A vital role of tubulin-tyrosine-ligase for neuronal organization.

Abstract

Tubulin is subject to a special cycle of detyrosination/tyrosination in which the C-terminal tyrosine of alpha-tubulin is cyclically removed by a carboxypeptidase and readded by a tubulin-tyrosine-ligase (TTL). This tyrosination cycle is conserved in evolution, yet its physiological importance is unknown. Here, we find that TTL suppression in mice causes perinatal death. A minor pool of tyrosinated (Tyr-)tubulin persists in TTL null tissues, being present mainly in dividing TTL null cells where it originates from tubulin synthesis, but it is lacking in postmitotic TTL null cells such as neurons, which is apparently deleterious because early death in TTL null mice is, at least in part, accounted for by a disorganization of neuronal networks, including a disruption of the cortico-thalamic loop. Correlatively, cultured TTL null neurons display morphogenetic anomalies including an accelerated and erratic time course of neurite outgrowth and a premature axonal differentiation. These anomalies may involve a mislocalization of CLIP170, which we find lacking in neurite extensions and growth cones of TTL null neurons. Our results demonstrate a vital role of TTL for neuronal organization and suggest a requirement of Tyr-tubulin for proper control of neurite extensions.

Full text

Page 1

A vital role of tubulin-tyrosine-ligase for
neuronal organization
Christian Erck*†, Leticia Peris†‡, Annie Andrieux†‡, Claire Meissirel§, Achim D. Gruber¶?, Muriel Vernet**,
Annie Schweitzer‡, Yasmina Saoudi‡, Herve ´ Pointu**, Christophe Bosc‡, Paul A. Salin††, Didier Job‡,‡‡,
and Juergen Wehland*‡‡§§
*Department of Cell Biology, German Research Center for Biotechnology, D-38124 Braunschweig, Germany;‡Laboratoire du Cytosquelette, Institut National
de la Sante ´ et de la Recherche Me ´dicale U366, and **Atelier de Transgene `se, De ´partement Re ´ponse et Dynamique Cellulaire, Commissariat a ` l’Energie
Atomique, F-38054 Grenoble, France;§Institut National de la Sante ´ et de la Recherche Me ´dicale U433 and††Unite ´ Mixte de Recherche 5167, Centre National
de la Recherche Scientifique, Faculte ´ de Medecine, RTH Laennec, F-69372 Lyon, France; and¶Department of Pathology, School of Veterinary Medicine
Hannover, D-30559 Hannover, Germany
Edited by Ronald D. Vale, University of California, San Francisco, CA, and approved April 21, 2005 (received for review December 22, 2004)
Tubulin is subject to a special cycle of detyrosination?tyrosination
in which the C-terminal tyrosine of ?-tubulin is cyclically removed
by a carboxypeptidase and readded by a tubulin-tyrosine-ligase
(TTL). This tyrosination cycle is conserved in evolution, yet its
physiological importance is unknown. Here, we find that TTL
suppression in mice causes perinatal death. A minor pool of
tyrosinated (Tyr-)tubulin persists in TTL null tissues, being present
mainly in dividing TTL null cells where it originates from tubulin
synthesis, but it is lacking in postmitotic TTL null cells such as
neurons, which is apparently deleterious because early death in
TTL null mice is, at least in part, accounted for by a disorganization
of neuronal networks, including a disruption of the cortico-tha-
lamic loop. Correlatively, cultured TTL null neurons display mor-
phogenetic anomalies including an accelerated and erratic time
course of neurite outgrowth and a premature axonal differentia-
tion. These anomalies may involve a mislocalization of CLIP170,
which we find lacking in neurite extensions and growth cones of
TTL null neurons. Our results demonstrate a vital role of TTL for
neuronal organization and suggest a requirement of Tyr-tubulin
for proper control of neurite extensions.
CLIP170 ? tubulin code
M
tility, cell morphogenesis, and intracellular motile events. The
???-tubulin dimer, the microtubule building block, is subject to
specific posttranslational modifications that principally affect
the C termini of both subunits (1). One of these modifications,
the tyrosination cycle, involves the enzymatic cyclic removal of
the C-terminal tyrosine of ?-tubulin by a so far uncharacterized
tubulin carboxypeptidase and the readdition of a tyrosine resi-
