observation that
the AT1R antagonist losartan blocked AII-induced
LOX-1 in our study and reduced LOX-1 expression in
modified (neointimal) VSMC of hypercholestrolemic
rabbits34suggest that AII may be an inducer of LOX-1
expression in VSMC in vivo. Furthermore, taken to-
gether with our results, observations that losartan inhib-
its cellular uptake of ox-LDL by macrophages from
hypercholesterolemic patients39are consistent with the
concept that AII affects ox-LDL trafficking at least in
part via modulation of LOX-1 expression in humans in
vivo.
The finding that the specific 12-LO inhibitor baica-
lein blocked AII-induced LOX-1 expression is in accor-
dance with previous reports that the 12-LO pathway is
important for AII-dependent signal transduction. We
have previously reported that several structurally unre-
lated LO inhibitors block AII-induced vasoconstriction
and AII-dependent calcium transients.6,40–42In the
present study, we observed a rapid increase in genera-
tion of 12- and 15-HETE after 10 min of exposure to
AII, consistent with rapid activation of LO enzymes.
The finding that AII-induced LOX-1 mRNA expression
FIG. 5. Effect of AII (10?7 mol/L) alone and AII in the presence of losartan (10?5mol/L) or baicalein (10?7mol/L) on human platelet
12-lipoxygenase (12-LO) and 15-LO type II mRNA expression. A) mRNA expression of 12-LO in control (lanes 1 to 3) and AII-treated cells
(lanes 4 to 6). Lower panel: cyclophyllin mRNA expression in the same culture extracts. B) Densitometric analysis of 12-LO mRNA
expression (corrected by cyclophyllin mRNA expression) in control, AII-, AII ? baicalein–, and AII ? losartan–treated VSMC. Results are
expressed in arbitrary units relative to control incubates. **P ? .001 v control; #P ? .05 v AII. C) 15-LO mRNA expression in control (lanes
1 to 3) and AII-treated cells (lanes 4 to 6). Lower panel: cyclophyllin mRNA expression in the same culture extracts. D) Densitometric
analysis of 15-LO mRNA expression (corrected by cyclophyllin mRNA expression) in control, AII-, AII ? baicalein–, and AII ? losartan–treated
VSMC. Results are expressed in arbitrary units relative to control incubates. ***P ? .0001 v control; ###P ? .0001 v AII. Abbreviations as
in Figs. 1 and 2.
304
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 7

was blocked by the LO inhibitor baicalein suggests that
these rapidly generated eicosanoid products may have a
role in downstream signaling, which eventually leads to
increased LOX-1 expression.
In addition to the rapid AII-dependent induction of
12- and 15-HETE generation, longer exposure to AII
also increased mRNA expression of human platelet type
12-LO and 15-LO type II 2. Because LO enzymes
(particularly 15-LO) comprise a key mechanism by
which LDL can be oxidized in vivo, our results are
compatible with the function of AII-driven machinery
for ox-LDL trafficking and generation in human VSMC.
On one hand, AII increases LOX-1 expression, which
facilitates the uptake of extracellular ox-LDL into
VSMC. Our finding that AII increases cell-dependent
ox-LDL degradation supports this notion, as it indicates
that more ox-LDL was taken up by the cells after AII
treatment, presumably secondary to enhanced LOX-1
expression. On the other hand, AII induces increases in
the activity and expression of human platelet type
12-LO and 15-LO type II 2, thus providing a pathway
by which native LDL taken up by VSMC can be oxi-
dized by either juxta- or intracellular means.
The evidence that hypertension, hypercholesterol-
emia, and AII are each linked to increased LOX-1
expression in VSMC provides an additional pathway by
which hypertension and the renin-angiotensin system
may contribute to atherogenesis. An AII-dependent
concomitant acceleration of ox-LDL uptake and LDL
oxidation, as shown in the present report, may acceler-
ate transformation of VSMC into foam cells and thus
contribute to plaque instability.43As hypertension per
FIG. 6. Effect of AII treatment on the release of 12- and 15-HETE. The VSMC were treated with AII (10?7mol/L) for 10 min. The reaction
was stopped with cold ethanol, and 12- and 15-HETE were extracted and measured as described in Methods. Results are expressed as means
? SEM of three separate experiments. A) 12-HETE release; *P ? .05. B) 15-HETE release; *P ? .05. Abbreviations as in Figs. 1 and 2.
