Content uploaded by Lucia E Rosas
Author content
All content in this area was uploaded by Lucia E Rosas
Content may be subject to copyright.
of June 13, 2013.
This information is current as
Functions
Ly108 Controls T Cell and Neutrophil
Cutting Edge: The SLAM Family Receptor
and Cox Terhorst
Julien, Svend Rietdijk, Anthony J. Coyle, Christopher Fraser
R. Satoskar, Lucia E. Rosas, William A. Faubion, Aimee
Duncan Howie, F. Stephen Laroux, Massimo Morra, Abhay
http://www.jimmunol.org/content/174/10/5931
2005; 174:5931-5935; ;J Immunol
References http://www.jimmunol.org/content/174/10/5931.full#ref-list-1
, 9 of which you can access for free at: cites 19 articlesThis article
Subscriptions http://jimmunol.org/subscriptions is online at: The Journal of ImmunologyInformation about subscribing to
Permissions http://www.aai.org/ji/copyright.html
Submit copyright permission requests at:
Email Alerts http://jimmunol.org/cgi/alerts/etoc
Receive free email-alerts when new articles cite this article. Sign up at:
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Immunologists All rights reserved.
Copyright © 2005 by The American Association of
9650 Rockville Pike, Bethesda, MD 20814-3994.
The American Association of Immunologists, Inc.,
is published twice each month byThe Journal of Immunology
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
CUTTING EDGE
IMMUNOLOGY
THE
OF
JOURNAL
Cutting Edge: The SLAM Family Receptor Ly108 Controls T
Cell and Neutrophil Functions
1
Duncan Howie,
2
* F. Stephen Laroux,* Massimo Morra,* Abhay R. Satoskar,
†
Lucia E. Rosas,
†
William A. Faubion,
3
* Aimee Julien,* Svend Rietdijk,* Anthony J. Coyle,
‡
Christopher Fraser,
§
and Cox Terhorst*
Ly108, a glycoprotein of the signaling lymphocytic activa-
tion molecule family of cell surface receptors expressed by
T, B, NK, and APCs has been shown to have a role in NK cell
cytotoxicity and T cell cytokine responses. In this study, we
describe that CD4
ⴙ
T cells from mice with a targeted disrup-
tion of exons 2 and 3 of Ly108 (Ly108
⌬E2ⴙ3
) produce sig-
nificantly less IL-4 than wild-type CD4
ⴙ
cells, as judged by
in vitro assays and by in vivo responses to cutaneous infection
with Leishmania mexicana. Surprisingly, neutrophil func-
tions are controlled by Ly108. Ly108
⌬E2ⴙ3
mice are highly
susceptible to infection with Salmonella typhimurium, bac-
tericidal activity of Ly108
⌬E2ⴙ3
neutrophils is defective, and
their production of IL-6, IL-12, and TNF-
␣
is increased.
The aberrant bactericidal activity by Ly108
⌬E2ⴙ3
neutro-
phils is a consequence of severely reduced production of reac-
tive oxygen species following phagocytosis of bacteria. Thus,
Ly108 serves as a regulator of both innate and adaptive im-
mune responses. The Journal of Immunology, 2005, 174:
5931–5935.
The signaling lymphocytic activation molecule (SLAM)
4
family of immune receptors, which includes the
SLAM-associated protein (SAP)-binding receptors
SLAM, Ly108, CD84, CS1, Ly-9, 2B4, CD48, BLAME, and
SF2001, are thought to play a role in innate and adaptive im-
munity (1, 2). Ly108 (NTB-A, SF2000, KALI, SF-3) is a mem-
brane glycoprotein of the SLAM family expressed on T cells, B
cells, macrophages, dendritic cells, and granulocytes (3–5).
Ly108 has been shown to function on NK cells by augmenting
cytotoxicity (4); this function is impaired in NK cells derived
from X-linked lymphoproliferative disease patients who lack
expression of the adapter SAP. A recent report suggests that anti-
Ly108 Ab cross-linking induces IFN-
␥
production by T cells
(6). Both Ly108 and SLAM are homotypic adhesion receptors
with two cytoplasmic immunoreceptor tyrosine-based switch
motif domains which are tyrosine-phosphorylated upon recep-
tor cross-linking (6, 7). The cell and tissue distribution of
SLAM and Ly108 are very similar and T cell IFN-
␥
responses
are augmented by Abs against either receptor (8, 9). T cell sig-
nals mediated by SLAM are partially regulated by the adapter
SAP (SH2D1A), which binds to the immunoreceptor tyrosine-
based switch motif domains in the receptors’ cytoplasmic tail,
inducing activation of Fyn and downstream phosphorylation of
Dok1/2, SH2-containing protein, Ras-GTPase-activating pro-
tein, and SHIP in T cells (7, 10, 11). EWS/FL11-associated
transcript 2 is structurally related to SAP and thought to have a
similar function in APCs (1, 12).