due by the tubulin-tyrosine-ligase (TTL) (2, 3). This tyrosination
cycle is conserved among eukaryotes (4, 5) and generates two
tubulin pools: intact tyrosinated ?-tubulin (Tyr-tubulin) and
detyrosinated ?-tubulin (Glu-tubulin), which lacks the C-
terminal tyrosine. In cultured cells, Glu-tubulin is enriched in
stable microtubules exhibiting little dynamic behavior (6–8),
whereas dynamic microtubules display Tyr-tubulin. In cells with
very long-lived microtubules, Glu-tubulin is finally converted
into ?2-tubulin, which lacks a C-terminal Glu-Tyr dipeptide and
cannot be enzymatically converted back to either Glu- or
Tyr-tubulin (9, 10). Under physiological conditions, ?2-tublin is
principally found in neurons but can also appear in cells lacking
TTL activity, irrespective of microtubule stabilization (10).
Tubulin detyrosination is a consequence, not the cause of
microtubule stabilization (11). TTL is frequently suppressed
during tumor progression (12–14) with resulting accumulation of
Glu-tubulin in tumor cells. TTL suppression in human cancers
is associated with increased tumor aggressiveness (13, 14).
However, it is still unknown whether the tyrosination cycle is of
any physiological significance in normal cells, tissues, or organ-
icrotubules are essential components of the cell cytoskel-
eton and are centrally involved in cell division, cell mo-
isms. To test the importance of the tyrosination cycle in whole
animals directly, we generated TTL null mice. These mice die
shortly after birth, apparently because of disorganization of
neuronal networks, indicating a vital role of TTL for the control
of neuronal organization.
Materials and Methods
TTL Targeting Construct and Knockout Mice. Genomic DNA clones
were identified as described (15). Within the targeting vector
pPNT (16), in a 14-kb genomic clone (Fig. 1A) exon 1 was
replaced by a phosphoglycerate kinase-driven neomycin resis-
tance (pGK-neo) cassette. After electroporation into R1 ES cells
(17) recombinant ES clones were identified by BamH1 digestion
and hybridization with a BamH1–BglII probe (Fig. 1A). Two
recombinant ES clones were aggregated with OF1 morula to
generate chimeric mice (17). Germ-line-transmitting mice from
the two ES clones were mated with either BALBc or 129 SvPas
mice to produce heterozygous mutant mice on either mixed
BALBc?129 SvPas or pure 129 SvPas backgrounds.
Antibodies, Western Blots, and TTL Assay. Primary antibodies used
were Glu- and ?2-tubulin (10), N STOP 175 (18), Tyr-tubulin
(cloneYL1?2, provided by J. V. Kilmartin, Medical Research
Center Laboratory of Molecular Biology, Cambridge, U.K.),
CLIP170 [clone 4D3 (19)], EB1 (Transduction Laboratories,
Lexington, KY), GFP (Molecular Probes), tau (Upstate Bio-
technology, Lake Placid, NY), and TTL [clone 1D3 (20)]. For
Western blot analysis amounts of tubulin protein in tissue lysates
were estimated by using the non-C-terminal-recognizing mono-
clonal ?-tubulin antibody (clone ?3a) from the laboratories of
D.J. and J.W. TTL activity in tissue extracts was determined as
described(20).Immunoblotswereanalyzedbyluminometrywith
a cooled charge-coupled device camera (Fuji) by using AIDA
software (Raytest, Straubenhault, Germany).
Histology. Whole brains from embryos were fixed in 4% para-
formaldehyde and embedded in paraffin. Coronal serial paraffin
sections (5 ?m) were stained with hematoxylin and eosin.
This paper was submitted directly (Track II) to the PNAS office.
Freely available online through the PNAS open access option.
Abbreviations: TTL, tubulin-tyrosine-ligase; diI, 1,1?-dioctadecyl 3,3,3?3?-tetramethylindo-
carbocyanine perchlorate; En, embryonic day n; siRNA, small interfering RNA; IC, internal
capsule; DTB, diencephalic-telencephalic boundary.
†C.E., L.P., and A.A. contributed equally to this work.
?Present address: Department of Veterinary Pathology, Free University Berlin, D-14163
Berlin, Germany.
‡‡The laboratories of D.J. and J.W. contributed equally to this work.
§§To whom correspondence should be addressed. E-mail: wehland@gbf.de.
© 2005 by The National Academy of Sciences of the USA
www.pnas.org?cgi?doi?10.1073?pnas.0409626102PNAS ?
May 31, 2005 ?
vol. 102 ?
no. 22 ?
7853–7858
CELL BIOLOGY

