Molecular cloning and protein expression of Duchenne muscular dystrophy gene products in porcine retina.

Abstract

Due to the difference between rodent and human retinal circuitry, we characterize a new animal model of retinal perturbation in neurotransmission in Duchenne Muscular Dystrophy (DMD) patients. We investigated the expression and localization of dystrophin proteins and dystrophin associated proteins in porcine retina by reverse transcription polymerase chain reaction, Western blot analysis and immunohistochemistry. Homologues of human DMD gene products and alternative spliced isoforms of Dp71 were identified. We observed that dystrophins were expressed in the outer plexiform layer, around blood vessels and at the inner limiting membrane as previously described in human and mouse retinae. Moreover, by double immunostaining we showed that beta-dystroglycan co-localizes with dystrophin in the outer plexiform layer whereas alpha1-syntrophin labeling differs from that for dystrophins. Using confocal laser microscopy we observed that dystrophins labeling co-localizes with pre- and post-synaptic cell markers in the outer plexiform layer. We suggest that porcine retina constitutes a good model to study the role of dystrophins in retinal neurotransmission and should be used to investigate the physiological roles of dystrophins in signal transduction.

Full text

Page 1

Molecular cloning and protein expression of Duchenne muscular
dystrophy gene products in porcine retina
Agne `s Bordaisa, Francisco Bolan ˜os-Jimenezb, Patrice Forta, Carolina Varelaa,
Jose ´-Alain Sahela, Serge Picauda, Alvaro Rendona,*
aLaboratoire de Physiopathologie Cellulaire et Mole ´culaire de la Re ´tine, INSERM U592, Ho ˆpital Saint-Antoine,
Ba ˆtiment Kourilsky, 184 rue du Faubourg Saint-Antoine, 75571 Paris, France
bInstitut National de la Recherche Agronomique, Unite ´ de Fonctions Digestives et Nutrition Humaine,
Rue de la Ge ´raudie `re, B.P. 71627, 44316 Nantes, France
Received 3 December 2004; received in revised form 17 March 2005; accepted 24 March 2005
Abstract
Due to the difference between rodent and human retinal circuitry, we characterize a new animal model of retinal perturbation in
neurotransmission in Duchenne Muscular Dystrophy (DMD) patients. We investigated the expression and localization of dystrophin proteins
and dystrophin associated proteins in porcine retina by reverse transcription polymerase chain reaction, Western blot analysis and
immunohistochemistry. Homologues of human DMD gene products and alternative spliced isoforms of Dp71 were identified. We observed
that dystrophins were expressed in the outer plexiform layer, around blood vessels and at the inner limiting membrane as previously
described in human and mouse retinae. Moreover, by double immunostaining we showed that b-dystroglycan co-localizes with dystrophin in
the outer plexiform layer whereas a1-syntrophin labeling differs from that for dystrophins. Using confocal laser microscopy we observed that
dystrophins labeling co-localizes with pre- and post-synaptic cell markers in the outer plexiform layer. We suggest that porcine retina
constitutes agood model tostudythe role ofdystrophins inretinal neurotransmission andshould beused toinvestigate the physiologicalroles
of dystrophins in signal transduction.
q 2005 Elsevier B.V. All rights reserved.
Keywords: Dystrophins; DAPs; Retina; Porcine
1. Introduction
Dystrophin is well known as the defective protein in
Duchenne Muscular Dystrophy (DMD). This X linked
disorder is characterized by a progressive degeneration of
skeletal muscular tissue [1] and several non-progressive
clinical manifestations including cardiomyopathy, mental
deficits, hearing deficits, gastric dilation and abnormalities
of the electroretinogram (ERG) [2,3]. Dystrophin is
a cytoskeletal-associated protein of 427 kDa, a member of
thespectrinsuperfamilyconsistingoffourdistinctdomains:an
N-terminal actin binding domain, a rod-shaped spectrin-like
domain,a cystein-richdomainandauniquecarboxy-terminal
domain [4–6]. In addition to this, full-length dystrophin of
427 kDa,theactivationofinternalpromotersintheDMDgene
leads to the production of several short products named in
reference to their calculated molecular weight as Dp260 [7],
Dp140 [8], Dp116 [9] and Dp71 [10]. Dp71 is the most
abundant DMD gene product in non-muscular tissue.
Dystrophin forms a linkage between cytoskeletal actin and
the extracellular matrix through a cluster of membrane and
cytoplasmic proteins (dystrophin-associated proteins, DAPs).
It has been suggested that in retina, dystrophins are key
elements in membrane stability, synaptic structure and
synaptic transmission. It has been shown that the dystro-
phin–DAPs complex is involved in the clustering of voltage-
gatedsodiumchannels,neuronalnitricoxidesynthase(nNOS)
and AQP4 [11–13]. It was also suggested that dystrophins
participateintheclusteringofGABAAreceptorsinthecentral
nervous system [14].
Although an abnormal electroretinogram (ERG) is
certainly one of the best characterized non-muscular
Neuromuscular Disorders 15 (2005) 476–487
www.elsevier.com/locate/nmd
0960-8966/$ - see front matter q 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.nmd.2005.03.011
*Corresponding author. Tel.: C33 1 49 28 46 04; fax: C33 1 49 28 46
05.
E-mail address: rendon@st-antoine.inserm.fr (A. Rendon).

