Cre/lox-regulated transgenic zebrafish model with conditional myc-induced T cell acute lymphoblastic leukemia.

Abstract

We have created a stable transgenic rag2-EGFP-mMyc zebrafish line that develops GFP-labeled T cell acute lymphoblastic leukemia (T-ALL), allowing visualization of the onset and spread of this disease. Here, we show that leukemias from this transgenic line are highly penetrant and render animals moribund by 80.7 +/- 17.6 days of life (+/-1 SD, range = 50-158 days). These T cell leukemias are clonally aneuploid, can be transplanted into irradiated recipient fish, and express the zebrafish orthologues of the human T-ALL oncogenes tal1/scl and lmo2, thus providing an animal model for the most prevalent molecular subgroup of human T-ALL. Because T-ALL develops very rapidly in rag2-EGFP-mMyc transgenic fish (in which "mMyc" represents mouse c-Myc), this line can only be maintained by in vitro fertilization. Thus, we have created a conditional transgene in which the EGFP-mMyc oncogene is preceded by a loxed dsRED2 gene and have generated stable rag2-loxP-dsRED2-loxP-EGFP-mMyc transgenic zebrafish lines, which have red fluorescent thymocytes and do not develop leukemia. Transgenic progeny from one of these lines can be induced to develop T-ALL by injecting Cre RNA into one-cell-stage embryos, demonstrating the utility of the Cre/lox system in the zebrafish and providing an essential step in preparing this model for chemical and genetic screens designed to identify modifiers of Myc-induced T-ALL.

Full text

Page 1

Cre?lox-regulated transgenic zebrafish model
with conditional myc-induced T cell acute
lymphoblastic leukemia
David M. Langenau*†, Hui Feng*, Stephane Berghmans*, John P. Kanki*, Jeffery L. Kutok‡, and A. Thomas Look*§
*Department of Pediatric Oncology, Dana–Farber Cancer Institute, Harvard Medical School, Boston, MA 02115;†Department of Hematology?Oncology,
Children’s Hospital, Boston, MA 02115; and‡Department of Pathology, Brigham and Women’s Hospital, Boston, MA 02115
Edited by Max D. Cooper, University of Alabama at Birmingham, Birmingham, AL, and approved March 15, 2005 (received for review November 22, 2004)
We have created a stable transgenic rag2-EGFP-mMyc zebrafish
line that develops GFP-labeled T cell acute lymphoblastic leukemia
(T-ALL), allowing visualization of the onset and spread of this
disease.Here,weshowthatleukemiasfromthistransgeniclineare
highly penetrant and render animals moribund by 80.7 ? 17.6 days
of life (?1 SD, range ? 50–158 days). These T cell leukemias are
clonally aneuploid, can be transplanted into irradiated recipient
fish, and express the zebrafish orthologues of the human T-ALL
oncogenes tal1?scl and lmo2, thus providing an animal model for
the most prevalent molecular subgroup of human T-ALL. Because
T-ALL develops very rapidly in rag2-EGFP-mMyc transgenic fish (in
which ‘‘mMyc’’ represents mouse c-Myc), this line can only be
maintained by in vitro fertilization. Thus, we have created a
conditional transgene in which the EGFP-mMyc oncogene is pre-
ceded by a loxed dsRED2 gene and have generated stable rag2-
loxP-dsRED2-loxP-EGFP-mMyc transgenic zebrafish lines, which
have red fluorescent thymocytes and do not develop leukemia.
Transgenic progeny from one of these lines can be induced to
develop T-ALL by injecting Cre RNA into one-cell-stage embryos,
demonstrating the utility of the Cre?lox system in the zebrafish
and providing an essential step in preparing this model for chem-
ical and genetic screens designed to identify modifiers of Myc-
induced T-ALL.
lymphoma ? tal1?scl ? lmo2
T
cells acquire mutations that cause differentiation arrest, rapid
proliferation, and suppression of apoptosis within developing T
lymphocytes (1). Our current understanding of the molecular basis
of T cell malignancies has emerged largely from the analysis of
recurrent chromosomal translocations, which typically juxtapose T
cell oncogenes with strong promoter elements responsible for high
expressionlevelsoftheTcellreceptor(2,3).TheseTcelloncogenes
encode transcription factors, including (i) basic helix–loop–helix
(bHLH) family members such as TAL1?SCL, TAL2, LYL1, and
BHLHB1, (ii) LIM-only (LMO) domain genes such as LMO1 and
LMO2, and (iii) the orphan homeobox genes HOX11?TLX1 and