Page 2

1,1?-Dioctadecyl 3,3,3?3?-Tetramethylindocarbocyanine Perchlorate
(DiI) Labeling. The fluorescent carbocyanine dye diI (Molecular
Probes) was used to trace projections in fixed WT and TTL null
brains (21) at embryonic day 15 (E15) and E17 (n ? 2 for each
phenotype and each developmental stage). Brains were fixed in
4% paraformaldehyde and hemisected along the sagittal mid-
line. Both hemispheres were used for axonal tracing. Crystals
(50- to 100-?m diameters) were placed in the thalamus or the
dorsal cortical plate of paired littermates. Brains were kept at
37°C for 5–8 weeks to allow appropriate diI diffusion. DiI-
labeled axons were visualized under epifluorescence micros-
copy;forterminalaxonalarborsaconfocalmicroscopewasused.
Cell Culture and Immunofluorescence Microscopy. Cortical and hip-
pocampal cell cultures were prepared as described (22). Cells
were plated on poly-L-lysine-coated coverslips in DMEM?10%
FBS, which was replaced 2 h later by DMEM with B27?N2
supplement (GIBCO). Primary glial cultures were established
from newborn mouse cerebral hemispheres (23). Cells were
maintained in DMEM?10% FBS for 7 days to form an astroglial
cell layer, with progenitor glial spread on top. Astrocyte cultures
were derived from the astroglial cell layer. Mouse embryonic
fibroblasts were prepared from E13.5 embryos following stan-
dard procedures and cultured in DMEM?10% FBS. For immu-
nofluorescence,cellswereeitherfixedwithmethanol(?20°C)or
4% paraformaldehyde and permeabilized with 0.1% Triton
X-100. F-actin was visualized with rhodamine-phalloidin (Mo-
lecular Probes). Fluorescence intensity ratios were determined
by using METAMORPH software, version 6.2 (Universal Imaging,
Downingtown, PA).
Small Interfering RNA (siRNA). siRNA oligonucleotides specific for
the six mRNAs encoding ?-tubulin with a C-terminal Tyr were
designed as described (24): tuba1 (GenBank accession no.
NM?011653), tuba2 (GenBank accession no. NM?011654), tuba3
(GenBank accession no. NM?009446), tuba6 (GenBank acces-
sion no. NM?009448), tuba7 (GenBank accession no.
NM?009449), and tuba8 (GenBank accession no. NM?017379).
We used the combination of two siRNAs specific for ?-tubulin
tuba1, tuba2, and tuba6 (siRNA A and B) and of two siRNAs
specific for ?-tubulin tuba3, tuba7, and tuba8 (siRNA C and D).
siRNA sequences are: siRNA A, AACGAAGCCATCTACGA-
CATC (coding region 616–636); siRNA B, AAATACATGGC-
CTGCTGCATG (coding region 931–951); siRNA C AAA-
GAAGTCCAAGCTGGAGTT (coding region 486–506); and
siRNA D AAAGATGTCAATGCTGCCATT (coding region
976–996).
siRNA oligonucleotides were purchased from Proligo (Paris).
Transient transfection of siRNA (200 nM) was carried out in
serum-free media by using Oligofectamine (Invitrogen). Ten
percent FBS was added 3 h after transfection, and cells were
cultured for 48 h.
Time-Lapse Video Microscopy and Morphometric Analysis. Hip-
pocampal cells from WT or TTL null embryos were cultured for
up to 5 days and maintained with serum-free DMEM plus 20
mM Hepes and supplement B27?N2 inside the video microscopy
platform. Phase-contrast images were taken every 15 min for 3
days. Neurite and axon lengths were measured by using META-
MORPH. Neuritic growth rates were determined as the slope of
the regression of neuritic length vs. time. Neuritic length vari-
ations were measured as the linked variance of neuritic length
around the linear regression of length vs. time. A similar
procedure was applied for axonal length variations. To measure
neurite length, antibody- or phalloidin-labeled cells were ran-
domly selected from fixed cells on coverslips and analyzed by
METAMORPH. The following parameters were evaluated: axonal
length, length of minor processes, and percentage of neurons
having two axons. We examined ?100 cells from three indepen-
dent cultures for each experimental condition and time point.
Results
TTLNullMice.TTLnullmiceweregeneratedbyconventionalgene
knockout by insertion of a neomycin selection cassette into the
first exon of the ubiquitously expressed TTL gene (Fig. 1 A and
B). Heterozygotic mice were normal, and crossing of heterozy-
gotes yielded all expected genotypes in a Mendelian ratio at
birth, indicating that deletion of TTL was not embryonically
lethal. Newborn TTL null mice, either from 129 SvPas?BALB?c
or 129 SvPas pure backgrounds, were indistinguishable from
their WT littermates with apparently normal organogenesis.
Fig. 1.
vectoranditsgenomicintegration.(B)SouthernblotanalysisofgenomicDNA
derived from tails of newborn WT (???) and TTL null (???) mice after
digestionwithBglIIandhybridizationwiththeprobeshowninA.(C)Western
blotanalysisofTTLinbraintissueofE19WTandTTLnullmice.Equalamounts
oftotalproteinwereloaded.(D)RepresentativeWesternblotanalysisofTyr-,
Glu-and?2-tublinintissuelysatesofE19WTandTTLnullmice(n?3foreach
phenotype). Tubulin loading was checked by using the ?-tubulin mAb ?3a
(alpha-Tub). Lane 1, brain; lane 2, heart; lane 3, lung; lane 4, muscle; and lane
5, skin. ?2-Tublin (delta-Tub) is present in all investigated TTL null tissues;
minor amounts of Tyr-tubulin (Tyr-Tub) were detectable in TTL null tissues,
especiallyinmuscle,and?2-tublinwasdetectedinWTtissuesuponprolonged
blot exposure. Blot exposure time was 10 s, except 60 s at*. (E) Analysis of
tubulin composition in WT or TTL null brain cells. Double-immunostaining of
Tyr- and Glu-tubulin in WT and TTL null hippocampal neurons or astrocytes in
culture. Whereas only Glu-tubulin is detectable in TTL null postmitotic neu-
rons, dividing astrocytes reveal Glu- and Tyr-tubulin (see Fig. 7 for higher
magnification). (Scale bar: 20 ?m.)
TTL null mice. (A) Schematic representation of the TTL targeting
7854 ?
www.pnas.org?cgi?doi?10.1073?pnas.0409626102Erck et al.