Page 2

manifestations of the DMD disease, the precise functional
alterations underlying this phenotype remain unclear.
To date, a considerable advance in the understanding of the
pathogenic mechanisms in human visual diseases has come
from the study of animal models, specially using transgenic
and mutants mice. Several dystrophin-deficient mice strains
have been used to study the function of dystrophins in the
retina [15,16]. However, neither the anatomy nor the retinal
circuitry, which is mainly rod-driven in mice, is very
comparable between humans and mice. Moreover, whereas
a reduction of the b-wave amplitude of the ERG is observed
inmostDMDpatientsexhibitingadefectiveexpressionofthe
Dp427 form of dystrophin, the only mouse model reprodu-
cing this alteration is the mdx3cvstrain which has a severe
reduction of all the long and short forms of dystrophin. Other
animal models are, therefore, necessary to fully understand
the sequence of molecular events underpinning the ERG
phenotype of DMD patients and to assess the function of
dystrophins in retina. The pig is considered as an appropriate
animal model for biomedical research. In fact, among all the
non-primate mammals, the porcine retina is the most similar
to human ones. Not only the dimensions of the porcine and
human eyes are analogous, but also some anatomic and
physiological features are quite similar [17]. Even if the pig
retina has no fovea and exhibits a rather homogenous
distribution of rods and cones, it has a typical primate-like
architecture.
Since dystrophins are implicated in synaptic organization
of the retina, and there are several differences between the
retinal circuitry in current mouse models and the human
retina, the extrapolation of conclusions can be difficult. As
mentioned before, the porcine retina seems to be a closer
model to compare with the human than the mouse. In the
present study, we report the identification and molecular
characterization of the porcine homologues of dystrophin
and the short DMD gene products. Using specific antibodies
in immunoblot and immunohistochemical analysis we
further determined the presence and cellular localization
of dystrophins and their associated proteins in the porcine
retina. Our results indicate that pig can be an appropriate
animal model to study the role of dystrophins in retinal
neurotransmission as well as their involvement in the ERG
phenotype observed in DMD patients.
2. Materials and methods
2.1. Cloning by reverse transcription-polymerase
chain reaction (RT-PCR)
Adult pig eyes were collected from a local slaughterhouse
immediately after death. Retinae were recovered after
removal of the anterior segment. Total RNA from retinal
fragmentswasextractedusingTrizolreagent(Invitrogen-Life
Technologies) according to the manufacturer’s instructions.
Total RNA (1 mg) was reverse transcribed using random
hexamers and SuperScript II (Invitrogen-Life Technologies)
in 20 ml final volume. PCR amplifications were performed
using 2 ml of the RT reaction and 25 pmol of primers specific
to the human (NM_004009) or (after initial characterization)
to the porcine mRNA sequences.
In order to generate a sequence contig of the entire pig
dystrophin coding region, porcine RT-PCR products were
subcloned into pGEM-t-easy vector (Promega), and
sequenced using T7 and SP6 primers and an automatic
sequencer Ceq8000 (Beckman Coulter, CA). Sequence reads
were assembled to generate a contig of dystrophin Dp427
codingcDNAandfurtheranalysedusingtheBLASTprogram
and the CLUSTAL methods (Infobiogen, Evry, France). The
cDNA sequence for Sus scrofa dystrophin Dp427 (DMD
gene)wassubmittedtoEMBLNucleotideSequenceDatabase
and registered under the accession number AJ865385.
To study alternative splicing, we performed RT-PCR.
After amplification with primers F1: 50-TGGGAAGCTCA
CTCCTCCACTCG-30and R1: 50-GGGACAGGCCTTTA
TGTTCA-30, 1 ml of the amplified product was used as
template for a second amplification with primers F2: 50-
CTGCAAGGAGTGTCCAATCA-30and R1. Amplified
products were purified, subcloned and sequenced as
described above.
2.2. Antibodies
Dystrophins were detected with the monoclonal pan-
specific antibody Dys2 (Novocastra, Newcastle-on-Tyne,
UK) which is directed against amino acids 3669–3685
of human dystrophin. b-dystroglycan was detected with
the polyclonal antibody previously characterized by Rivier
et al. [18]: JAF. The distribution of a1-syntrophin was
analyzed using the polyclonal antibody raised against the
amino acids 191–206 of mouse a1-syntrophin (Sigma).
Cone photoreceptors and rod bipolar cells were, respect-
ively, identified with PNA coupled to Alexa 488 (Molecu-
lar Probes, Eugene, OR) and a polyclonal antibody against
PKC alpha (Santa Cruz Biotechnology, Inc., CA).
2.3. Protein extraction and Western-blot analysis
Retina samples from adult pig were homogenized in 10
volumes (wt/vol) of extraction buffer containing protease
inhibitors (Roche Diagnostics GmbH; Sigma), sonicated
and centrifuged at 1000g for 1 min. Supernatants were
recovered and protein concentrations were determined using
bovine serum albumin (BSA) as standard [19].
Protein extracts (40 mg) were resolved using NuPAGE
Tris–Acetate 3–8% gradient gels (Invitrogen) and electro-
transferredtopolyvinylidenedifluoridemembranesaccording
to the manufacturer’s instructions. The efficiency of protein
transfer was controlled by both ponceau red staining of the
blot and Coomassie blue staining of the remaining gel.
Membranes were blocked in PBS containing 0.1% Tween
20, 1% BSA, 5% dry milk (BIO-RAD, Herts, UK) for 1 h at
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487 477