We have recently demonstrated that mice deficient in SLAM
have impaired macrophage responses to LPS stimulation and
diminished Th2 cytokine production (2). Because an IL-4 de-
fect is also observed in CD4
⫹
cells from mice deficient in SAP
and because this defect appears to be more robust in SAP-defi-
cient animals than in SLAM-deficient mice, we hypothesize
that other SLAM-related receptors might have a similar pheno-
type (13, 14). This prompted us to investigate the role of Ly108
in adaptive and innate immune responses. In this study, we re-
port that in a mouse with a targeted disruption of the Ly108
gene CD4
⫹
T cell and innate responses are defective. The re-
sults of these studies demonstrate a surprising role for Ly108 in
the control of responses to bacteria by neutrophils while mac-
rophage functions are intact.
Materials and Methods
Generation of Ly108-deficient (Ly108
⌬E2⫹3
) mice
A targeting construct was generated from a 129/Sv mouse pBAC clone
(CD84.361) and was cloned into the plasmid vector pPNT. The second and
third exons of the Ly108 gene, encoding the complete ectodomain of
Ly108, were replaced with the neomycin resistance gene.
The targeting vector was linearized and electroporated into embryonic
stem (ES) cells. G418-resistant ES cell colonies were screened by Southern
blot. SpeI digestion of genomic DNA generated a 12-kb band from the
*Division of Immunology, Beth Israel Deaconess Medical Center, Harvard Medical
School, Boston, MA 02215;
†
Department of Microbiology, Ohio State University, Cleve-
land, OH 43210;
‡
MedImmune Inc., Gaithersberg, MD 20878; and
§
Millenium Phar-
maceuticals, Cambridge, MA 02139
Received for publication December 9, 2004. Accepted for publication March 11, 2005.
The costs of publication of this article were defrayed in part by the payment of page charges.
This article must therefore be hereby marked advertisement in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
1
D.H. was supported by a Fellowship from the Leukemia and Lymphoma Society of
America and C.T. was supported by a grant from the March of Dimes.
2
Address correspondence and reprint requests to Dr. Duncan Howie, Therapeutic Im-
munology Group, Sir William Dunn School Pathology, Oxford University, South Parks
Road, Oxford OX1 3RE, U.K. E-mail address: duncan.howie@path.ox.ac.uk
3
Current address: Division of Gastroenterology, Mayo Clinic, Rochester MN 55905.
4
Abbreviations used in this paper: SLAM. signaling lymphocytic activation molecule;
SAP, SLAM-associated protein; ROS, reactive oxygen species; TEPM, thioglycolate-elic-
ited peritoneal macrophage; ES, embryonic stem; WT, wild type; PMN, polymorphonu-
clear neutrophil; PGN, peptidoglycan.
Copyright © 2005 by The American Association of Immunologists, Inc. 0022-1767/05/$02.00
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
endogenous wild-type (WT) Ly108 allele, while the correctly targeted
Ly108 allele generated an additional 6.1-kb band (Fig. 1, Aand B). The
single integration site was confirmed with the internal 5⬘probe upon SpeI
digestion of the DNA (our unpublished data). A Ly108
⫹/⫺
ES cell clone
was injected into C57BL/6 blastocysts. F
1
mice with germline transmission
of Ly108
⫹/⫺
(C57BL/6 ⫻129/Sv) were bred to homozygosity.
Ly108
⌬E2⫹3
mice were kept under specific pathogen-free conditions.
Mice were genotyped by genomic PCR. Primers P1–P4 were used for
typing, P1 and P2 amplify the second exon, giving a 540-bp band, while P3
and P4 amplify the neomycin gene to produce a 700-bp band (Fig. 1B). The
sequences are: P1, 5⬘-GAGACCATAAGTTAGGATCATC-3⬘; P2, 5⬘-
CAGTGTATGATCCTGTGTCTG-3⬘; P3, 5⬘-GCAGCGCATCGCCTTC
TATC-3⬘; and P4, 5⬘-CACCTAGATCTCTTACTCCTC-3⬘. All mice in
this study were of the C57BL/6 ⫻129sv background; control mice
(C57BL/6 ⫻129sv F
1
) were purchased from The Jackson Laboratory.