Page 3

However, TTL null mice displayed defective breathing and
ataxia(datanotshown)anddiedwithin24hafterbirth.TTLwas
undetectable in E19 TTL null tissues (Fig. 1C), and such tissue
extracts revealed no TTL activity (data not shown), indicating
full disruption of TTL expression.
Tubulin Composition in TTL Null Mice. ?-Tubulin composition was
probed in various tissues of WT and TTL null mice at E19 by
using Tyr-, Glu-, and ?2-tublin antibodies (10). Because of TTL
suppression (12), ?2-tublin was anomalously detectable in non-
neuronal TTL null tissues (Fig. 1D). Because tubulin detyrosi-
nation occurs in differentiated cells (25), Glu-tubulin was de-
tected in WT tissues. Surprisingly, minor amounts of Tyr-tubulin
were present in TTL null tissues, especially in muscle; the reason
is currently unknown. To examine Tyr-tubulin distribution and
the consequences of TTL suppression in different cell types we
analyzed cells derived from both WT and TTL null brain tissue
by immunfluorescence (Fig. 1E). Oligodendrocytes (data not
shown) as well as neurons and astrocytes of WT origin contained
Tyr-tubulin, whereas both TTL null oligodendrocytes (data not
shown) and neurons lacked detectable Tyr-tubulin (Fig. 1E; see
also Fig. 7, which is published as supporting information on the
PNAS web site). Examination of other cell types, including
dividing fibroblasts (Fig. 2 and data not shown), also indicated
that the residual Tyr-tubulin pool in TTL null tissues was
unevenly distributed among cell types, being present mainly in
dividing TTL null cells, but obviously not in postmitotic cells.
Thus, an important question concerned the origin of Tyr-tubulin
in such dividing TTL null cells.
Tyr-Tubulin Origin in TTL Null Cells.Tyr-tubulinindividingTTLnull
cells could originate either from tubulin synthesis or a hitherto
uncharacterizedTTLenzymaticactivity.Becausethemajorityof
fibroblasts derived from TTL null embryos revealed detectable
amounts of Tyr-tubulin (see Fig. 8, which is published as
supporting information on the PNAS web site), WT or TTL null
fibroblasts were exposed to ?-tubulin siRNA to suppress ?-
tubulin synthesis. After 48-h exposure the cell density was
diminished and microtubule arrays were slightly disorganized
but still almost exclusively composed of Tyr-tubulin in WT cells,
whereas the number of Tyr-tubulin positive cells was drastically
reduced in TTL null cultures (Figs. 2A and 8). A quantitative
analysis of the Tyr?Glu-tubulin ratio (Fig. 2B) and Western
blotting (Fig. 2C) showed a significant decrease of Tyr-tubulin
after exposure of TTL null cells to ?-tubulin siRNA. Two
independent sets of siRNA gave similar results and demon-
strated that, in dividing TTL null cells, Tyr-tubulin originates
from tubulin synthesis.
Brain Anatomy in TTL Null Mice. No obvious malformation of any
organ was detectable in newborn TTL null mice, and histological
examination of a series of tissues, including lung, heart, liver,
kidney, gut, trachea, and skin appeared normal (data not
shown). Based on the symptoms of the newborn TTL null mice,
we concentrated on the brain. At various stages of development,
the general anatomic organization of the brain was conserved in
TTL null mice, although variable extents of ventricular expan-
sions were observed (data not shown). To investigate brain
organization at the histological level, we focused on the cortex
with its characteristic layer organization. Embryonic cerebral
cortices at E13.5 showed an apparently normal preplate orga-
nization as indicated by calretinin staining (data not shown). At
E19.5, the organization of the neocortex in cortical layers was
clearly visible in WT embryos, whereas TTL null embryos
displayed a blurred layer organization (Fig. 3). Appropriate
formation of the cortex at late stages of development depends to
a large extent on the establishment of correct reciprocal con-
nections between the thalamus and the neocortex, forming the
cortico-thalamic loop. In this context, previous work indicated
that impairments of the cortico-thalamic loop development are
lethal(26).Thisfindingledustoanalyzetheestablishmentofthe
cortico-thalamic loop in TTL null mice.
Disruption of the Cortico-Thalamic Loop in TTL Null Brains. In the
adult brain, the cortico-thalamic loop is characterized by axonal
projections from the thalamus to the neocortex as well as from
the neocortex to the thalamus (i.e., thalamocortical and cortico-
thalamic pathways). In developing brains, the axons from the
thalamus and the neocortex grow concurrently to eventually
meet and form the internal capsule (IC). We used the lipophilic
dye diI to label axonal projections in fixed E15 and E17 WT or
TTL null brains (Fig. 4). Starting with thalamo-cortical projec-
tions at E15, diI implants in the thalamus labeled a thick bundle
of axons forming the IC in WT specimen, which reached the
intermediate zone of the ventral cortex as reported (27, 28) (Fig.
4A). In contrast, in TTL null brains, only a small fraction of
labeled thalamic axons crossed the diencephalic-telencephalic
boundary (DTB), but never formed the IC (Fig. 4B). By E17,
numerous thalamic axons in WT brains had grown through the
IC and extended toward the intermediate zone of the dorsal
Fig.2.
of Tyr- and Glu-tubulin in WT (???) and TTL null (???) mouse embryonic
fibroblasts treated with ?-tubulin siRNA (see Fig. 8 for higher magnification).
(Scale bar: 20 ?m.) (B) Quantitative analysis of Tyr-?Glu-tubulin fluorescence
intensity ratio in TTL null mouse embryonic fibroblasts. TTL null cells treated
with ?-tubulin siRNA (n ? 76) showed a significant reduction in Tyr-?Glu-
tubulin ratio compared with cells not treated with siRNA (n ? 66).***, P ?
0.001 (t test). (C) Western blot analysis of Tyr- and Glu-tubulin in lysates of WT
and TTL null mouse embryonic fibroblasts treated with Oligofectamine alone
(?siRNA) or ?-tubulin siRNA (?siRNA). Equal amounts of total protein were
loaded.
Tyr-tubulinorigininTTLnullfibroblasts.(A)Double-immunostaining
Fig. 3.
(???) embryos (E19.5) were stained with hematoxylin and eosin. Note blur-
ring of cortical layers in brains from TTL null mice with reduced cell numbers
in the cortical plate zone (CP). MZ, mantle zone; SP, subplate zone; IZ,
intermediate zone; SVZ, subventricular zone; VZ, ventricular zone.
Cortex anatomy. Coronal brain sections from WT (???) or TTL null
Erck et al.PNAS ?
May 31, 2005 ?
vol. 102 ?
no. 22 ?
7855
CELL BIOLOGY