HOX11L2?TLX3 (3–5). Up-regulation of T-ALL oncogene tran-
scription factors can also occur in the absence of chromosomal
translocations(6–8),presumablyduetomutationsthatcauseeither
monoallelicactivation,throughcis-actingmutationsordeletions,or
biallelic activation, from the disruption of upstream factors that
normally suppress the expression of these genes in developing
thymoctyes (8).
In human T-ALL, we have identified five distinct multistep
molecular pathways based on the overexpression of (i) TAL1?SCL
plus LMO1 or LMO2, (ii) LYL1 plus LMO2, (iii) HOX11, (iv)
HOX11L2, and (v) MLL-ENL (1, 9), each of which is characterized
by distinct molecular signatures (1, 10, 11). These subgroups are
clinically relevant, with event-free survival differing among patient
groups (1, 11, 12). For example, patients expressing both TAL1?
SCL or LYL1 and a LMO family member (LMO1 or LMO2) have
cell lineage acute lymphoblastic leukemia (T-ALL) is an
aggressive hematologic malignancy arising when immature T
a worse prognosis than those expressing HOX11 (1, 11, 12).
Activation of these T cell oncogenes appears to be critical for
thymocyte transformation, possibly by causing stage-specific arrest
of T cell maturation (1). However, additional mutations are also
found in leukemic cells from patients in each of the major sub-
groups, including those that affect pathways that control apoptosis,
proliferation, and genomic instability. Recently, we have identified
activating mutations in NOTCH1 that result in increased NOTCH
signaling and increased proliferation of developing thymocytes
(13). In addition, four of five subgroups of human T-ALL express
high levels of either MYC or MYCN (1), suggesting that MYC may
be a central regulator of proliferation and?or genomic instability in
this malignancy. Finally, most human T-ALLs biallelically delete
the CDKN2A locus, which encodes both the p16(INK4A) and
p14(ARF) tumor suppressors, thereby disrupting both the RB and
p53pathwaysandcontributingtoaberrantcontrolofbothcellcycle
progression and programmed cell death (1, 14).
The zebrafish has recently emerged as an important vertebrate
modelofMyc-inducedT-ALL(15);however,studieshavenotbeen
performed to assess how closely zebrafish T-ALL mimics the
human disease. In addition, the promise of the zebrafish T-ALL
model lies in its utility for chemical (16–18) and genetic modifier
screens (19–21), marking the emergence of the zebrafish as a
unique vertebrate model with which to identify enhancers that
accelerate disease or suppressors that curb tumor growth. Here, we
showthattransgenicrag2-EGFP-mMyczebrafish(inwhich‘‘mMyc’’
represents mouse c-Myc) develop T-ALLs that faithfully model the
most common and most treatment-resistant subtype of human
T-ALL, in which SCL and LMO1?2 are coexpressed. However,
these rag2-EGFP-mMyc transgenic fish are often severely diseased
by the time they reach reproductive maturity, making this line
difficult to breed and maintain. Thus, conditional transgenic ap-
proachesareneededtoestablishzebrafishleukemiamodelsthatare
amenable to forward genetic and small molecule suppressor
screens.Ourcurrentresultsindicatethatthemolecularmechanisms
underlying zebrafish T-ALL are remarkably similar to those found
in the human disease and establish Cre?lox strategies in transgenic
zebrafish that provide a general means to develop conditional
models of cancer for genetic analysis in this model organism.
Materials and Methods
Isolation of lmo1 and p16. RNA was obtained from 1- to 5-day-old
embryos and made into cDNA, and degenerate PCR primers were
used to amplify a fragment of the lmo1 and p16 gene. RACE PCR
was used to isolate the full-length lmo1 (GenBank accession no.
This paper was submitted directly (Track II) to the PNAS office.
Abbreviations: T-ALL, T cell acute lymphoblastic leukemia; mMyc, mouse c-Myc; LMO,
LIM-only; TCR, T cell receptor.
Data deposition: The sequence reported in this paper has been deposited in the GenBank
database (accession no. AF398514).
§To whom correspondence should be addressed. E-mail: thomas?look@dfci.harvard.edu.
© 2005 by The National Academy of Sciences of the USA
6068–6073 ?
PNAS ?
April 26, 2005 ?
vol. 102 ?
no. 17www.pnas.org?cgi?doi?10.1073?pnas.0408708102