305
AJH–March 2005–VOL. 18, NO. 3LOX-1 REGULATION BY ANGIOTENSIN II

Page 8

se also increases LOX-1 expression but not LO en-
zymes,44the relative contribution of high blood pres-
sure and AII to LOX-1–related alterations in VSMC
comprising the arterial wall remains subject to further
investigation.
References
1.O’Brien KD, Shavelle DM, Caulfield MT, McDonald TO, Olin-
Lewis K, Otto CM, Probstfield JL: Association of angiotensin-
converting enzyme with low-density lipoprotein in aortic
valvular lesions and in human plasma. Circulation 2002;106:
2224–2230.
Figueroa JE, Vijayagopal P: Angiotensin II stimulates synthesis of
vascular smooth muscle cell proteoglycans with enhanced low den-
sity lipoprotein binding properties. Atherosclerosis 2002;162:261–
268.
Timmermaans PB, Smith RD: Angiotensin II receptor subtypes:
selective antagonists and functional correlates. Eur Heart J 1994;
15:79–87.
Nickenig G, Bohm M: Regulation of the angiotensin ATR1 receptor
expression by hypercholesterolemia. Eur J Med Res 1997;2:285–
289.
Li D, Saldeen T, Romeo F, Mehta JL: Oxidized LDL upregulates
angiotensin II type 1 receptor expression in cultured human coro-
nary artery endothelial cells: the potential role of transcription factor
NF-kappaB. Circulation 2000;102:1970–1976.
Stern N, Golub M, Nozawa K, Berger M, Knoll E, Yanagawa N,
Natarajan R, Nadler JL, Tuck ML: Selective inhibition of angioten-
sin II-mediated vasoconstriction by lipoxygenase blockade. Am J
Physiol 1989;257:H434–H443.
Nakao J, Ito H, Chang WC, Koshihara Y, Murota S: Aortic smooth
muscle cell migration caused by platelet-derived growth factor is
mediated by lipoxygenase product(s) of arachidonic acid. Biochem
Biophys Res Commun 1983;112:866–871.
Nishio E, Watanabe Y: Role of the lipoxygenase pathway in phen-
ylephrine-induced vascular smooth muscle cell proliferation and
migration. Eur J Pharmacol 1997;336(2–3):267–273.
Steinberg D, Parthasaranthy S, Carew TE, Witztum JL: Beyond
cholesterol: modification of low-density lipoprotein that increases
its atherogenicity. N Engl J Med 1989;320:915–924.
10. Scheidegger KJ, Butler S, Witztum JL: Angiotensin II increases
macrophage-mediated modification of low density lipoprotein via a
lipoxygenase-dependent pathway. J Biol Chem 1997;272:21609–
21615.
11. Kuhn H, Chan L: The role of 15-lipoxygenase in atherogenesis: pro-
and antiatherogenic actions. Curr Opin Lipidol 1997;8:111–117.
12. Yla-Herttuala S, Palinski W, Rosenfeld ME, Parthasarathy S,
Carew TE, Butler S, Witztum JL, Steinberg D: Evidence for the
presence of oxidatively modified low density lipoprotein in ath-
erosclerotic lesion of rabbit and man. J Clin Invest 1989;84:
1086–1095.
13. Chin JH, Azhar S, Hoffman BB: Inactivation of endothelium-de-
rived relaxing factor by oxidized lipoproteins. J Clin Invest 1992;
89:10–18.
14. Kugiyama K, Kerns SA, Morrisett JD: Impairment of endothelium-
dependent arterial relaxation by lysolecithin in modified low-density
lipoproteins. Nature 1990;344:160–162.