Page 4

cortex (Fig. 4C). At the same age, labeled thalamic axons in TTL
null brains did not form an appropriate IC but deviated from
their normal route and looped around without further progress
(Fig. 4D). We then examined cortico-thalamic projections from
E15 to E17. In WT mice, the majority of labeled axons grew
through the IC with the leading front reaching the thalamus (29)
(Fig. 4E). In contrast, in TTL null brains, diI-labeled axons never
exited the neocortex (Fig. 4F). In E17 WT brains, the vast
majority of labeled cortico-thalamic axons projected densely to
the thalamus and elaborated terminal arbors (Fig. 4G), whereas
in TTL null mice, labeled axons were still restricted to the
neocortex as shown at E15 (Fig. 4H). Thus, a major impairment
of the cortico-thalamic loop in TTL null mice is obviously caused
by abnormal neuronal projections in vivo.
Neuronal Differentiation of TTL Null Cells. We next tested whether
the abnormal neuronal extensions observed in brain develop-
ment were associated with impaired neurite outgrowth in iso-
lated neurons. Neurons in primary culture follow a predictable
temporal sequence of morphological changes as shown for
hippocampal neurons (22) involving initial extension of a lamel-
lipodial veil (stage I) that is later replaced by three to four minor
neurites (stage II), one of which becomes the axon (stage III).
This morphogenetic sequence is sensitive to cytoskeletal alter-
ations (30, 31). Neuronal cells from E18.5 embryos, either WT
or TTL null, were isolated, plated, and monitored for neurite
extension and axon formation 12, 24, or 48 h later (Fig. 5A) in
both cortical and hippocampal cultures. Whereas TTL null
neurons reached each of the normal morphogenetic stages,
axonaldifferentiationwaspremature,withalargeexcessofstage
III cells (Fig. 5A; see also Fig. 9, which is published as supporting
information on the PNAS web site). At day 2, when compared
withWTcellsallneuritesandaxonswerelongerinTTLnullcells
with an excess of abnormal cells with two axon-like extensions
(tau-positive processes). Neurite growth pattern was further
analyzed in stage II hippocampal neurons by video microscopy.
Whereas neurites extended and retracted for short distances in
WT cells, neurite growth was erratic in TTL null neurons, with
growing and shrinking phases of large amplitude (Fig. 5B). A
similar trend was observed in axons. Upon quantification, the
neuritic growth rate, neuritic length variations, and axonal
growth rate were significantly higher in TTL null cells (Fig. 5B).
Thus, there were apparent defects in the control of neuritic
growth in TTL null cells, with an erratic time course of neurite
growth, an increased net rate of both neurite and axon extension,
and apparent premature and abnormal axonal differentiation.
Abnormal CLIP170 Distribution in TTL Null Neurons. We did not
detect any obvious disorganization of microtubule networks or
actin organization in TTL null neurons. In particular, growth
conesapparentlyhadnormalactinandmicrotubuleorganization
(see Fig. 9), and we failed to find any perturbation in the
expression or localization of major microtubule-associated pro-
teins (MAPs) such as MAP2, MAP1B, STOPs, or of a variety of
other microtubule proteins potentially involved in microtubule-
dependent regulations of neurite outgrowth such as dynein,
p150glued, or p140mDia (data not shown). The microtubule tip
proteins EB1 and CLIP170 were of special interest because of
their contribution to cell morphogenesis (31–37). Moreover,
previous work in yeast suggested that tubulin detyrosination
affects CLIP170 association with microtubule tips (38). In WT
or TTL null developing neurons endogenous EB1 was distrib-
uted over the cell body and neurites, including growth cones,
with distinct aspects of microtubule end labeling along the axon
and in the growth cones (Fig. 6A; see also Fig. 10, which is
published as supporting information on the PNAS web site). In
WT neurons, CLIP170 had a similar general cellular distribution
as EB1, although microtubule end labeling is not that distinct
Fig. 4.
labelingofthecortico-thalamicloopatE15(A,B,E,andF)andE17(C,D,G,and
H) in WT (Left) or TTL null (Right) embryos, axon labeling after diI implants in
the thalamus (A–D) or the cortex (E–H). (A) In E15 WT embryos, labeled
thalamo-cortical axons grew through the IC (white arrow) up to the interme-
diatezoneoftheventralcortex.(B)Incontrast,inE15TTLnullembryos,asmall
bundleoflabeledfibersjustcrossedtheDTB,butdidnotformanIC.(C)InE17
WTembryosthalamo-corticalaxonsformedathickbundleinIC(whitearrow),
andleadingfibersreachedtheirmaximumextentintheintermediatezoneof
the dorsal cortex (white arrowhead). (D) In E17 TTL null embryos diI-labeled
axons failed to form an IC, but wandered about in a looping trajectory
(triangle and Inset). (E) Cortico-thalamic axons in E15 WT embryos formed a
dense terminal projection zone in the thalamus (white star and Inset). (F) In
E15 TTL null embryos, the maximum extent of labeled axons was restricted to
the neocortex (white arrowhead). (G) In E17 WT embryos, labeled cortico-
thalamicaxonselaborateadenseterminalfield(whitestar)whereas(H)inTTL
nullembryosthemaximumextentreachedbylabeledaxonsisstillconfinedto
the neocortex as shown at E15 (compare white arrowheads in F and H). Co,
cortex; dTh, dorsal thalamus. (Scale bar: 150 ?m, A–F; 60 ?m, Insets in D and
E; and 75 ?m, G and H.)
Defective cortico-thalamic loop in embryonic TTL null mice. DiI
7856 ?
www.pnas.org?cgi?doi?10.1073?pnas.0409626102Erck et al.