RT-PCR
RT-PCR was performed as previously described (2, 8) Ly108 fragments
spanning exons 2 and 3 were amplified using a 5⬘primer in exon 2 which
was 5⬘-GGGAAGATAGCCAATATCATCAT-3⬘and 3⬘primer in exon 3
which was 5⬘-GCAGAGACTCTGGGTCGAAA-3⬘. Fragments spanning
exons 1– 8 were amplified with a 5⬘primer TCAGAGGATGGTCTGG
CTCT in exon 1 and a 3⬘primer AGCGTGTGGATGAGTTACCC in exon
8.
T cell stimulation proliferation assays and Th1/Th2 polarization
T cell stimulation, proliferation assays, and Th1/Th2 polarization were per-
formed as previously described (2, 8).
ELISA for T cell, polymorphonuclear neutrophils (PMNs), and
macrophage cytokine secretion
ELISA quantitation of cytokines in tissue culture supernatants or serum
was performed as previously described (2, 8).
Infection with Leishmania mexicana
L. mexicana infections were performed as previously described (15). Le-
sion diameter was measured at 1-wk intervals for up to 8 wk.
Infection with Salmonella typhimurium
WT and Ly108
⌬E2⫹3
mice were challenged i.p with 1 ⫻10
5
CFU of S.
typhimurium 14028s or sseB, an attenuated isogenic mutant of the 14028s
strain of S. typhimurium. Mice were injected i.p. with 1 ⫻10
5
bacteria in
2 ml of PBS. Blood samples were taken from the tail vein at 24 h for
cytokine analysis. Time to death was recorded.
Isolation of macrophages and PMNs
Thioglycolate-elicited macrophages (TEPM) were obtained as previously
described (2). PMNs were isolated from bone marrow or alternatively from
the peritoneum 4 h after injection with 2 ml of 5% Brewer’s thioglycolate
medium. Bone marrow or thioglycolate peritoneal lavage was washed three
times in HBSS/5% FCS. PMNs were then isolated by discontinuous Percoll
gradient centrifugation. Using this technique, ⬎95% purity was routinely
obtained as assessed by Wright-Giemsa staining.
Gentamicin-protection bacterial killing assay
Macrophage bactericidal activity was measured using a gentamicin pro-
tection assay as previously described (2).
PMN opsono-phagocytic killing assay
Bone marrow-derived or peritoneal-derived PMNs were washed three
times in HBSS/5% FCS before re-suspension at 1 ⫻10
6
in HBSS supple-
mented with 50% fresh autologous mouse serum. Bacteria opsonized in
20% fresh normal mouse serum at 37
o
C for 30 min were added to the
PMNs at ratios of 3:1, 2:1, or 1:1 PMNs:bacteria and incubated at 37
o
C
with end-over-end mixing. Fifty-microliter aliquots were extracted at 0, 30,
60, 90, and 120 min and lysed in 10 ml of sterile water for 15 min at 25
o
C.
Twenty microliters was then plated directly onto Luria-Bertani agar plates,
and bacterial colonies were counted after an 18-h incubation at 37
o
C.
Flow cytometric measurement of PMN phagocytosis
Bone marrow-derived PMNs (4 ⫻10
6
/ml in HBSS/5% FCS) were incu-
bated for various periods with 4 ⫻10
8
paraformaldehyde-fixed and opso-
nized GFP-expressing Escherichia coli strain MS589 (a kind gift from Dr.
P. Klemm, Technical University of Denmark, Lyngby, Denmark). Cells
were washed three times in ice-cold PBS followed by a 60-s wash in 0.4%
trypan blue to quench extracellular GFP and a final wash in PBS before
flow cytometry. As a negative control for nonspecific bacterial-PMN ad-
hesion, a portion of the PMNs was fixed for 10 min in 2% paraformalde-
hyde before the assay.
Measurement of superoxide generation
Superoxide production was measured with lucigenin. PMNs and macro-
phages resuspended in HBSS/5% FCS at 2.5 ⫻10
5
and 1 ⫻10
6
/ml, re-
spectively, were stimulated for 3 h with 8 ⫻10
7
heat-killed, opsonized E.
coli strain F18 or PMA at 1
g/ml for 15 min. Luminescence was measured
with a TD2020 luminometer (Turner Designs).