Page 3

room temperature then incubated with the Dys2 antibody in
the same blocking buffer. Blots were then washed and
incubated with goat anti-mouse IgG secondary antibody
conjugated to horseradish peroxidase (Jackson Immunore-
searchlaboratories)diluted1:15,000.Molecularweightswere
comparedtoprestainedmolecularsizemarkers(Benchmarks,
Invitrogen). Chemiluminescence was performed using
ECLC plus Western blotting detection system (Amersham
Biosciences, UK) and documented on film (Kodak).
2.4. Tissue preparation and immunocytochemistry
Postmortem human eye tissue was obtained from the
Center for the Conservation of Corneal and Ocular Tissue
from Strasbourg, all procedures followed the principles
elicited in the Declaration of Helsinki. The retina was
separated from the posterior eye cup and fixed by immersion
in PBS 4% paraformaldehyde for 15 minutes and rinsed in
PBS before cryoprotection.
Adult pig eyes were opened along the ora serrata. The
retinae were isolated in phosphate buffer saline (PBS) and
fixed for 2 min in 4% paraformaldehyde. After cryoprotec-
tion retina samples were embedded in freezing medium
(cryoblock, Labonord) and frozen in liquid nitrogen.
Retinae were vertically sliced at 8 mm thickness in a
cryostat and sections were placed on gelatin-coated glass
slides.
Immunohistochemical labeling was carried out using
the indirect immunofluorescence method. After blocking
in PBS, containing 10% normal goat serum (NGS), 1%
bovine serum albumin (BSA) and 0.05% Triton X-100,
sections were incubated with primary antibody in PBS
supplemented with 3% NGS, 1% BSA and 0.1%
Tween20. Primary antibodies were detected using
secondary goat anti-rabbit or anti-mouse IgG antibody
coupled to Alexa (Molecular Probes, Eugene, OR) diluted
1:500 in PBS containing 3% NGS, 1% BSA, and 0.1%
Tween20. After mounting in Gel/Mount (biomeda, Foster
City, CA) the sections were examined and photographed
using a confocal laser scanning equipped with an
argon-kripton laser (TCS SP1 Leica, Lasertechnik
GmbH). The images were adjusted for contrast and
brightness using Adobe Photoshop 5.5 (Adobe Systems,
San Jose, CA). Controls were prepared by omitting the
primary antibody during the incubation; in these controls,
no specific staining could be detected.
3. Results
3.1. Sequence analysis of swine dystrophin
To clone the porcine homologue of the dystrophin
gene, we designed several pairs of primers (Table 1) for
Table 1
Oligonucleotides were chosen according to the sequences available in GenBank for human dystrophin mRNA (accession number NM_004009) or after initial
characterization, from porcine sequence (accession number AJ865385)
PrimerSequence PrimerSequence
Dp427F1H
Dp427R2
EX32R1
Dp260F1P
Dp140F3H
Dp140R2H
Dp140R1P
Dp140F1P
Dp71F1H
HDp71-R2
DYST3-R
DYST4-F
DYST5-F
DYST6-F
DYST6-R
DYST7-F
DYST7-R
DYST8-F
DYST8-R
DYST9-F
DYST10-F
DYST10-R
DYST11-F
DYST11-R
DYST12-R
DYST13-F
DYST13-R
CGGCAACCGGAGTGGAAGAAACAG
ATTGTTCAGGGCATGAACTCTTGT
GGCTGGTTTTTGGAATAATCG
TCAAGAGATCAGGAGGAACATTCG
CTAGCAATGGCAAAGCTTTGTGCG
GCTCTGGAAACCTTTATCCACTGG
CCCAGTTGCATTCAACACTCTGAC
GGAACTCCAGGATGGCATTGGG
TGGGAAGCTCACTCCTCCACTCG
CTCTTGCTCCAGGCGGTCATA
CATTAAGATGGACTTCTTATCTGG
CATCACTAACACAGACAACTG
GGCCCTGGTGGAACAGATGG
CTGAAGGAGGAATGGCCTGC
GCAGGCCATTCCTCCTTCAG
GAAGTTTGGGCATGTTGGCATG
CATGCCAACATGCCCAAACTTC
GAGTGAAGTGAAGTCTGAAGTGG
CCACTTCAGACTTCACTTCACTC
GTGGTATCAGTACAAGAGGC
GCTCAGTTTCGAAGACTCAAC
GTTGAGTCTTCGAAACTGAGC
CCTGAGATCCCTGGAAGGTTC
GAACCTTCCAGGGATCTCAGG
CCACGGGCTGCCAGGATCCC
GAGCTCTACCAGTCTTTAGC
GCTAAAGACTGGTAGAGCTC
DYST14-F
DYST14-R
DYST15-F
DYST15-R
DYST16-R
DYST18-F
DYST19-F
DYST20-F
DYST50F
DYST51R
DYST53R
DYST58R
DYST59F
DYST59R
DYST60F
DYST61R
DYST62F
DYST63R
DYST64F
DYST65R
DYST74F
DYST75R
DYST76F
DYST77R
DYST71R
DYST70F
CCCCGAATGGGCTACCTGCC
GGCAGGTAGCCCATTCGGGG
CAGAGGTCCGACAGCAGTCAGC
GCTGACTGCTGTCGGACCTCTG
GCATAGACGTGTAAAACCTGCC
GTCATAGGCCAGACCTGTTTG
GGAACAGTGCTTGTAAGTGC
CTCTTCAGGAACTTTTGGTG
GGAACATGCATTCAACATCG
GCTTGCAATGTGTCCTCAGCAG
CGTTGCCATTTGAGAAGGATG
GAGTGGCTGGTTTTTCCTTG
CAATGGCTGGAAGCTAAGGA
TCCTTAGCTTCCAGCCATTG
TGGTGGTGGTAGTCGATGAA
TCCTCTTGGGCATGCTTTAC
GTAAAGCATGCCCAAGAGGA
TCAGTTGCTCTGCAGCTTGT
GCCAAAAGCTAGAGGAGCAA
TGGCTCCGCTTCTTTCTTTA
CTGGTGGAGCTGAGGAAATC
TACCTTTGCTCCCAGCTCAT
CTGCAAGGAGTGTCCAATCA
GGGACAGGCCTTTATGTTCA
CAAATCATCTGCCAAGTGGA
GATGCTGAGCTCATTGCTGA
F, forward; R, reverse.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487 478