Page 5

with CLIP170 antibodies, whereas in TTL null neurons,
CLIP170 was detectable in the cell body in similar amounts as in
WTneurons,butwasdrasticallydiminishedinneuriteextensions
and growth cones (Figs. 6B and 10) despite similar expression
levels (Fig. 6C). Thus, CLIP170 was mislocalized in TTL null
neurons.
Discussion
In this study we inactivated a key enzyme involved in a tubulin
modification in whole mammals, with dramatic consequences on
brain development and animal survival. TTL suppression led to
abnormalexpressionof?2-tublininnonneuronaltissues,withno
obvious effects on organ development, suggesting that ?2-
tubulin accumulation per se is not deleterious to cells. Whereas
TTL suppression fully depleted Tyr-tubulin in postmitotic cells,
such as neurons, Tyr-tubulin persisted in dividing TTL null cells
where it apparently arose from tubulin synthesis, which probably
is more active in dividing cells than in quiescent cells to provide
sufficient amounts of tubulin to daughter cells. Currently we do
not know whether the rescue pool of newly synthesized Tyr-
tubulin is essential for the progression of the cell cycle in dividing
TTL null cells. TTL activity is highest in the brain (2), and
Tyr-tubulin suppression in TTL null neurons apparently caused
extensive disorders in neuronal organization, including a disrup-
tion of the cortico-thalamic loop. Further detailed analysis of
TTL null brain organization strongly suggests that anomalies in
neuronal growth affect other neurons in addition to cortico-
thalamic neurons (E. Bloch-Gallego, personal communication).
However, the disruption of the cortico-thalamic loop is probably
sufficient to account for the perinatal death of TTL null
newborns, as other mouse mutants such as Mash-1- or Pax-6-
deficient mice with disrupted cortico-thalamic loops are not
viable (26). Disruption of the cortico-thalamic loop in TTL null
mice could have various origins such as anomalies in neurite
extension formation. Whereas cortical neurite projections are
shorter in the brain of TTL null mice, neurites grow faster and
differentiate earlier in cultured TTL null neurons than in WT
neurons. TTL null cells also show an erratic time course of
neurite outgrowth and anomalies of axonal differentiation.
Apparently, TTL suppression disrupted mechanisms that are
essential for controlling neurite outgrowth, but not neurite
outgrowth per se. Disruption of the cortico-thalamic loop could
Fig.5.
(A) Cell differentiation of cortical and hippocampal neurons in WT or TTL
null primary culture after 0.5, 1, and 2 days in vitro. The percentage of cells
reaching stage III (presence of an axon) was always increased in TTL null
cells compared with WT cells, indicating a premature differentiation of TTL
null neurons. Compared with WT cells in 2-day in vitro hippocampal cells,
both neurite (WT, n ? 150; TTL null, n ? 110) and axonal (WT, n ? 50; TTL
null, n ? 75) mean length were longer in TTL null cells. TTL null cultures also
revealed a higher percentage of cells with two axon-like processes (n ? 190
forbothWTandTTLnull).(B)Morphologicalchangesduringestablishment
of polarity in cultured hippocampal neurons examined by time-lapse,
phase-contrast video microscopy. Neurite and axon growth was examined
from 1 day after plating until 3 days, showing a 10-h sequence window
including the phase of axon formation. Because axon differentiation is
premature in TTL null cells, this window corresponds to different time
points in WT and TTL null cultures. Quantification was performed by using
the complete data. In WT hippocampal neurons, neurites extended and
retracted over short distances over time. In TTL null neurons, neurites
extended or retracted over markedly longer distances. The net rate of
neurite (WT, n ? 16; TTL null, n ? 18) and axonal (WT, n ? 9; TTL null, n ?
10) elongation was increased in TTL null cells compared with WT cells.
Neuritic length variations (measured as the linked variance of neuritic
length around the linear regression of length vs. time) were significantly
higher in TTL null neurons compared with WT neurons.
Neuriteoutgrowthandaxonaldifferentiationinculturedneurons.
Fig.6.
immunofluorescence of EB1??-tubulin and CLIP170??-tubulin in WT and TTL
null neurons. In both, EB1 is distributed throughout the cell body, neurites,
and growth cones with a characteristic ‘‘comet’’ pattern. In WT neurons,
CLIP170 is also distributed throughout the cell body, neurites, and growth
cones, whereas in TTL null neurons, the CLIP170 signal is restricted to the cell
bodyandinitialpartsofneurites,beingundetectableingrowthcones(seeFig.
10 for higher magnification). (Scale bar: 10 ?m.) (B) Quantitative analysis of
CLIP 170 staining, showing CLIP170??-tubulin fluorescence intensity ratios in
cell bodies (WT, n ? 32; TTL null, n ? 41) or growth cones from WT or TTL null
neurons (WT, n ? 30; TTL null, n ? 27). Growth cones of TTL null neurons
showed a significant reduction in CLIP170 levels compared with WT cells.***,
P?0.001(ttest).(C)ImmunoblotanalysisofCLIP170contentinWTorTTLnull
neurons. Equal amounts of total protein were loaded.
DistributionofEB1andCLIP170inhippocampalneurons.(A)Double-
Erck et al.PNAS ?
May 31, 2005 ?
vol. 102 ?
no. 22 ?
7857
CELL BIOLOGY