Results and Discussion
Generation of Ly108
⌬E2⫹3
mice
A mouse with a targeted disruption of the second and third ex-
ons of Ly108, encoding its entire ectodomain, was generated by
homologous recombination in ES cells (Fig. 1, Aand B).
Ly108
⌬E2⫹3
mice were fertile, morphologically indistinguish-
able from WT littermates, and no differences in T, B, or NK
development were detected by cell surface marker analysis (our
FIGURE 1. Targeted disruption of the mouse Ly108 gene. A, The targeting
vector. The mouse Ly108 genomic locus, Ly108 targeting vector, and chromo-
somal locus after homologous recombination with the targeting vector. The
second and third exons of the Ly108 gene encoding the entire ectodomain of
Ly108 were replaced with a neomycin resistance cassette. The locations of the
Southern blot probe and four oligonucleotide primers, P1–P4, used for
genomic PCR typing and the SpeI sites used for Southern blot digestion are
shown. SP, Signal peptide; IgV, IgV set domain; IgC, IgC set domain; TM,
transmembrane domain; CP1,2,3,4, cytoplasmic domains. B, Genomic South-
ern blot and PCR analysis. Left panel, Screening for homologous recombination
by Southern blot digestion with SpeI. The WT Ly108 locus produces a 12-kb
fragment using the probe shown. The targeted locus produces a 6.1-kb frag-
ment. Right panel, Screening for homologous recombination events by genomic
PCR using primers P1–P4. Each sample was amplified with a mixture of prim-
ers P1–P4. A 540-bp band is detected in WT and heterozygote mice. A 700-bp
band, which results from amplification of the Neo gene is detected in knockouts
and heterozygotes. C, RT-PCR analysis. RT-PCR products were generated
from the thymus of WT and Ly108
⌬E2⫹3
mice. A 450-bp band encoding the
second and third exons is detectable in WT mice but absent in Ly108
⌬E2⫹3
mice. A full-length 1.2-kb band is detectable using primers spanning exons 1– 8
in WT and a 650-bp band is present in the Ly108
⌬E2⫹3
mice.
5932 CUTTING EDGE: Ly108 FUNCTION IN T CELLS AND PMNs
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
unpublished data). No transcripts encoding Ly108 exons 2 and
3 mRNA was detected by RT-PCR in knockout thymus (Fig.
1C). A 650-bp transcript was detectable with primers spanning
the signal peptide to the 3⬘untranslated region, indicating that
a short residual transcript encoding the transmembrane and cy-
toplasmic domain remained in these mice. Since Ly108 is a self-
ligand, it was anticipated that removal of the entire extracellular
portion of the receptor would result in a total loss of Ly108
function. It is possible however that the Ly108
⌬E2⫹3
mutation
results in a different phenotype from a Ly108
null
mouse.
Impaired IL-4 production by Ly108
⌬E2⫹3
CD4
⫹
T cells
To determine whether Ly108
⌬E2⫹3
T cells deviated in their cy-
tokine production in a way similar to those derived from
SLAM
⫺/⫺
and SAP
⫺/⫺
mice, we performed various in vitro
and in vivo analyses. First, splenic CD4
⫹
T cells were stimu-
lated in vitro with anti-CD3 and anti-CD28 or PMA and iono-
mycin, followed by analysis of cell supernatant cytokines using
ELISA. Ly108
⌬E2⫹3
CD4
⫹
T cells produce significantly less
IL-4 than WT T cells even after PMA/ionomycin stimulation,
whereas production of IFN-
␥
was normal (Fig. 2A).
Ly108
⌬E2⫹3
CD4
⫹
T cells stimulated with anti-CD3 Abs also
produced less IL-13 than WT T cells as assessed by semiquan-
titative cytokine array analysis (our unpublished data).
Ly108
⌬E2⫹3
CD8
⫹
T cell production of IFN-
␥
did not differ
from WT CD8
⫹
T cells (our unpublished data). We next de-
termined whether the observed defect in IL-4 production by
Ly108
⌬E2⫹3
CD4
⫹
T cells could be “rescued” by a secondary
stimulation or by Th2 polarization. Following secondary stim-
ulation, IL-4 production by Ly108
⌬E2⫹3
CD4
⫹
T cells was still
lower and IL-4 production following Th2 polarization was
⬃50% of that of WT CD4
⫹
T cells (Fig. 2B). Conversely, po-
larization of CD4
⫹
T cells toward a Th1 phenotype resulted in
equivalent IFN-
␥
production by CD4
⫹
T cells from WT and
Ly108
⌬E2⫹3
mice (Fig. 2B). The proliferative response of
Ly108
⌬E2⫹3
CD4
⫹
T cells to anti-CD3/CD28 stimulation
was normal (our unpublished observations).