Page 2

AF398514). By contrast, the p16 sequence fragment was used to
search the zebrafish genome (www.sanger.ac.uk?Projects?D?rerio)
andidentifyaputativefull-lengthORFforthep16locus(R.Stewart
and A.T.L., unpublished data).
Penetrance of Disease in rag2-EGFP-mMyc Stable Transgenic Ze-
brafish. Stable transgenic rag2-EGFP-mMyc fish have been gener-
ated previously and develop GFP-labeled T-ALL (15). To deter-
mine the penetrance of disease in stable transgenic rag2-EGFP-
mMyc fish, sperm was harvested from 10- to 20-week-old leukemic
male fish and used for in vitro fertilization of AB WT eggs. The
resulting progeny were scored for leukemia onset at 30–60 days of
lifeasdeterminedbyinfiltrationofGFP-labeledleukemiccellsinto
sites adjacent to the thymus. At 3 months of age, nonleukemic
sibling fish were analyzed for the presence of the mMyc transgene
as determined by PCR of genomic DNA isolated from the tail fin
as described in ref. 15.
Collection of Leukemias and Determination of DNA Content. Leuke-
mic rag2-EGFP-mMyc fish were killed, and the heads were fixed in
4% paraformaldehyde, embedded in paraffin, and sectioned. The
remaining portion of fish was diced over 5 ml of ice-cold 0.9 ? PBS
plus 5% FBS. The suspension was filtered over a 40-?m filter,
washed, and subsequently (i) transplanted into irradiated recipient
fish (1 ? 106cells per fish, 2–3 days after receiving 23 Gy of total
body irradiation from a137Cs source), (ii) analyzed for DNA
content as determined by DNA flow cytometry, (iii) frozen in 10
million-cell aliquots, and?or (iv) analyzed by FACS to determine
the percentage of GFP-labeled leukemic cells contained within
each sample. DNA flow cytometric analysis was completed essen-
tially as described in ref. 15. Specifically, tumor cells and WT
nucleated red blood cells were stained with propidium iodide in
hypotonic sodium-citrate buffer and analyzed for cellular DNA
content by flow cytometry alone and as a mixture with normal
control cells.
RT-PCR Analysis. RNA was isolated (with TRIzol, GIBCO?BRL)
from leukemia cells and control FACS-sorted, GFP-positive thy-
mocytes from rag2-GFP and lck-GFP transgenic fish (15, 22, 23).
RNA was treated with DNaseI before reverse transcription, and
RT-PCR was performed. (PCR primers and thermocycling condi-
tions are described in detail in the Supporting Text and Table 1,
which are published as supporting information on the PNAS web
site.)
To confirm that expression of the scl and lmo2 transcripts was
confined to the leukemic lymphoblasts, RNA in situ hybridization
was completed on paraffin-embedded sections from transgenic
rag2-EGFP-mMyc fish essentially as described in refs. 15 and 22.
PCR primers used to generate probes for in situ hybridization
analysis are described in the Supporting Text.
To determine whether scl and lmo2 expression resulted from
transcription of one or both alleles, PCR was used to amplify the 3?
untranslated regions of scl and lmo2 (Table 1). PCR products were
purified (QIAquick PCR Purification Kit, Qiagen, Valencia, CA)
andsequenced.cDNAwasobtainedfromzebrafishT-ALLsamples
having polymorphic alleles for either scl or lmo2 and subjected to
PCR. PCR fragments were purified and sequenced.
Southern Blot Analysis to Determine Clonality and to Assess Loss of
the p16 Locus.Southernblotanalysiswasusedtodeterminewhether
leukemia cells have T cell receptor (TCR)-? or IgM receptor
rearrangements and whether the p16 genomic locus is lost. South-
ern blot analysis was performed as described in refs. 15 and 24.
Sequencing of the p53 Locus. Genomic DNA was isolated from
zebrafish leukemic samples and subjected to PCR amplification of
exons 4–9 of the zebrafish p53 gene. Fragments were purified and
sequenced as described in ref. 25 and Table 1.
Cre?lox Strategies. To verify that Cre?lox-mediated strategies work
inthezebrafish,anexpressionvectorwascreatedthatcontainsloxP
sites flanking the dsRED2 transgene and the polyadenylation site
contained within the dsRED2-N1 vector (Clontech). The loxed
dsRED2transgenewasclonedintotheEGFP-N1expressionvector
upstream of the EGFP ORF (Fig. 3A). One-cell-stage embryos
were injected with either the CMV-loxP-dsRED2-loxP-EGFP plas-
mid (50 ng??l) alone or in combination with Cre RNA (25 ng??l).
Cre RNA was made by in vitro transcription by using the pCS2?Cre
vector and SP6 RNA polymerase. Transiently injected embryos
were analyzed 26 h postfertilization for GFP and dsRED2 expres-
sion as determined by fluorescent microscopy.
Developing Conditional Transgenic Zebrafish. The loxed dsRED2
coding sequence was cloned into the rag2-EGFP-mMyc plasmid
upstreamoftheEGFP-mMyctransgenebyusingBamHIrestriction
enzyme sites (Fig. 4A). The resulting rag2-loxP-dsRED2-loxP-
EGFP-mMyc plasmid was linearized with XhoI, phenol?
chloroform-extracted, and ethanol-precipitated. Linearized DNA
wasinjectedintoone-cell-stageABstrainembryos[100ng??lDNA
in0.5?TEbuffer(10mMTris?1mMEDTA,pH?7.0)containing
100 mM KCl. Primary injected adult fish were screened for the
ability to produce offspring that contained the transgene as deter-
mined by detection of dsRED2 fluorescence within developing
thymocytes at 6 days postfertilization. Two stable transgenic rag2-
loxP-dsRED2-loxP-EGFP-mMyc zebrafish lines were identified
(lines G7 and G16, AB strain). F1 and F2 rag2-loxP-dsRED2-loxP-
EGFP-mMyc transgenic fish were injected with 25 ng??l Cre RNA
and analyzed for leukemia onset.
AnalysisofLeukemiasfromCre-Injectedrag2-loxP-dsRED2-loxP-EGFP-
mMyc Fish. Leukemic cells from Cre-injected stable transgenic
rag2-loxP-dsRED2-loxP-EGFP-mMyc fish were harvested and (i)
transplanted into irradiated adult fish, (ii) analyzed by cytospin and
Giemsa?May–Grunwaldstainingtoconfirmlymphoblastmorphol-
ogy, (iii) subjected to FACS analysis to assess levels of GFP and
dsRED2 expression within lymphoblasts, and?or (iv) extracted for
genomicDNAandanalyzedforCRErecombinationasdetectedby
PCR (forward primer specific to the rag2 promoter region, AT-
GCTAATTTGAAGCACTAGCA; reverse primer specific to the
EGFP coding sequence, GTGCAGATGAACTTCAGGGT).
Results
Complete Penetrance of T-ALL in a rag2-EGFP-mMyc Stable Transgenic
Line. We have previously described a rag2-EGFP-mMyc stable
transgeniczebrafishlineinwhichtheonsetandprogressionofTcell
malignancycanbemonitoredbyfluorescencemicroscopy(15).The
disease is first detected as an expansion of GFP-labeled T cells in
the thymus, and, subsequently, malignant cells infiltrate regions
adjacent to the thymus in a phase comparable to human T cell
lymphoblastic lymphoma. Then, transformed T cells rapidly spread
throughout the skeletal musculature, visceral organs, and kidney
marrow, leading to widely disseminated T-ALL (Fig. 1 and Fig. 4
of ref. 15). In a series of 106 stable transgenic rag2-EGFP-mMyc
fish, all animals developed T-ALL and succumbed to death by
80.7 ? 17.6 days of life (?1 SD, range ? 50–158 days). Sixty-four
nonleukemic siblings were raised until 3 months of age, and none
harbored the mMyc transgene in somatic DNA. Taken together,
these results indicate that Myc-induced leukemias are fully pene-
trant in our rag2-EGFP-mMyc transgenic line.
Myc-Induced Leukemias Are of T Cell Origin and Oligoclonal. Because
rag2 is expressed in both immature T and B cells (22), we wanted
to assess whether leukemias arising in our stable transgenic ze-
brafish were of T cell or B cell origin. Several lines of evidence
indicatedthatalloftheleukemiasarisinginthistransgeniclinewere
of T cell origin. (i) Each malignancy developed as a GFP-labeled
lymphoma in the thymus (n ? 106). (ii) Southern blot analysis
Langenau et al.
PNAS ?
April 26, 2005 ?
vol. 102 ?
no. 17 ?
6069
IMMUNOLOGY