Page 6

result, at least in part, from the lack of a ‘‘handshake’’ between
thalamo-cortical and cortico-thalamic projections (39), which
crucially depends on a correct time and space control of axonal
growth.
Based on recent evidence in Saccharomyces cerevisiae, indi-
cating a specific and crucial role of the C-terminal aromatic
residue of ?-tubulin for CLIP170 association with microtubule
tips (38), we analyzed CLIP170 localization in WT and TTL null
neurons, which could be important for the control of cell
morphogenesis (40) and the dynamic control of adhesive struc-
tures (41). CLIP170 is mislocalized in TTL null neurons, being
absent from neurite extensions and growth cones, which may
contribute to impaired control of neurite extensions in TTL null
neurons. Further studies are required to decipher the down-
streamconsequencesofCLIP170mislocalizationthatmayreveal
additional anomalies. For instance, although TTL suppression
does not affect microtubule dynamics by itself (12), we have
observed increased microtubule resistance to nocodazole in
developing TTL null neurons (data not shown), which may be a
consequence of CLIP170 mislocalization and whose importance
for the TTL null phenotype needs to be assessed. In any case,
detailed studies of CLIP170 interactions with microtubules, the
composition of microtubule tip complexes, and microtubule
dynamics are required.
We thank D. Proietto for technical assistance, Dr. E. Bloch-Gallego for
communication of unpublished data, Dr. F. Perez for help and advice,
and several colleagues for discussion. This work was supported by la
Ligue Nationale Contre le Cancer (E´quipe Labellise ´e Ligue) (D.J.),
Association de la Recerche sur le Cancer Grant 9041 (to M.V.), and the
Deutsche Forschungsgemeinschaft and the Fonds der Chemischen In-
dustrie (J.W.).
1. Westermann, S. & Weber, K. (2003) Nat. Rev. Mol. Cell Biol. 4, 938–947.
2. Barra, H. S., Arce, C. A. & Argarana, C. E. (1988) Mol. Neurobiol. 2, 133–153.
3. Ersfeld, K., Wehland, J., Plessmann, U., Dodemont, H., Gerke, V. & Weber,
K. (1993) J. Cell Biol. 120, 725–732.
4. Barra, H. S., Rodriguez, J. A., Arce, C. A. & Caputto, R. (1973) J. Neurochem.
20, 97–108.
5. Preston, S. F., Deanin, G. G., Hanson, R. K. & Gordon, M. W. (1979) J. Mol.
Evol. 13, 233–244.
6. Gundersen, G. G., Kalnoski, M. H. & Bulinski, J. C. (1984) Cell 38, 779–789.
7. Kreis, T. E. (1987) EMBO J. 6, 2597–2606.
8. Wehland, J. & Weber, K. (1987) J. Cell Sci. 88, 185–203.
9. Paturle-Lafanechere, L., Edde, B., Denoulet, P., Van Dorsselaer, A., Maz-
arguil, H., Le Caer, J. P., Wehland, J. & Job, D. (1991) Biochemistry 30,
10523–10528.
10. Paturle-Lafanechere, L., Manier, M., Trigault, N., Pirollet, F., Mazarguil, H. &
Job, D. (1994) J. Cell Sci. 107, 1529–1543.
11. Webster, D. R., Wehland, J., Weber, K. & Borisy, G. G. (1990) J. Cell Biol. 111,
113–122.
12. Lafanechere, L., Courtay-Cahen, C., Kawakami, T., Jacrot, M., Rudiger, M.,
Wehland, J., Job, D. & Margolis, R. L. (1998) J. Cell Sci. 111, 171–181.
13. Mialhe, A., Lafanechere, L., Treilleux, I., Peloux, N., Dumontet, C., Bremond,