To confirm the defect in IL-4 production in vivo, we ana-
lyzed the ability of Ly108
⌬E2⫹3
mice to mount an inflamma-
tory response to infection with L. mexicana. Th2 responses
upon infection with L. mexicana are a prerequisite for control-
ling the progression of lesions caused by the parasite and con-
sequently serves as a useful indicator for the correct balance of
Th1 and Th2 responses (16). Whereas IL-4 is necessary for le-
sion formation, IFN-
␥
production is required for protective
host immunity after L. mexicana infection (17–19). In IL-4
⫺/⫺
mice, Th1 responses are predominant, which results in healing
of the lesions (17). Ly108
⌬E2⫹3
mice infected with L. mexicana
exhibited delayed formation of lesions compared with WT
mice (5 wk in Ly108
⫺/⫺
animals, 3 wk in WT) and developed
significantly smaller lesions (Fig. 2D). In vitro Ag restimulation
of lymph node CD4
⫹
T cells from the L. mexicana-infected
mice revealed lower IL-4 production by the Ly108
⌬E2⫹3
T cells
(536 ⫾124 vs 229 ⫾35 pg/ml). This result was consistent with
the in vitro observation of impaired IL-4 production by CD4
⫹
T cells. Thus, in Ly108
⌬E2⫹3
, SLAM
⫺/⫺
, and SAP
⫺/⫺
mice
Th2 functions are impaired; the Ly108
⌬E2⫹3
phenotype is
more robust than observed in the SLAM
⫺/⫺
mouse, since IL-4
production is impaired even upon stimulation with PMA and
ionomycin (13).
Increased susceptibility to bacterial infection in the absence of Ly108
Because we had observed altered innate immune responses and,
in particular, a macrophage defect in SLAM
⫺/⫺
mice (2), we
next examined a role for Ly108 in innate immunity. To this
end, WT and Ly108
⌬E2⫹3
mice were infected i.p with 1 ⫻10
5
of S. typhimurium 14028s or a congenic sseB mutant of S. typhi-
murium, deficient in the SPI2-encoded type III secretory sys-
tem. S. typhimurium sseB is attenuated for virulence and is there-
fore cleared efficiently by WT mice. Twenty-four hours after
infection with 14028s, Ly108
⌬E2⫹3
mice displayed signs of se-
vere salmonellosis including hunching, pilial erection, and leth-
argy. WT controls appeared to be healthy. Ly108
⌬E2⫹3
mice
suffered from accelerated morbidity in response to the WT S.
typhimurium strain 14028s (100% succumbed to infection in 3
days vs 5 days for WT mice; Fig. 3A) and displayed unusual
sensitivity to the attenuated sseB strain (40% of Ly108
⌬E2⫹3
mice succumbed to infection vs no WT animals). Analysis of
FIGURE 2. Impaired production of IL-4 and reduced inflammatory re-
sponse to L. mexicana infection in the absence of Ly108. A, Reduced IL-4 pro-
duction by CD4
⫹
T cells in the absence of Ly108. CD4
⫹
T cells from WT and
Ly108
⌬E2⫹3
mice were stimulated as described in Materials and Methods. IL-4
and IFN-
␥
in the culture supernatants were measured by ELISA. Results are
representative of three separate experiments. P⫹I, PMA ⫹ionomycin. B, Re-
duced IL-4 production by Ly108
⌬E2⫹3
CD4
⫹
cells after Th2 polarization.
CD4
⫹
T cells from WT and Ly108
⌬E2⫹3
mice were stimulated under Th1 and
Th2 conditions outlined in Materials and Methods. IL-4 and IFN-
␥
in cell cul-
ture supernatants were measured by ELISA. C, Reduced inflammatory response
to cutaneous L. mexicana infection in Ly108
⌬E2⫹3
mice. WT and Ly108
⌬E2⫹3
mice were infected with 5 ⫻10
6
amastigotes of L. mexicana by s.c. injection
into the rump. Lesion size was measured by mean lesion diameter in WT (f)
and Ly10
⌬E2⫹3
(Œ) mice following L. mexicana infection for 7 wk. Data are
represented as mean ⫾SE. ⴱ,p⬍0.05.