15. Nishio E, Watanabe Y: Oxidized LDL induces apoptosis in cultured
smooth muscle cells: a possible role for 7-ketocholesterol. Biochem
Biophys Res Commun 1996;223:413–418.
16. Li DY, Yang BC, Metha JL: Oxidized low-density lipoprotein
induces apoptosis in cultured human coronary artery endothelial
cells: role of PKC, PTK, bcl-2 and Fas. Am J Physiol 1998;275:
H568–H576.
17. Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H,
2.
3.
4.
5.
6.
7.
8.
9.
Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T, Masaki T: An
endothelial receptor for oxidized low-density lipoprotein. Nature
1997;386:73–77.
18. Kakutani M, Masaki T, Sawamura T: A platelet-endothelium inter-
action mediated by lectin-like oxidized low-density lipoprotein re-
ceptor-1. Proc Natl Acad Sci USA 2000;97:360–364.
19. Jialal I, Devaraj S: The role of oxidized low density lipoprotein in
atherogenesis. J Nutr 1996;126:1053S–1057S.
20. Limor R, Weisinger G, Gilad S, Knoll E, Sharon O, Jaffe A, Kohen
F, Berger E, Lifchizt-Mercer B, Stern N: A novel form of platelet-
type 12-lipoxygenase mRNA in human vascular smooth muscle
cells. Hypertension 2001;38:864–871.
21. Sambrook J, Fritsh EF, Maniatis T: Molecular Cloning: A Labora-
tory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, 1989, pp 18.60–18.75.
22. Eskra JD, Pereira MJ, Ernest MJ: Solid-phase extraction and high-
performance liquid chromatography analysis of lipoxygenase path-
way products. Anal Biochem 1986;154:323–337.
23. Bilheimer DW, Eisenberg S, Levy RI: The metabolism of very low
density lipoprotein proteins. I. Preliminary in vitro and in vivo
observations. Biochim Biophys Acta 1972;260:212–221.
24. Bierman EL, Stein O, Stein Y: Lipoprotein uptake and metabolism
by rat aortic smooth muscle cells in tissue culture. Circ Res 1974;
35:136–150.
25. Chen M, Kakutani M, Minami M, Kataoka H, Kume N, Narumiya
S, Kita T, Masaki T, Sawamura T: Increased expression of
lectin-like oxidized low density lipoprotein receptor-1 in initial
atherosclerotic lesions of Watanabe heritable hyperlipidemic rab-
bits. Arterioscler Thromb Vasc Biol 2000;20:1107–1115.
26. Yoshida H, Kondratenko N, Green S, Steinberg D, Quehenberger O:
Indentification of the lectin-like receptor for oxidized low-density
lipoprotein in human macrophages and its potential role as a scav-
enger receptor. Biochem J 1998;334:9–53.
27. Katakoka H, Kume N, Miyamoto S, Miniami M, Moriwaki H,
Murase T, Sawamura T, Masaki T, Hishimoto N, Kita T: Expression
of lectin oxidized low-density lipoprotein receptor-1 in human ath-
erosclerosis lesions. Circulation 1999;99:3110–3117.
28. Sakurai K, Sawamura T: Stress and vascular responses: endothelial
dysfunction via lectin-like oxidized low-density lipoprotein recep-
tor-1: close relationships with oxidative stress. J Pharmacol Sci
2003;91:182–186.
29. Murase T, Kume N, Korenga R, Ando J, Sawamura T, Masaki T,
Kita T: Fluid shear stress transcriptionally induces lectin-like oxi-
dized LDL receptor-1 in vascular endothelial cells. Circ Res 1998;
83:328–333.
30. Kume N, Murase T, Moiwaki H, Aoyama T, Sawamura T, Masaki
T, Kita T: Inducible expression of lectin-like oxidized LDL recep-
tor-1 in vascular endothelial cells. Circ Res 1998;83:322–327.
31. Li DY, Zhang C, Philips MI, Sawamura T, Mehta JL: Upregulation
of endothelial receptor for oxidized low-density lipoprotein
(LOX-1) in cultured human coronary artery endothelial cells by
angiotensin II type 1 receptor activation. Circ Res 1999;84:1043–
1049.