A., Panh, M. H., Payan, R., Wehland, J., Margolis, R. L. & Job, D. (2001)
Cancer Res. 61, 5024–5027.
14. Kato, C., Miyazaki, K., Nakagawa, A., Ohira, M., Nakamura, Y., Ozaki, T.,
Imai, T. & Nakagawara, A. (2004) Int. J. Cancer 112, 365–375.
15. Erck, C., MacLeod, R. A. & Wehland, J. (2003) Cytogenet. Genome Res. 101,
47–53.
16. Tybulewicz, V. L., Crawford, C. E., Jackson, P. K., Bronson, R. T. & Mulligan,
R. C. (1991) Cell 65, 1153–1163.
17. Nagy, A., Rossant, J., Nagy, R., Abramow-Newerly, W. & Roder, J. C. (1993)
Proc. Natl. Acad. Sci. USA 90, 8424–8428.
18. Pirollet, F., Margolis, R. L. & Job, D. (1992) Biochim. Biophys. Acta 1160,
113–119.
19. Rickard, J. E. & Kreis, T. E. (1991) J. Biol. Chem. 266, 15597–15605.
20. Wehland, J. & Weber, K. (1987) J. Cell Biol. 104, 1059–1067.
21. Godement, P., Vanselow, J., Thanos, S. & Bonhoeffer, F. (1987) Development
(Cambridge, U.K.) 101, 697–713.
22. Dotti, C. G., Sullivan, C. A. & Banker, G. A. (1988) J. Neurosci. 8, 1454–1468.
23. Ainger, K., Avossa, D., Morgan, F., Hill, S. J., Barry, C., Barbarese, E. &
Carson, J. H. (1993) J. Cell Biol. 123, 431–441.
24. Elbashir, S. M., Harborth, J., Weber, K. & Tuschl, T. (2002) Methods 26,
199–213.
25. Gundersen, G. G. & Bulinski, J. C. (1986) Eur. J. Cell Biol. 42, 288–294.
26. Lopez-Bendito, G. & Molnar, Z. (2003) Nat. Rev. Neurosci. 4, 276–289.
27. Molnar, Z., Adams, R. & Blakemore, C. (1998) J. Neurosci. 18, 5723–5745.
28. Braisted, J. E., Catalano, S. M., Stimac, R., Kennedy, T. E., Tessier-Lavigne,
M., Shatz, C. J. & O’Leary, D. D. (2000) J. Neurosci. 20, 5792–5801.
29. Hevner, R. F., Miyashita-Lin, E. & Rubenstein, J. L. (2002) J. Comp. Neurol.
447, 8–17.
30. da Silva, J. S. & Dotti, C. G. (2002) Nat. Rev. Neurosci. 3, 694–704.
31. Dehmelt, L. & Halpain, S. (2004) J. Neurobiol. 58, 18–33.
32. Beach, D. L., Thibodeaux, J., Maddox, P., Yeh, E. & Bloom, K. (2000) Curr.
Biol. 10, 1497–1506.
33. Brunner, D. & Nurse, P. (2000) Cell 102, 695–704.
34. Busson, S., Dujardin, D., Moreau, A., Dompierre, J. & De Mey, J. R. (1998)
Curr. Biol. 8, 541–544.
35. Carvalho, P., Tirnauer, J. S. & Pellman, D. (2003)Trends Cell Biol. 13, 229–237.
36. Coquelle,F.M.,Caspi,M.,Cordelieres,F.P.,Dompierre,J.P.,Dujardin,D.L.,
Koifman, C., Martin, P., Hoogenraad, C. C., Akhmanova, A., Galjart, N., et al.
(2002) Mol. Cell. Biol. 22, 3089–3102.
37. Maddox, P. S., Stemple, J. K., Satterwhite, L., Salmon, E. D. & Bloom, K.
(2003) Curr. Biol. 13, 1423–1428.
38. Badin-Larcon, A. C., Boscheron, C., Soleilhac, J. M., Piel, M., Mann, C.,
Denarier, E., Fourest-Lieuvin, A., Lafanechere, L., Bornens, M. & Job, D.
(2004) Proc. Natl. Acad. Sci. USA 101, 5577–5582.
39. Molnar, Z. & Blakemore, C. (1995) Trends Neurosci. 18, 389–397.
40. Busch, K. E., Hayles, J., Nurse, P. & Brunner, D. (2004) Dev. Cell 6, 831–843.
41. Krylyshkina, O., Anderson, K. I., Kaverina, I., Upmann, I., Manstein, D. J.,
Small, J. V. & Toomre, D. K. (2003) J. Cell Biol. 161, 853–859.
7858 ?
www.pnas.org?cgi?doi?10.1073?pnas.0409626102Erck et al.