5933The Journal of Immunology
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
serum cytokines in S. typhimurium sseB-infected Ly108
⌬E2⫹3
mice showed a 4- to 7-fold increase over WT mice in the
amounts of circulating IL-12p40, TNF-
␣
, and IL-6 (Fig. 3B).
We next investigated the possibility that increased suscepti-
bility to bacterial infection in Ly108
⌬E2⫹3
mice might be due to
aberrant neutrophil or macrophage responses. Bone marrow
PMNs were tested for in vitro cytokine production in response
to stimulation with bacterial (E. coli) LPS and peptidoglycan
(PGN) from Staphylococcus aureus (Fig. 3C). Surprisingly,
PMNs from Ly108
⌬E2⫹3
mice produced 5-fold more IL-12p40
than WT PMNs in response to LPS and twice as much TNF-
␣
.
IL-6 production was also moderately elevated by PMNs from
Ly108
⌬E2⫹3
mice. Cytokine production by macrophages was,
however, not significantly different between WT and
Ly108
⌬E2⫹3
mice (our unpublished observations). Cytokine
production by neutrophils in response to PGN did not increase
significantly above constitutive levels, and no differences were
observed between WT and Ly108
⌬E2⫹3
neutrophils in this re-
spect, despite PGN inducing robust TNF-
␣
responses in both
WT and Ly108
⌬E2⫹3
macrophages (our unpublished data).
Both bone marrow neutrophils and peritoneal macrophages ex-
pressed Ly108 mRNA (Fig. 3D).
We then tested the Ly108
⌬E2⫹3
PMNs ability to phagocy-
tose and kill bacteria. As shown in Fig. 4A, PMNs from
Ly108
⌬E2⫹3
mice were impaired in their bactericidal activity,
displaying a significant lag in time to clear bacteria in vitro. Kill-
ing of S. aureus was also diminished in PMNs from Ly108
⌬E2⫹3
mice, as was killing of E. coli by thioglycolate-elicited peritoneal
PMNs from Ly108
⌬E2⫹3
mice (our unpublished data). To as-
sess whether the defect in PMN killing in the absence of Ly108
was attributable to impaired uptake of bacteria, a flow cytomet-
ric analysis of phagocytosis was used. Ly108
⌬E2⫹3
PMNs were
FIGURE 3. Increased susceptibility of Ly108
⌬E2⫹3
mice to infection with
S. typhimurium.A, Survival of Ly108
⌬E2⫹3
mice after infection with S. typhi-
murium 14028s or sseB. WT and Ly108
⌬E2⫹3
mice (n⫽5/group) were in-
fected with S. typhimurium as described in Materials and Methods. Time to
death was recorded. B, Serum proinflammatory cytokines in S. typhimurium-
infected Ly108
⌬E2⫹3
mice. Sera from the mice infected with S. typhimurium
sseB were collected at 24 h postinfection. Cytokines were measured by ELISA.
Data represent the mean ⫾SE from five mice. C, PMN cytokine production in
response to LPS and PGN stimulation. Bone marrow PMNs from WT and
Ly108
⌬E2⫹3
mice were stimulated for 24 h with LPS (100 ng/ml) or PGN (1
g/ml). Cytokines were measured by ELISA. D, Ly108 expression by perito-
neal macrophages and bone marrow neutrophils. RT-PCR of Ly108 on RNA
derived from TEPM (left panel) and bone marrow PMNs (right panel). CTR,
Control.
FIGURE 4. Killing of bacteria by PMNs, but not macrophages is impaired
in the absence of Ly108. A, PMN bacterial killing. Measurement of in vitro
killing of E. coli by bone marrow-derived PMNs from WT and Ly108
⌬E2⫹3
mice by gentamicin protection assay. Results are expressed as internalized E. coli
CFU/ml recovered from PMNs at the indicated times (starting inoculum 1 ⫻
10
6
bacteria). Data are representative of five experiments. B, PMN phagocyto-
sis. Phagocytosis of GFP-E. coli MS589 strain by WT and Ly108
⌬E2⫹3
bone
marrow PMNs. Filled histograms represent control PMNs fixed with parafor-
maldehyde before addition of bacteria. Unfilled histograms represent GFP flu-
orescence of bacteria internalized by PMNs. Data are representative of three
experiments. C, Macrophage bacterial phagocytosis and killing. Killing of E.
coli by TEPM from WT and Ly108
⌬E2⫹3
mice using a gentamicin-protection
assay. Data represent the mean ⫾SE of bacteria recovered from 1 ⫻10
6
mac-
rophages (m
; starting inoculum 1 ⫻10
7
E. coli). Data are representative of
three experiments. D, Production of ROS by Ly108
⌬E2⫹3
PMNs and macro-
phages. Bone marrow-derived PMNs and TEPM from WT and Ly108
⌬E2⫹3
mice were stimulated with heat-killed E. coli for 3 h or PMA for 15 min. Lu-
cigenin luminescence was measured at the indicated periods. Data are repre-
sentative of five experiments.