Page 4

Fig. 1. Comparison of the full length sequences of dystrophin from various species. Alignment of amino acid sequences of porcine, human (NM_004009) and
mouse (M68859) dystrophins. Stars indicate identity, dashes indicate gaps introduced to maximize similarity. Structural or functional domains are boxed and
shaded.X representsthe firstandlastaminoacidofthe central roddomain.Aminoacid residuesare numberedat theright ofthe sequence.Multiplesalignments
were conducted using Clustal W program (Infobiogen).
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487 479

Page 5

PCR amplification of cDNA reverse-transcribed from total
RNA of porcine retina. The primers were chosen to span
the human dystrophin cDNA sequence (NM_004009) and
PCR products were cloned and sequenced. The predicted
porcine dystrophin protein shows a high degree of
sequence homology to human dystrophin (94% overall
amino acid identity). Alignment of the deduced amino
acid sequence of the protein encoded by the porcine gene
with full-length human and mouse dystrophin is shown in
Fig. 1. Moreover, the porcine cDNA sequence contains
several structural and functional domains originally
identified in human and mouse dystrophin: the WW
domain which is a protein-binding module found in
several signaling and regulatory molecules and thought
Fig. 1 (continued)
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487 480

Page 6

to mediate the interaction of dystrophin with the
cytoplasmic domain of b-dystroglycan [20,21]; a
cysteine-rich domain containing two EF-hand motifs that
potentially bind calcium [5]; and a ZZ domain possessing
conserved cysteine residues [22]. The COOH terminus of
human and porcine dystrophin comprise also two poly-
peptide stretches that are predicted to form a-helical
leucine zipper coiled-coil motifs [23] and has been named
the CC (coiled coil) domain. This domain forms the
binding site for dystrobrevin and may modulate the
interaction between syntrophins [24,25] and some other
dystrophin-associated proteins [23,26].
3.2. Cloning of the 50-end sequence of the shorter DMD
gene products
The activation of internal promoters of the DMD gene
leads to the production offour short products named Dp260,
Dp140, Dp116 and Dp71. PCR amplification using forward
primers spanning the 50UTR of Dp260, Dp140 or Dp71
human sequences in conjunction with reverse primers
spanning porcine full-length dystrophin previously
sequenced, allowed us to show that some of the
short products of the DMD gene are expressed in porcine
retina (Fig. 2).
Our results (Fig. 2(A)) agree with the initial descrip-
tion of Dp260 as a retinal-specific DMD gene product
with its first exon lying in intron 29 and producing 13
specific amino acids upstream of the common sequence
with dystrophin Dp427 [7]. PCR amplification of the
Dp140 transcript (Fig. 2(B)) resulted from 50UTR region
with no specific coding sequence [8]. Fig. 2(C) shows
alignment of the 50end region and the deduced seven
amino acids of the first specific exon of the Dp71
transcript. This protein is produced by the activation of an
internal promoter located between exons 62 and 63 of the
DMD gene [27,28].
3.3. RT-PCR analysis of alternative splicing
of Dp71 transcripts in porcine retina
It is known that the transcript encoding the Dp71
C-terminal product of the DMD gene can generate multiple
proteinproductsasaresultofalternativesplicing[29–31].In
order to detect individual Dp71 mRNA populations, we
performed a cDNA amplification using a forward primer
corresponding to the specific 50-end of human Dp71 and a
reversed primerspecific tothe porcine Dp427 sequence. The
nested amplification of this PCR product with primers
spanningexons68and75oftheporcinedystrophinsequence
led to the identification of three porcine Dp71 spliced
transcripts lacking either exon 71 (39 bp), exon 74 (159 bp),
or the region comprised between exons 71 and 74 (330 bp)
(Fig. 3).
3.4. Detection of dystrophin and short protein
products in porcine retina
To investigate expression of the previously identified
porcine dystrophin transcripts at the protein level in retina,
total protein lysates from adult pig were examined by
Western blot analysis using the monoclonal pan-specific
antibody Dys2. As shownin Fig. 4,we detected the presence
offour bands in porcine retina homogenates. Comparison of
Fig. 2. Nucleotide and predicted amino acid sequences of the 50-end of short DMD gene products in various species. (A) The deduced amino acid sequence of
the N-terminus of porcine Dp260 is aligned with the previously reported 50-end sequences of human (NM_004012) and mouse (U15218) Dp260. (B) The
nucleotidesequencerepresentsthe specific50-endofDp140withno codingsequence.(C)ThededucedaminoacidsequenceoftheN-terminusofporcineDp71
is aligned with the previously reported 50-end sequences of human (NM_004015) and mouse (U00789) Dp71. The amino acids corresponding to the first and
specific exon of Dp71 are written in bold. The sequence used as forward primer in PCR experiments is underlined.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487481