Page 3

showed that Myc-induced leukemias contained oligoclonal TCR-?
gene rearrangements (18 of 36), whereas none of the leukemias
containedIgheavychainreceptorgene(IgM)rearrangements(n?
21; Figs. 6 and 7 and Table 2, which are published as supporting
information on the PNAS web site). (iii) RT-PCR analysis showed
that leukemic lymphoblasts expressed high levels of the T cell-
specific tyrosine kinase gene (lck) (22) (Fig. 2A) and TCR-? (24)
(n ? 30; Table 3, which is published as supporting information on
the PNAS web site).
DNAflowcytometrywasalsousedtodetermineclonalityandto
assess whether leukemias acquired chromosomal abnormalities
during disease progression (Table 2; see also Fig. 8, which is
publishedassupportinginformationonthePNASwebsite).Tenof
63 leukemias analyzed were hyperdiploid, as indicated by clonal
increases in DNA content (range ? 1.01–1.45). Although most of
these leukemias contained monoclonal populations of cells with
increased DNA content (9 of 10), one T-ALL sample contained
two distinct populations of hyperdiploid cells but failed to show
TCR-? gene rearrangement by Southern analysis (Fig. 8B).
Myc-Induced Leukemias Are Transplantable. Transplantation and
propagation of disease into secondary recipients is a hallmark of
cancer,sowetestedwhetherleukemiccellsfromrag2-EGFP-mMyc
fish could be transplanted by i.p. injection into irradiated adult
recipient fish. Lymphoblasts were isolated from primary leukemic
fish, and FACS analysis confirmed that samples were highly en-
riched for leukemic lymphoblasts, containing 93.8 ? 1.4% (?SD)
GFP-labeled leukemic cells (n ? 10). GFP-labeled cells multiplied
and generated leukemia in irradiated recipient fish within 1 month
after injection (n ? 11 independently arising leukemias). These
results are similar to those reported previously for leukemia cells
arising in F0 primary injected fish (15).
Zebrafish Myc-Induced T-ALLs Coexpress both tal1?scl and lmo2.
BecausecMYCexpressionisup-regulatedinthreeoffivemolecular
subgroupsofhumanT-ALL(1,9),includingthosemisexpressing(i)
TAL1?SCL plus LMO1 or LMO2, (ii) HOX11, and (iii) HOX11L2?
TLX3, we predicted that we might observe several distinct molec-
ular subgroups of zebrafish T-ALL. However, RT-PCR (Fig. 2A
and Table 3) and in situ hybridization analyses (Fig. 2 B–E) showed
that all Myc-induced leukemias coexpress tal1?scl and lmo2 (n ?
20)butnotlmo1,hox11,orthezebrafishorthologuesofHOX11L2?
TLX3, tlx3a, or tlx3b (26). By contrast, RT-PCR analysis revealed
that normal thymocytes from lck-GFP and rag2-GFP stable trans-
genic fish express lower levels of scl and similar levels of lmo2 when
compared with Myc-induced T-ALLs (Fig. 2A). Finally, RNA in
situ hybridization of paraffin-embedded sections from 70-day-old
lck-GFPtransgenicanimalsshowedthatsclandlmo2areexpressed
in only a subset of cortical thymocytes (Fig. 2 F–M).
To investigate the mechanisms by which tal1?scl and lmo2 are
overexpressed in zebrafish T-ALL, we asked whether expression
wasmonoallelicorbiallelicatthechromosomallevel.Weidentified
four zebrafish leukemia sample DNAs that harbored polymor-
phisms in the 3? untranslated region of scl and three with polymor-
phismsinthelmo2gene(n?20).RT-PCRanalysisofthesecDNAs
revealed that in each case, scl and lmo2 transcripts were up-
regulated equally from both chromosomal alleles (Table 2; see also
Fig. 9, which is published as supporting information on the PNAS
web site), indicating that expression is biallelic and does not result
from chromosomal translocations or other allele-specific deletions
or mutations.
Apoptotic Pathways in Zebrafish Myc-Induced T-ALL. Myc-induced
transformation in mammals collaborates with mutations that dis-
Fig. 1.
thymic lymphoma, which progresses to T-ALL. Fluorescence microscopic anal-
ysis at 50 days of life showing the thymus of control rag2-GFP transgenic fish
(A) and massive GFP-labeled cellular dissemination of leukemic lymphoblasts
in rag2-EGFP-mMyc transgenic fish (B). Fish are oriented with anterior to the
left and dorsal to the top. Arrowheads mark location of the thymus (T).
Stable transgenic rag2-EGFP-mMyc zebrafish develop GFP-labeled
Fig. 2.
atastageinwhichsclandlmo2arecoexpressed.RT-PCRanalysisofFACS-sorted,GFP-labeledthymocytesfrom70-day-oldtransgeniclck-GFP(lck?)andrag2-GFP
(rag2?) fish or leukemic lymphoblasts isolated from diseased fish (denoted by numbers). RT, reverse transcription reactions; No RT, no reverse transcription
controls. (B–M) RNA in situ hybridization of paraffin-embedded sections confirms that scl and lmo2 are coexpressed in lymphoblasts from rag2-EGFP-mMyc
transgenic fish (shown here infiltrating the skeletal musculature) and that scl and lmo2 are expressed in a subset of thymocytes in 70-day-old, nonleukemic,
lck-GFPtransgeniczebrafish.Imagesarephotographedat400?(B–E),50?(F–I),and200?(J–M).ImagesinJ–Marehigher-magnificationimagesoftherespective
regions in F–I (indicated by the boxed region in F).
Leukemic lymphoblasts express T cell markers and both scl and lmo2. (A) Semiquantitative RT-PCR showing that Myc-induced leukemias are arrested
6070 ?
www.pnas.org?cgi?doi?10.1073?pnas.0408708102Langenau et al.