5934 CUTTING EDGE: Ly108 FUNCTION IN T CELLS AND PMNs
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
efficient in phagocytosis of paraformaldehyde-fixed GFP ex-
pressing E. coli (Fig. 4B). In contrast to PMNs, Ly108
⌬E2⫹3
peritoneal macrophages were competent in both phagocytosis
(2-h time point) and killing of bacteria after 6 and 24 h (Fig.
4C). Thus, Ly108
⌬E2⫹3
PMNs are defective in their responses
to bacteria, while macrophage functions appear normal.
Reduced PMN oxidative burst in the absence of Ly108
Following phagocytosis of bacteria, both PMNs and macro-
phages elicit a respiratory burst of reactive oxygen species
(ROS) and NO into the bacteria-containing phagolysosome.
To explain the significantly delayed bacterial killing by
Ly108
⌬E2⫹3
PMNs, we examined both their NO and ROS
production. No difference in NO production in response to
LPS and IFN-
␥
was observed between WT and Ly108
⌬E2⫹3
PMNs (our unpublished data). However, a dramatic reduction
in ROS production by Ly108
⌬E2⫹3
PMNs in response to heat-
killed E. coli was observed (Fig. 4D). As predicted by the bac-
terial killing experiments, production of ROS by Ly108
⌬E2⫹3
macrophages in response to bacterial phagocytosis was normal.
Analysis of ROS generation in response to PMA, a stimulus
which bypasses receptor involvement, indicated that both
PMNs and macrophages from Ly108
⌬E2⫹3
mice made robust
ROS responses equal to or, in the case of Ly108
⌬E2⫹3
macro-
phages, exceeding that of WT cells.
In conclusion, we report here for the first time a critical role
for the SLAM family receptor Ly108 in CD4
⫹
T cell responses
and innate immunity to bacteria and parasites. This is the first
report of the involvement of such a cell surface receptor in bac-
terial phagosomal killing. It will be of great interest to elucidate
the biochemical mechanisms involved in Ly108 induction of
cytokines in T cells and oxidative burst in PMNs.
Acknowledgments
We thank Ana Aabadia Molina, Tanya Mayadas, Xavier Cullere, and
Ahmad Utomo for experimental advice and review of this manuscript.
Disclosures
The authors have no financial conflict of interest.
References
1. Engel, P., M. J. Eck, and C. Terhorst. 2003. The SAP and SLAM families in
immune responses and X-linked lymphoproliferative disease. Nat. Rev. Immunol.
3: 813– 821.
2. Wang, N., A. Satoskar, W. Faubion, D. Howie, S. Okamoto, S. Feske, C. Gullo,
K. Clarke, M. Rodriguez Sosa, A. H. Sharpe, and C. Terhorst. 2004. The cell
surface receptor SLAM controls T cell and macrophage functions. J. Exp. Med.
199: 1255–1264.
3. Fraser, C. C., D. Howie, M. Morra, Y. Qiu, C. Murphy, Q. Shen,
J. C. Gutierrez-Ramos, A. Coyle, G. A. Kingsbury, and C. Terhorst. 2002. Iden-
tification and characterization of SF2000 and SF2001, two new members of the
immune receptor SLAM/CD2 family. Immunogenetics 53: 843– 850.
4. Bottino, C., M. Falco, S. Parolini, E. Marcenaro, R. Augugliaro, S. Sivori,
E. Landi, R. Biassoni, L. D. Notarangelo, L. Moretta, and A. Moretta. 2001.
NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface molecule
contributing to the inability of natural killer cells to kill Epstein-Barr virus-in-
fected B cells in X-linked lymphoproliferative disease. J. Exp. Med. 194:
235–246.
5. Peck, S. R., and H. E. Ruley. 2000. Ly108: a new member of the mouse CD2
family of cell surface proteins. Immunogenetics 52: 63–72.
6. Valdez, P. A., H. Wang, D. Seshasayee, M. Van Lookeren Campagne, A. Gurney,
W. P. Lee, and I. S. Grewal. 2004. NTB-A, a new activating receptor in T cells
that regulates autoimmune disease. J. Biol. Chem. 279: 18662–18669.