Page 7

the apparent molecular masses of the detected proteins in
porcine retina with those of human and mouse homogen-
ates, clearly indicates that they correspond to full-length
dystrophin and the short products of the DMD gene Dp260,
Dp140 and Dp71. It should be noted that overexposure of
the same blot revealed, with an unavoidable background
increase, an additional band, with an apparent molecular
mass of 260 kDa (data not shown).
3.5. Localization of DMD gene products and DAPs
in the porcine retina
In order to determine, the cellular localization of DMD
gene products in porcine retina, serial retinal sections were
subjected toimmunohistochemistry with the exon78-specific
dystrophin antibody Dys2. For comparison, human retinal
sections were also included in our experiments. Dys2
produced a punctuate signal in the outer plexiform layer
(OPL) and staining around blood vessels, in both swine and
human retinae (Fig. 5(A) and (B)). In both cases, we also
observed a signal at the vitreal border of the retinae
corresponding to the inner limiting membrane (ILM),
which was less pronounced in the human sample. Close
analysis of the OPL labeling revealed the existence of two
differentpatterns ofstaining(Fig.5(C) and (D)). The firstone
consisted of a continuous line of dots aligned along the OPL,
whereas the second was formed by clusters of points grouped
in a row below the punctuate staining and positioned at
Fig. 3. AlternativesplicingwithinporcineDp71cDNA.(A)SchematicrepresentationoftheDp71cDNAandtheapproximatepositionsoftheoligonucleotideprimers
usedforRT-PCRandnestedPCRamplifications.(B)SequenceanalysisofDp71cDNAsinporcineretina.PCRproductswereobtainedafternestedamplificationwith
primersflankingexons68(F2)and75(R1).AlignmentofdeducedaminoacidsequenceofthenestedPCRproductsandthehumanDp71(NM_004015).Starsindicate
identity; dashes indicate gaps introduced to maximize similarity. Grey and white boxes represent coding and non-coding regions, respectively.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487482

Page 8

regular intervals along the OPL. Double staining experiments
with Dys2/PNA (a marker of cone photoreceptors) and Dys2/
PKCa (amarker ofrod bipolar cells)suggest that dystrophins
are presynaptically localized in porcine cone pedicles
(Fig. 5(F)) and also postsynaptically in bipolar cells
(Fig. 5(H)). In addition, we observed that antidystrophins
antibodies directed against different domains of the dystro-
phin molecule like the clone MANDYS8 (rod domain) or
H5A3 (peptide 3669–3685) revealed a similar staining to the
one observed with the Dys2 antibody (data not shown).
We further analyzed the localization of two dystrophin-
associated proteins involved in the DAPs complex: b-
dystroglycan and a1-syntrophin [32]. Immunostaining with
polyclonal anti-b-dystroglycan produced a similar pattern of
staining to Dys2, i.e. numerous immunoreactive dots
scattered throughout the OPL, surrounding blood vessels
and along the ILM as reported previously in mouse [33–36],
human [35,37] and bovine retina [38]. Considerable overlap
Fig. 5. Immunohistochemical analysis of the cellular localization of dystrophins in porcine and human retinae. Confocal fluorescence photomicrographs of
vertical sections through porcine (A), (C), (E)–(H) and human (B) and (D) retina immunolabeled with the Dys2 antibody. (C) and (D) Correspond to
enlargements of the OPL immunolabeled in (A) and (B), respectively. DMD gene products, detected by Dys2 antibody, are concentrated in the OPL, at the
ILM, and around blood vessels. Note the punctuate ((C) and (D), arrowhead) and row-like ((C) and (D), arrow) patterns of staining produced by dystrophin
antibodies in the OPL. Many Dys2 immunoreactive dots ((E), arrows) co-localize with PNA staining ((F), arrows) at the cone pedicles. Dys2 immunostaining
((G), arrows) co-localizes with PKCa immunostaining ((H), arrows) at the dendritic tips of rod bipolar cells. ONL, outer nuclear layer; OPL, outer plexiform
layer; INL, inner nuclear layer; IPL, inner plexiform layer; ILM, inner limiting membrane. Scale bars A–B: 25 mm; C–H: 2 mm.
Fig. 4. Immunoblot analysis of dystrophin gene products in porcine retina
usingthe pan-specificmonoclonalantibodyDys2(B).For comparison,DMD
gene products detected in human and mouse retinae with the same antibody
are also shown ((A) and (C), respectively). The apparent molecular mass in
kDa of dystrophin and short DMD gene products is indicated on the right.
Molecular weight markers are indicated on the left in kilodaltons.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487483