Page 4

ablecomponentsofthecellularapoptoticmachinery(1,14,27,28).
However, given the rapidity of leukemia onset in our transgenic
model, we questioned whether apoptosis was suppressed in ze-
brafish T-ALL and, if so, whether we could document the mech-
anisms that deregulate cell death in these tumors. Semiquantitative
RT-PCR analysis showed that each of the zebrafish T-ALLs
expressed similar levels of p53, mdm2, bcl-xL, bcl-2, and bax RNAs
(n ? 12; Fig. 2A and Table 3). When compared with thymocyte
controls, Myc-induced T-ALLs expressed higher levels of bcl-xL,
bax,p53,andmdm2;however,bcl-2RNAexpressionwasdecreased,
likelyreflectingthatT-ALLsarearrestedatastageofdevelopment
marked by this gene expression profile (8).
Because human T-ALLs have either biallelic deletions of the
CDKN2A locus (14) or, less frequently, mutational inactivation of
p53 (29, 30), we asked whether zebrafish Myc-induced leukemias
harbor abnormalities in orthologues of these loci. The p16 copy
number was not decreased in these tumors as detected by Southern
blot analysis (n ? 21) (Table 2; see also Fig. 10, which is published
as supporting information on the PNAS web site). Because ?90%
ofmutationsinp53occurwithinexons4–8(theregionthatencodes
the DNA-binding domain) (31, 32), we analyzed zebrafish T-ALL
samples for mutations in p53 in these corresponding exons. We
sequencedgenomicDNAfromzebrafishT-ALLleukemiacellsand
failed to identify any mutations in exons 4–9 of the p53 genomic
locus (n ? 12; Table 2).
Cre?lox Conditional Transgenic Strategies in the Zebrafish. T-ALL
develops in 100% of stable transgenic rag2-EGFP-mMyc fish and
progresses to widespread disease before reproductive maturity,
necessitatingharvestingspermfromdiseasedmalestomaintainthe
transgenic line by in vitro fertilization (IVF) (15). Because IVF
procedures are cumbersome and not amenable to forward genetic
approaches, we sought to develop a conditional transgenic ap-
proach, allowing identification and maintenance of zebrafish lines
that did not develop leukemia until the investigator selectively
induced T cell-specific expression of the Myc oncogene. For this
purpose, we developed Cre?lox-mediated transgenic approaches,
whichhavebeenreportedinmice(33,34)andXenopus(35,36)but
not zebrafish.
We created a vector in which the CMV promoter drives the
ubiquitous expression of a dsRED2 transgene that is followed by
multiple transcription stop sites and flanked by loxP sites. The
EGFP coding sequence was cloned downstream of this cassette
(CMV-loxP-dsRED2-loxP-EGFP vector; Fig. 3A). Transient injec-
tion of the CMV-loxP-dsRED2-loxP-EGFP construct into embryos
without Cre recombinase results in dsRED2 fluorescence and no
EGFP expression (50 ng??l; Fig. 3 C and D). By contrast, coinjec-
tion of the CMV-loxP-dsRED2-loxP-EGFP plasmid (50 ng??l) with
Cre RNA (25 ng??l) resulted in the excision of the dsRED2 allele
and juxtaposition of the EGFP transgene next to the CMV pro-
moter, leading to embryos that express EGFP and no red fluores-
cence (Fig. 3 F and G). Excision was extremely efficient in embryos
injected with 25 ng??l Cre RNA because single cells with red
fluorescence were observed in ?5% of injected zebrafish embryos
(n ? 100).
Applying this strategy to our transgenic models of T cell malig-
nancy, the rag2-EGFP-mMyc transgene was modified by inserting
the loxP-dsRED2-loxP cassette between the rag2 promoter and the
EGFP-mMyc oncogene (Fig. 4A), and two stable transgenic lines
were generated (G7 and G16). In the absence of Cre-mediated
recombination, rag2-loxP-dsRED2-loxP-EGFP-mMyc transgenic
fish exhibited high levels dsRED2 expression in the developing
thymocytes but failed to express the EGFP-mMyc transgene or
developlymphomaorleukemia(Fig.4B).AftertheinjectionofCre
RNA into G7 and G16 one-cell embryos, the dsRED2 allele was
excised in both lines (Fig. 4C); however, only transgenic zebrafish
from the G7 line developed T-ALL. Most leukemias arising in the
G7 line expressed both dsRED2 and EGFP-mMyc (Fig. 4D),
suggesting that Cre recombination was incomplete in embryos
injected with 25 ng??l Cre RNA. Some of the G7 line leukemias
exhibited complete recombination and expressed only the EGFP-
mMyc transgene, indicated by green fluorescence without any
Fig. 3.
Diagram of the CMV-loxP-dsRED2-loxP-EGFP construct. (B–G) One-cell-stage
embryos were injected with the CMV-loxP-dsRED2-loxP-EGFP vector in the
absence of Cre RNA (? Cre RNA) (B–D) or with Cre RNA (? Cre RNA, 25 ng??l)
(E–G). Shown are bright-field (B and E), red fluorescence (dsRED2) (C and F),
and green fluorescence (EGFP) images (D and G) of embryos at 26 h postfer-
tilization. Anterior is to the left, and dorsal is toward the top.
Cre-mediated recombination in transiently injected embryos. (A)
Fig. 4.
EGFP-mMyc fish leads to transgene recombination and rapid onset of Myc-
induced T-ALL. (A) Diagram of rag2-loxP-dsRED2-loxP-EGFP-mMyc construct.
(B) Thymocytes from a 73-day-old rag2-lox-dsRED2-EGFP-mMyc transgenic
fish are red-fluorescent-labeled in the absence of Cre expression. (C) PCR of
genomicDNAisolatedfrombloodcellsofWTcontrolortransgenicrag2-loxP-
dsRED2-loxP-EGFP-mMyc(LDL-EMyc)fish.rag2primersamplifygenomicDNA,
mMyc primers amplify the mMyc transgene, and Lox primers amplify either a
1.7-kb nonrecombined fragment (Lox-NR) or a 0.4-kb fragment, which results
when Cre recombination has occurred (Lox-Rec). (D and E) One-cell-stage
rag2-loxP-dsRED2-loxP-EGFP-mMyc embryos were injected with the Cre RNA
(25ng??l)andgrownto51daysofdevelopment,atwhichtimetheyhadboth
GFP- and dsRED2-labeled (D) or GFP-positive alone (E) leukemias. The same
fish is shown, right (D) and left (E) side. Images are composites of dsRED2 and
GFP fluorescence and bright-field images.
Cre RNA injection into stable transgenic rag2-loxP-dsRED2-loxP-
Langenau et al.
PNAS ?
April 26, 2005 ?
vol. 102 ?
no. 17 ?
6071
IMMUNOLOGY