32. Zhang L, Huang YW, Yao HP: Angiotensin II increases the expres-
sion of lectin-like oxidized LDL receptor-1 in cultured human
umbilical vein endothelial cells. Zhejiang Da Xue Xue Bao Yi Xue
Ban 2002;31:326–330.
33. Morawietz H, Rueckschloss U, Niemann B, Duerrschmidt N, Galle
J, Hakim K, Zerkowski HR, Sawamura T, Holtz J: Angiotensin II
induces LOX-1, in human endothelial receptor for oxidized LDL.
Circulation 1999;100:899–902.
34. Chen H, Li D, Sawamura T, Inoue K, Mehta JL: Upregulation of
LOX-1 expression in aorta of hypercholesterolemic rabbits: modu-
lation by losartan. Biochem Biophys Res Commun 2000;276:1100–
1114.
306
AJH–March 2005–VOL. 18, NO. 3 LOX-1 REGULATION BY ANGIOTENSIN II

Page 9

35. Nagase M, Hirose S, Fujita T: Unique repetitive sequence and
unexpected regulation of expression of rat endothelial receptor for
oxidized low-density lipoprotein (LOX-1). Biochem J 1998;330:
1417–1422.
36. Kim JA, Gu JL, Natarajan R, Berliner JA, Nadler JL: A leukocyte
type of 12-lipoxygenase is expressed in human vascular and mono-
nuclear cells. Evidence for upregulation by angiotensin II. Arterio-
scler Thromb Vasc Biol 1995;15:942–948.
37. Hilfiker A, Hilfiker-Kleiner D, Fuchs M, Kaminski K, Lichten-
berg A, Rothkotter HJ, Schieffer B, Drexler H: Expression of
CYR61, an angiogenic immediate early gene, in arteriosclerosis
and its regulation by angiotensin II. Circulation 2002;106:254–
260.
38. Ruperez M, Lorenzo O, Blanco-Colio LM, Esteban V, Egido J,
Ruiz-Ortega M: Connective tissue growth factor is a mediator of
angiotensin II-induced fibrosis. Circulation 2003;108:1499–1505.
39. Hayek T, Aviram M, Heinrich R, Sakhnini E, Keidar S: Losartan
inhibits cellular uptake of oxidized LDL by monocyte-macrophages
from hypercholesterolemic patients. Biochem Biophys Res Com-
mun 2000;273:417–420.
40. Saito F, Hori MT, Ideguchi Y, Berger M, Golub M, Stern N, Tuck
ML: 12-Lipoxygenase products modulate calcium signals in vascu-
lar smooth muscle cells. Hypertension 1992;20:138–143.
41. Kisch E, Jaffe A, Knoll E, Stern N: Role of the lipoxygenase
pathway in angiotensin II-induced vasoconstriction in the human
placenta. Hypertension 1997;29:796–801.
42. Stern N, Yanagawa N, Saito F, Hori M, Natarajan R, Nadler J, Tuck
M: Potential role of 12 hydroxyeicosatetraenoic acid in angiotensin
II-induced calcium signal in rat glomerulosa cells. Endocrinology
1993;133:843–847.
43. Kataoka H, Kume N, Miyamoto S, Minami M, Morimoto M,
Hayashida K, Hashimoto N, Kita T: Oxidized LDL modulates
Bax/Bcl-2 through the lectin like Ox-LDL receptor-1 in vascular
smooth muscle cells. Arterioscler Thromb Vasc Biol 2001;21:955–
960.
44. Nozawa K, Tuck ML, Eggena P, Golub M, Nadler JL, Natarajan R,
Stern N: Inhibition of the lipoxygenase pathway reduces blood
pressure in renovascular hypertensive rats. Am J Physiol 1990;259:
H1774–1780.
307
AJH–March 2005–VOL. 18, NO. 3 LOX-1 REGULATION BY ANGIOTENSIN II