Page 9

of dystrophin and b-dystroglycan staining was observed
(Fig. 6(C) and (I)). Using an antibody directed against a1-
syntrophin, we detected a signal in the OPL, around blood
vessels, in the inner plexiform layer (IPL) and within the
photoreceptor outer segments. It can be observed (Fig. 6(F)
and (L)) that the OPL immunostaining for a1-syntrophin
differs from that of dystrophins. Simultaneous visualisation
of a1-syntrophin and PNA revealed the presence of a1-
syntrophin in cone outer segments (Fig. 6(O)).
4. Discussion
Eighty percent of DMD patients present an abnormal
electroretinogram, when recorded in scotopic (dark-adapted)
conditions, characterized by a large diminution of the b-wave
amplitude. The ERG can be defined as the measure of the
global electrical activity of the retina in response to light
recordedfromthecornea.Sothisphenotypestronglysuggests
a functional role of DMD gene products in retinal
Fig. 6. Confocal micrographs of porcine retina double immunostained with antibodies against dystrophins and dystrophin-associated proteins. Vertical retinal
sectionswere double-immunostained withantibodieseitheragainstdystrophins(A)and (G)and b-dystroglycan(B)and (H)oragainst dystrophins((D)and (J))
and a1-syntrophin (E) and (K). (G)–(L) Represent magnified views of the OPL staining shown in (A)–(F). (M)–(O) Correspond to an enlarged views of
photoreceptor outer segments co-labeled by PNA (M) and a1-syntrophin (N). The images in (C), (F), (I), (L), (O) were superimposed to reveal areas of co-
localization which appear yellow. Dystrophin (A) and b-dystroglycan (B) are expressed in the OPL (filled arrowheads), and are concentrated at the ILM
(arrow)andaroundthe bloodvessels (star).a1-syntrophin (E)and(K) isconcentratedatthe OPL(filledarrowhead)and alsolocalizedin thecone matrixsheath
((E), (N), (O), open arrowheads). OS, outer segments; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform
layer; ILM, inner limiting membrane. Scale bars A–F: 25 mm; G–O: 5 mm.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487 484