Page 5

detectable red fluorescence (Fig. 4E). Heterozygous rag2-loxP-
dsRED2-loxP-EGFP-mMycfish(G7line)werebredtoABWTfish
and injected with Cre RNA at the one-cell stage of development.
In total, 12 of 186 CRE-injected progeny developed disease in the
G7 line by 151 ? 61 days (range ? 52–192 days; n ? 5).
T-ALLs in Cre-Injected Fish Are Similar to Those from rag2-EGFP-mMyc
Leukemias. Fluorescent microscopic analysis revealed that rag2-
loxP-dsRED2-loxP-EGFP-mMyc transgenic zebrafish injected with
Cre RNA at the one-cell stage develop thymic leukemias as adults,
indicating that these tumors are of T cell origin. Additionally,
fluorescent leukemia cells can be transplanted into irradiated
recipients (Fig. 5 D and G; n ? 3) and have lymphoblast morphol-
ogy as determined by Giemsa?May–Grunwald staining (Fig. 5 F
and I; n ? 2). Taken together, these results indicate that leukemias
arising in the conditional rag2-loxP-dsRED2-loxP-EGFP-mMyc
transgenic line (G7) are similar to those observed in the rag2-
EGFP-mMyc stable transgenic line.
Discussion
We have previously shown that transgenic zebrafish develop Myc-
inducedTcelllineageleukemia(15);however,adetailedmolecular
characterizationofthesetumorshasnotbeendescribed.Leukemias
developing in rag2-EGFP-mMyc transgenic fish are remarkably
similartothosefoundinhumanpatientswithT-ALL.Forexample,
zebrafish Myc-induced T-ALLs arise after a defined latency period
and have clonal TCR-? gene rearrangements, suggesting that
additional mutations are required for malignant transformation of
the T cell. Additionally, these zebrafish T-ALLs coexpress both scl
and lmo2, resembling the most common and most treatment-
resistant molecular subtype of this disease in humans (1, 11). Both
scl and lmo2 are biallelically activated in zebrafish Myc-induced
T-ALL, in a pattern similar to that of a subset of patients who have
overexpression of SCL and LMO2 in leukemic lymphoblasts,
indicating that malignant transformation likely results from the
disruption of upstream regulatory mechanisms that normally turn
off the expression of these transcription factors during double-
negative thymocyte development (8).
Although zebrafish Myc-induced T-ALLs are similar to human
leukemias, there are also key differences. First, zebrafish Myc-
induced T-ALLs resemble only one subclass of human T-ALLs,
those that coexpress SCL and LMO2. Remarkably, we never
observe expression of hox11?tlx1 or the hox11L2?tlx3 family mem-
bers in Myc-induced leukemias in the zebrafish (26). It is possible
that timing of transgene expression during thymocyte development
affects the subtype of T-ALL that is observed. For example, rag2
expressionistightlyregulatedduringTcelldevelopmentandisonly
induced in cells undergoing active TCR-? and TCR-? gene rear-
rangement (37, 38), providing two waves of Myc transgene expres-
sion during thymocyte development. Another possibility is that the
mechanisms that regulate HOX11- and HOX11L2-induced trans-
formationinhumansarenotfoundinthezebrafish.rag2-hox11and
rag2-tlx3 transgenic zebrafish will need to be developed to deter-
mine whether overexpression of a hox11 family member can
synergize with Myc in the genesis of zebrafish T-ALL.
Human and murine leukemias escape cell death by inactivation
of multiple gene products involved in regulating the apoptotic
pathways. For example, leukemias developing in Emu-Myc mice
harbor mutations that curb apoptosis, including the loss of
p19(ARF), mutation of p53, or up-regulation of Mdm2 (27), and
most human T-ALLs have biallelic deletion of the CDKN2A locus,
which encodes the P14(ARF) gene (14). Because of these findings,
we expected to identify abnormalities that down-regulate apoptotic
pathways in our zebrafish leukemias; however, we did not find
variableexpressionlevelsofmdm2,bcl-xL,bcl-2,p53,orbax,nordid
we find deletions in the p16 gene locus or mutations in the p53
DNA-bindingdomain.Thus,weconcludethateithersuppressionof
apoptosis is mediated by a currently unidentified mechanism in
zebrafish T-ALLs or Myc-induced transformation in zebrafish
lymphoid cells does not require an associated mutational inactiva-
tionoftheapoptoticmachinery.Giventhatteleostfishesapparently
lack an ARF gene (39), it is likely that overexpression of myc may
not activate the cell death machinery through the p53 pathway in
zebrafish, as has been documented in mammalian cells (40).
Further experiments using rag2-EGFP-bcl-2 transgenic (41) and
p53-deficient fish (25) will likely resolve whether suppression of
apoptosis is required for malignant transformation of the T cell in
zebrafish.
Leukemias developed in 100% of stable transgenic rag2-EGFP-
mMyc fish, which is optimal for performing genetic screens de-
signed to uncover mutations that enhance or suppress leukemo-
genesis. However, the transgenic rag2-EGFP-mMyc zebrafish line
has been difficult to maintain, because these fish develop disease
beforereachingfullreproductivematurity.Toresolvethisproblem,
we developed conditional transgenic zebrafish by using Cre?lox
technology (33–36). Two transgenic zebrafish lines were identified
Fig.5.
have typical lymphoblast morphology. WT control (A–C) and irradiated WT fish transplanted with lymphoblasts from rag2-loxP-dsRED2-loxP-EGFP-mMyc (D–F)
or rag2-EGFP-mMyc transgenic (G–I) fish. (A, D, and G) Fluorescent microscopic analysis with fish oriented with anterior to the left and dorsal to the top. Images
are a composite of GFP fluorescence and bright-field images. (B, E, and H) FACS analysis based on GFP fluorescence. (C, F, and I) Giemsa?May–Grunwald staining
of blood cells obtained from cytospin analysis. Original images were photographed at 1,000?.
LeukemiasdevelopinginCre-injectedrag2-loxP-dsRED2-loxP-EGFP-mMyctransgenicfisharetransplantable,expresslowlevelsofGFPfluorescence,and
6072 ?
www.pnas.org?cgi?doi?10.1073?pnas.0408708102Langenau et al.