7. Latour, S., G. Gish, C. D. Helgason, R. K. Humphries, T. Pawson, and
A. Veillette. 2001. Regulation of SLAM-mediated signal transduction by SAP,
the X-linked lymphoproliferative gene product. Nat. Immunol. 2: 681– 690.
8. Howie, D., S. Okamoto, S. Rietdijk, K. Clarke, N. Wang, C. Gullo,
J. P. Bruggeman, S. Manning, A. J. Coyle, E. Greenfield, V. Kuchroo, and
C. Terhorst. 2002. The role of SAP in murine CD150 (SLAM)-mediated T-cell
proliferation and interferon
␥
production. Blood 100: 2899 –2907.
9. Aversa, G., C. C. Chang, J. M. Carballido, B. G. Cocks, and J. E. de Vries. 1997.
Engagement of the signaling lymphocytic activation molecule (SLAM) on acti-
vated T cells results in IL-2-independent, cyclosporin A-sensitive T cell prolif-
eration and IFN-
␥
production. J. Immunol. 158: 4036 – 4044.
10. Latour, S., R. Roncagalli, R. Chen, M. Bakinowski, X. Shi, P. L. Schwartzberg,
D. Davidson, and A. Veillette. 2003. Binding of SAP SH2 domain to FynT SH3
domain reveals a novel mechanism of receptor signalling in immune regulation.
Nat. Cell Biol. 5: 149 –154.
11. Chan, B., A. Lanyi, H. K. Song, J. Griesbach, M. Simarro-Grande, F. Poy,
D. Howie, J. Sumegi, C. Terhorst, and M. J. Eck. 2003. SAP couples Fyn to
SLAM immune receptors. Nat. Cell Biol. 5: 155–160.
12. Morra, M., J. Lu, F. Poy, M. Martin, J. Sayos, S. Calpe, C. Gullo, D. Howie,
S. Rietdijk, A. Thompson, et al. 2001. Structural basis for the interaction of the
free SH2 domain EAT-2 with SLAM receptors in hematopoietic cells. EMBO J.
20: 5840 –5852.
13. Wu, C., K. B. Nguyen, G. C. Pien, N. Wang, C. Gullo, D. Howie, M. R. Sosa,
M. J. Edwards, P. Borrow, A. R. Satoskar, et al. 2001. SAP controls T cell
responses to virus and terminal differentiation of TH2 cells. Nat. Immunol. 2:
410 – 414.
14. Czar, M. J., E. N. Kersh, L. A. Mijares, G. Lanier, J. Lewis, G. Yap, A. Chen,
A. Sher, C. S. Duckett, R. Ahmed, and P. L. Schwartzberg. 2001. Altered lym-
phocyte responses and cytokine production in mice deficient in the X-linked
lymphoproliferative disease gene SH2D1A/DSHP/SAP. Proc. Natl. Acad. Sci.
USA 98: 7449 –7454.
15. Hart, D. T., K. Vickerman, and G. H. Coombs. 1981. A quick, simple method for
purifying Leishmania mexicana amastigotes in large numbers. Parasitology 82:
345–355.
16. Stamm, L. M., A. Raisanen-Sokolowski, M. Okano, M. E. Russell, J. R. David,
and A. R. Satoskar. 1998. Mice with STAT6-targeted gene disruption develop a
Th1 response and control cutaneous leishmaniasis. J. Immunol. 161: 6180 – 6188.
17. Satoskar, A., H. Bluethmann, and J. Alexander. 1995. Disruption of the murine
interleukin-4 gene inhibits disease progression during Leishmania mexicana in-
fection but does not increase control of Leishmania donovani infection. Infect.
Immun. 63: 4894 – 4899.
18. Afonso, L. C., and P. Scott. 1993. Immune responses associated with suscepti-
bility of C57BL/10 mice to Leishmania amazonensis.Infect. Immun. 61:
2952–2959.
19. Guevara-Mendoza, O., C. Une, P. Franceschi Carreira, and A. Orn. 1997. Ex-
perimental infection of BALB/c mice with Leishmania panamensis and Leish-
mania mexicana: induction of early IFN-
␥
but not IL-4 is associated with the
development of cutaneous lesions. Scand. J. Immunol. 46: 35– 40.
5935The Journal of Immunology
by guest on June 13, 2013http://www.jimmunol.org/Downloaded from