Page 10

neurotransmission. Despite intense research in the field over
many years, the underlying mechanisms and the relevant
cellular interactions underlying this phenotype are not fully
elucidated.
Among the different animal models of muscular
dystrophy, the mdx3cvmouse is the only one to show a
scotopic phenotype involving reduced amplitude of the b-
wave and a long implicit time. The non-overlapping
distribution of dystrophins and the fact that only the
mdx3cvhave the ERG alteration suggest that each DMD
gene product may have discrete functions within the retina
[16,36,39]. In support to this idea, targeted deletion of
Dp71, which is exclusively expressed by Mu ¨ller glial cells,
has shown that this DMD gene product is not directly
involved in b-wave generation [16]. This observation
further suggests that the DMD gene products localized in
the OPL are of critical importance in retinal visual
information processing.
As mentioned before, reduction of b-wave amplitude is
found in most DMD patients that have a diminution
(absence) of Dp427, whereas in mice a severe reduction in
expression of all dystrophin products is necessary to
reproduce this phenotype [40]. Thus, clear differences exist
in either the retinalcircuitry or the function ofdystrophins in
the retina between humans and mice, making the develop-
ment of other animal models necessary to determine the
cellular mechanisms underlying the visual defects of DMD
patients. The aim of this work was to establish the porcine
retinaasamoreaccuratemodeltostudythefunctionalroleof
dystrophins and DAPs in human diseases.
We cloned and characterized the porcine homologues of
the dystrophin gene. Additionally, by RT-PCR, immuno-
histochemistry and immunoblot analysis, we demonstrated
the presence of all the transcripts and protein products of
pig DMD gene in the retina. Moreover, the 30end of the
dystrophin gene exhibits a complex pattern of alternative
splicing in different systems, tissues and throughout
different developmental stages [29,41,42]. We identified
three alternatively spliced transcripts that occur at the C-
terminal end of dystrophin that correspond to those
reported in human brain [30,31,43]. These differentially
spliced isoforms may regulate binding of dystrophins to
dystrophin-associated proteins at the membrane [44].
Indeed these observations point to the existence of Dp71
proteins that may not interact with syntrophins since the
essential binding region for a1 and b1-syntrophin closely
corresponds to the sequence encoded by exon 73–74
[24,25]. We not only identified the same DMD gene
products in porcine retina, but also Dp71 splicing
mechanisms that are quite similar to the human.
Finally, using the Dys2 antibody, we showed that in
both porcine (Fig. 5(A)) and human [45] (Fig. 5(B)) retina,
dystrophins are localized in the OPL, around blood vessels
and along the ILM. Previous studies in our laboratory with
the same antibody revealed a nearly identical pattern of
staining in wild type mice, whereas in Dp71-null mice
only the OPL signal was visible [16]. Similarly, in human
and porcine retinae, full-length dystrophin, Dp260 and
Dp140 are localized in the OPL, and Dp71 is expressed in
Mu ¨ller glial cells. Uncertainly persists concerning the
cellular localization of DMD gene products in the OPL:
they have been localized to photoreceptor terminals in rats
and mice [46–48], but also to postsynaptic bipolar and
horizontal cells processes in rabbit and human [37,45,49].
Our present results in porcine retinae support the idea that
dystrophins are both pre- (Fig. 5(E) and (F)) and
postsynaptically located (Fig. 5(G) and (H)). Although
definitive proof of this hypothesis is still lacking, our
results demonstrate a much more similar distribution of
dystrophins between pig and humans than between mice
and humans.
In muscle, the function of dystrophin is intimately linked
toitsassociationwithdystrophinassociatedproteins(DAPs).
Thus, the dystrophin–DAPs complex links the extracellular
matrix tothe actin cytoskeleton.Ithasbeen suggested thatin
addition to its structural role, the DAPs complex also
regulatessignal transductionbybindingsignalingmolecules
thatcouldbetissuespecific.EveniftheseDAPsareessential
to dystrophin’s functions, to date the composition of the
complexinthecentralnervoussystemhasonlybeenpartially
elucidated. In rodent Mu ¨ller glial cells, we previously
showed the existence of a DAPs complex composed of
Dp71, b-dystroglycan, d-sarcoglycan, a1-syntrophin, a-
dystrobrevin and PSD-93 [50], which is involved in
clustering of Kir4.1 potassium channels and AQP4 water
channels [16]. Here we observed that the expression of a1-
syntrophin is independent of the presence of the DMD gene
products and/or b-dystroglycan. We observed a clear a1-
syntrophin signal in the photoreceptors outer segments
whereas, no immunostaining for dystrophins or b-dystrogly-
can could be detected. The identification of the binding
partners for either the dystrophins/b-dystroglycan complex
in the OPL or the a1-syntrophin cone photoreceptor outer
segments, would help to explain why the absence of
dystrophins in retina produces a relatively mild phenotype,
compared with the devastating muscle pathology. In this
context,thepigretinarepresentsanexcellentsourceoftissue
for such biochemical and functional studies and would
greatly facilitate attempts to identify proteins and protein
interactions in photoreceptors and bipolar cells.
In vitro swine retina systems [51–53] also provide an
opportunity to study the molecular and cellular events
linked to the specific knock-down expression of each one of
the DMD gene products without any of the compensatory
mechanisms observed in vivo. In summary, our results
demonstrate that all DMD gene products and some DAPs
such as b-dystroglycan and a1-syntrophin are expressed in
the porcine retina. We also show that these products are
localized in pig retina at the same locations as previously
described in humans and many other species.
Given the large size of the retina, the minimal
ethical constraints concerning the use of this tissue
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487485