Page 6

that contained the rag2-loxP-dsRED2-loxP-EGFP-mMyc transgene.
In the absence of Cre RNA expression, both lines had strong
expression of dsRED2 within the developing T cells, and no fish
developed disease, indicating that the mMyc oncogene was not
expressed in the absence of Cre recombination. After injection of
Cre RNA into one-cell-stage embryos, both transgenic lines exhib-
ited recombination at the loxP sites; however, only the G7 stable
line produced offspring that developed T-ALL. Lack of leukemia
onset in the second transgenic line (G16) reinforces the need to
developmultipletransgeniclinesandsuggeststhatpositionaleffects
of integration and?or concatamer orientation may significantly
affect Cre-mediated excision and subsequent expression of the
second transgene.
Because only 13% of Cre-injected transgenic fish developed
disease, it is likely that injection of Cre RNA results in suboptimal
recombinationandmosaicactivationoftheEGFP-mMyctransgene
after recombination. This interpretation is supported by the fact
that most leukemias arising in Cre-injected rag2-loxP-dsRED2-loxP-
EGFP-mMyc transgenic fish are both dsRED2- and GFP-labeled,
indicating that leukemic clones had partial Cre-mediated recom-
bination at the locus containing transgene concatamers. Similarly,
individual fish had a leukemic clone that expressed both dsRED2
and GFP arising in one thymus and a second leukemia clone that
expressed only GFP in the other thymus, indicating that Cre
recombination occurs in a mosaic fashion within hematopoietic
progenitorsofindividualfish.Similarresultshavebeenobservedin
Xenopus (36). For example, transient injection of Cre RNA into
stable transgenic frogs harboring a CMV-loxP-ECFP-loxP-EYFP
transgene resulted in mosaic expression of the second ORF.
Furthermore, in some animals, neither blue (ECFP) nor yellow
(EYFP) fluorescence was detected in transgenic frogs after Cre
RNA injection, leading the researchers to conclude that the copy
numberofthereporterhadbeenreducedbyrecombinationwithout
generating an active EYFP expression cassette (36). By contrast,
breeding these CMV-loxP-ECFP-loxP-EYFP transgenic frogs to
stable transgenic Cre-expressing animals resulted in ?100% of
doubly transgenic offspring having homogenous expression of the
secondEYFPORF.Thus,developingtransgeniczebrafishlinesthat
specificallyexpressCreinthedevelopingTcellswilllikelyaidinthe
establishment of more penetrant models of disease.
Although zebrafish models of T-ALL exhibit key differences
when compared with the human disease, analysis of the conserved
mechanisms underlying transformation will likely lead to insights
intothepathogenesisofhumandisease.Forexample,themolecular
mechanisms responsible for regulating biallelic activation of scl and
lmo2 are unknown, and the downstream targets of Myc that are
responsible for oncogenic transformation and genomic instability
have yet to be identified. Because the zebrafish affords the unique
opportunity to perform forward genetic screens, it should be
possible to dissect the pathways that regulate Myc-induced disease
in a genetically tractable vertebrate. The proven feasibility of
Cre?lox-mediated strategies in the zebrafish will aid the develop-
ment of models of leukemia, lymphoma, and other cancers, which
will provide opportunities for both genetic and chemical modifier
screens designed to identify suppressors and enhancers in carcino-
genesis. For example, a dominant modifier genetic screen could be
conducted by breeding N-ethyl-N-nitrosourea-mutagenized fish
with homozygous rag2-loxP-dsRED2-loxP-EGFP-mMyc fish and
then analyzing the progeny for the time of leukemia onset after
CRE recombination and expression of the Myc transgene. Muta-
tions that modify the time of leukemia onset could be either
enhancers that result in more rapid onset of leukemia due to the
inactivationofonealleleofatumorsuppressorgeneorsuppressors
that delay or prevent the onset of Myc-induced transformation.
Finally, use of the Cre?lox technology in the zebrafish will provide
tools for assessing cell lineage commitment and plasticity of stem
cells and generating conditional knockouts in developing embryos.
We thank Y. Yang, N. Campisi, and E. Ronan for expert technical
assistance; L. I. Zon, B. Paw, and B. E. H. Langenau for critical review
ofthemanuscript;andJ.Vinokur,G.Kourkoulis,andW.Saganicforfish
care and husbandry. This work was supported by National Institutes of
Health Grants CA-68484 (to A.T.L.) and CA-06516 (to J.L.K.). D.M.L.
was a National Science Foundation Predoctoral Fellow and is now the
Edmond J. Safra Foundation–Irvington Institute Fellow.
1. Ferrando, A. A., Neuberg, D. S., Staunton, J., Loh, M. L., Huard, C., Raimondi, S. C., Behm,
F. G., Pui, C. H., Downing, J. R., Gilliland, D. G., et al. (2002) Cancer Cell 1, 75–87.
2. Look, A. T. (1997) Science 278, 1059–1064.
3. Ferrando, A. A. & Look, A. T. (2000) Semin. Hematol. 37, 381–395.
4. Bernard,O.A.,Busson-LeConiat,M.,Ballerini,P.,Mauchauffe,M.,DellaValle,V.,Monni,
R., Nguyen Khac, F., Mercher, T., Penard-Lacronique, V., Pasturaud, P., et al. (2001)
Leukemia 15, 1495–1504.
5. Wang, J., Jani-Sait, S. N., Escalon, E. A., Carroll, A. J., de Jong, P. J., Kirsch, I. R. & Aplan,
P. D. (2000) Proc. Natl. Acad. Sci. USA 97, 3497–3502.
6. Kees, U. R., Heerema, N. A., Kumar, R., Watt, P. M., Baker, D. L., La, M. K., Uckun, F. M.
& Sather, H. N. (2003) Leukemia 17, 887–893.
7. Watt, P. M., Kumar, R. & Kees, U. R. (2000) Genes Chromosomes Cancer 29, 371–377.
8. Ferrando, A. A., Herblot, S., Palomero, T., Hansen, M., Hoang, T., Fox, E. A. & Look, A. T.
(2004) Blood 103, 1909–1911.
9. Ferrando, A. A. & Look, A. T. (2003) Semin. Hematol. 40, 274–280.
10. Yeoh, E. J., Ross, M. E., Shurtleff, S. A., Williams, W. K., Patel, D., Mahfouz, R., Behm,
F. G., Raimondi, S. C., Relling, M. V., Patel, A., et al. (2002) Cancer Cell 1, 133–143.
11. Ferrando, A. A., Neuberg, D. S., Dodge, R. K., Paietta, E., Larson, R. A., Wiernik, P. H.,
Rowe, J. M., Caligiuri, M. A., Bloomfield, C. D. & Look, A. T. (2004) Lancet 363,
535–536.
12. Ballerini, P., Blaise, A., Busson-Le Coniat, M., Su, X. Y., Zucman-Rossi, J., Adam, M.,
van den Akker, J., Perot, C., Pellegrino, B., Landman-Parker, J., et al. (2002) Blood 100,
991–997.
13. Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. T., Silverman, L. B., Sanchez-Irizarry,
C., Blacklow, S. C., Look, A. T. & Aster, J. C. (2004) Science 306, 269–271.
14. Okuda, T., Shurtleff, S. A., Valentine, M. B., Raimondi, S. C., Head, D. R., Behm, F.,
Curcio-Brint, A. M., Liu, Q., Pui, C. H. & Sherr, C. J. (1995) Blood 85, 2321–2330.
15. Langenau, D. M., Traver, D., Ferrando, A. A., Kutok, J. L., Aster, J. C., Kanki, J. P., Lin,
S., Prochownik, E., Trede, N. S., Zon, L. I. & Look, A. T. (2003) Science 299, 887–890.
16. Peterson, R. T., Link, B. A., Dowling, J. E. & Schreiber, S. L. (2000) Proc. Natl. Acad. Sci.
USA 97, 12965–12969.
17. Peterson, R. T., Mably, J. D., Chen, J. N. & Fishman, M. C. (2001) Curr. Biol. 11, 1481–1491.
18. Peterson, R. T., Shaw, S. Y., Peterson, T. A., Milan, D. J., Zhong, T. P., Schreiber, S. L.,
MacRae, C. A. & Fishman, M. C. (2004) Nat. Biotechnol. 22, 595–599.
19. Driever, W., Solnica-Krezel, L., Schier, A. F., Neuhauss, S. C., Malicki, J., Stemple, D. L.,
Stainier, D. Y., Zwartkruis, F., Abdelilah, S., Rangini, Z., et al. (1996) Development
(Cambridge, U.K.) 123, 37–46.
20. Haffter, P., Granato, M., Brand, M., Mullins, M. C., Hammerschmidt, M., Kane, D. A.,
Odenthal, J., van Eeden, F. J., Jiang, Y. J., Heisenberg, C. P., et al. (1996) Development
(Cambridge, U.K.) 123, 1–36.
21. Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen, W., Burgess, S.,
Haldi, M., Artzt, K., Farrington, S., et al. (2002) Nat. Genet. 31, 135–140.
22. Langenau, D. M., Ferrando, A. A., Traver, D., Kutok, J. L., Hezel, J. P., Kanki, J. P., Zon,
L. I., Look, A. T. & Trede, N. S. (2004) Proc. Natl. Acad. Sci. USA 101, 7369–7374.
23. Jessen, J. R., Jessen, T. N., Vogel, S. S. & Lin, S. (2001) Genesis 29, 156–162.
24. Haire, R. N., Rast, J. P., Litman, R. T. & Litman, G. W. (2000) Immunogenetics 51, 915–923.
25. Berghmans, S., Murphey, R. D., Wienholds, E., Neuberg, D., Kutok, J. L., Fletcher, C. D.,
Morris, J. P., Liu, T. X., Schulte-Merker, S., Kanki, J. P., et al. (2005) Proc. Natl. Acad. Sci.
USA 102, 407–412.
26. Langenau, D. M., Palomero, T., Kanki, J. P., Ferrando, A. A., Zhou, Y., Zon, L. I. & Look,
A. T. (2002) Mech. Dev. 117, 243–248.
27. Eischen, C. M., Weber, J. D., Roussel, M. F., Sherr, C. J. & Cleveland, J. L. (1999) Genes
Dev. 13, 2658–2669.
28. Yunis, J. J., Frizzera, G., Oken, M. M., McKenna, J., Theologides, A. & Arnesen, M. (1987)
N. Engl. J. Med. 316, 79–84.
29. Diccianni, M. B., Yu, J., Hsiao, M., Mukherjee, S., Shao, L. E. & Yu, A. L. (1994) Blood
84, 3105–3112.
30. Jonveaux, P. & Berger, R. (1991) Leukemia 5, 839–840.
31. Olivier, M., Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C. & Hainaut, P. (2002) Hum.
Mutat. 19, 607–614.
32. Beroud, C. & Soussi, T. (2003) Hum. Mutat. 21, 176–181.
33. Gu, H., Marth, J. D., Orban, P. C., Mossmann, H. & Rajewsky, K. (1994) Science 265,
103–106.
34. Kuhn, R., Schwenk, F., Aguet, M. & Rajewsky, K. (1995) Science 269, 1427–1429.
35. Werdien, D., Peiler, G. & Ryffel, G. U. (2001) Nucleic Acids Res. 29, E53-3.
36. Ryffel, G. U., Werdien, D., Turan, G., Gerhards, A., Goosses, S. & Senkel, S. (2003) Nucleic
Acids Res. 31, e44.
37. Oettinger, M. A., Schatz, D. G., Gorka, C. & Baltimore, D. (1990) Science 248, 1517–1523.
38. Schatz, D. G., Oettinger, M. A. & Baltimore, D. (1989) Cell 59, 1035–1048.
39. Gilley, J. & Fried, M. (2001) Oncogene 20, 7447–7452.
40. Zindy, F., Eischen, C. M., Randle, D. H., Kamijo, T., Cleveland, J. L., Sherr, C. J. & Roussel,
M. F. (1998) Genes Dev. 12, 2424–2433.
41. Langenau, D. M., Jette, C., Berghmans, S., Palomero, T., Kanki, J. P., Kutok, J. L. & Look,
A. T. (2005) Blood 105, 3278–3285.
Langenau et al.
PNAS ?
April 26, 2005 ?
vol. 102 ?
no. 17 ?
6073
IMMUNOLOGY