Page 11

and the functional and structural similarities between human
and porcine retina, pig eyes can be considered a good model
for the study of the role of dystrophins in retinal physiology.
Acknowledgements
We thank Dr Hanneke Maas (Corneabank NORI,
Amsterdam) for generously supplying human retinae. We
thank Dr David Hicks for critical reading of the manuscript.
This work was supported by INSERM; University Pierre
and Marie Curie; Assistance Publique-Hopitaux de Paris;
Fe ´de ´ration des Aveugles de France, RETINA-France,
Association Franc ¸aise contre les Myopathies (AFM) and
the European Economic Community (RETRAINET:
HPRN-CT-2000-00098).
References
[1] Campbell KP. Three muscular dystrophies: loss of cytoskeleton–
extracellular matrix linkage. Cell 1995;80:675–9.
[2] BillardC, Gillet P,SignoretJL,et al. Cognitivefunctionsin Duchenne
muscular dystrophy: a reappraisal and comparison with spinal
muscular atrophy. Neuromuscul Disord 1992;2:371–8.
[3] SigesmundDA,Weleber RG, Pillers DA,et al. Characterization ofthe
ocular phenotype of Duchenne and Becker muscular dystrophy.
Ophthalmology 1994;101:856–65.
[4] Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C,
Kunkel LM. Complete cloning of the Duchenne muscular dystrophy
(DMD) cDNA and preliminary genomic organization of the DMD
gene in normal and affected individuals. Cell 1987;50:509–17.
[5] Koenig M, Monaco AP, Kunkel LM. The complete sequence of
dystrophin predicts a rod-shaped cytoskeletal protein. Cell 1988;53:
219–26.
[6] Ahn AH, Kunkel LM. The structural and functional diversity of
dystrophin. Nat Genet 1993;3:283–91.
[7] D’Souza VN, Nguyen TM, Morris GE, Karges W, Pillers DA,
Ray PN. A novel dystrophin isoform is required for normal retinal
electrophysiology. Hum Mol Genet 1995;4:837–42.
[8] Lidov HG, Selig S, Kunkel LM. Dp140: a novel 140 kDa CNS
transcript from the dystrophin locus. Hum Mol Genet 1995;4:329–35.
[9] Byers TJ, Lidov HG, Kunkel LM. An alternative dystrophin transcript
specific to peripheral nerve. Nat Genet 1993;4:77–81.
[10] Bar S, Barnea E, Levy Z, Neuman S, Yaffe D, Nudel U. A novel
product of the Duchenne muscular dystrophy gene which greatly
differs from the known isoforms in its structureand tissue distribution.
Biochem J 1990;272:557–60.
[11] Gee SH, Madhavan R, Levinson SR, Caldwell JH, Sealock R,
Froehner SC. Interaction of muscle and brain sodium channels with
multiple members of the syntrophin family of dystrophin-associated
proteins. J Neurosci 1998;18:128–37.
[12] Grady RM, Grange RW, Lau KS, et al. Role for alpha-dystrobrevin in
the pathogenesis of dystrophin-dependent muscular dystrophies. Nat
Cell Biol 1999;1:215–20.
[13] Hashida-Okumura A, Okumura N, Iwamatsu A, Buijs RM,
Romijn HJ, Nagai K. Interaction of neuronal nitric-oxide synthase
with alpha1-syntrophin in rat brain. J Biol Chem 1999;274:11736–41.
[14] Knuesel I, Mastrocola M, Zuellig RA, Bornhauser B, Schaub MC,
Fritschy JM. Short communication: altered synaptic clustering of
GABAA receptors in mice lacking dystrophin (mdx mice). Eur
J Neurosci 1999;11:4457–62.
[15] Pillers DM, Fitzgerald KM, Duncan NM, et al. Duchenne/Becker
muscular dystrophy: correlation of phenotype by electroretinography
with sites of dystrophin mutations. Hum Genet 1999;105:2–9.
[16] Dalloz C, Sarig R, Fort P, et al. Targeted inactivation of dystrophin
gene product Dp71: phenotypic impact in mouse retina. Hum Mol
Genet 2003;12:1543–54.
[17] Hendrickson A, Hicks D. Distribution and density of medium- and
short-wavelength selective cones in the domestic pig retina. Exp Eye
Res 2002;74:435–44.
[18] Rivier F, Robert A, Hugon G, et al. Dystrophin and utrophin
complexed with different associated proteins in cardiac Purkinje
fibres. Histochem J 1999;31:425–32.
[19] Bradford M. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein-dye
binding. Anal Biochem 1970;72:248–54.
[20] Jung D, Yang B, Meyer J, Chamberlain JS, Campbell KP.
Identification and characterization of the dystrophin anchoring site
on beta-dystroglycan. J Biol Chem 1995;270:27305–10.
[21] Rosa G, Ceccarini M, Cavaldesi M, Zini M, Petrucci TC. Localization
of the dystrophin binding site at the carboxyl terminus of beta-
dystroglycan. Biochem Biophys Res Commun 1996;223:272–7.
[22] Ponting CP, Blake DJ, Davies KE, Kendrick-Jones J, Winder SJ. ZZ
and TAZ: new putative zinc fingers in dystrophin and other proteins.
Trends Biochem Sci 1996;21:11–13.
[23] Blake DJ, Schofield JN, Zuellig RA, et al. G-utrophin, the autosomal
homologue of dystrophin Dp116, is expressed in sensory ganglia and
brain. Proc Natl Acad Sci USA 1995;92:3697–701.
[24] Ahn AH, Kunkel LM. Syntrophin binds to an alternatively spliced
exon of dystrophin. J Cell Biol 1995;128:363–71.
[25] Suzuki A, Yoshida M, Ozawa E. Mammalian alpha 1- and beta 1-
syntrophin bind to the alternative splice-prone region of the
dystrophin COOH terminus. J Cell Biol 1995;128:373–81.
[26] Sadoulet-Puccio HM, Rajala M, Kunkel LM. Dystrobrevin and
dystrophin: an interaction through coiled-coil motifs. Proc Natl Acad
Sci USA 1997;94:12413–8.
[27] Hugnot JP, Gilgenkrantz H, Vincent N, et al. Distal transcript of the
dystrophin gene initiated from an alternative first exon and encoding a
75-kDa protein widely distributed in nonmuscle tissues. Proc Natl
Acad Sci USA 1992;89:7506–10.
[28] Lederfein D, Yaffe D, Nudel U. A housekeeping type promoter,
located in the 30region of the Duchenne muscular dystrophy gene,
controls the expression of Dp71, a major product of the gene. Hum
Mol Genet 1993;2:1883–8.
[29] Feener CA, Koenig M, Kunkel LM. Alternative splicing of human
dystrophin mRNA generates isoforms at the carboxy terminus. Nature
1989;338:509–11.
[30] Austin RC, Howard PL, D’Souza VN, Klamut HJ, Ray PN. Cloning
and characterization of alternatively spliced isoforms of Dp71. Hum
Mol Genet 1995;4:1475–83.
[31] Austin RC, Morris GE, Howard PL, Klamut HJ, Ray PN. Expression
and synthesis of alternatively spliced variants of Dp71 in adult human
brain. Neuromuscul Disord 2000;10:187–93.
[32] Claudepierre T, Rodius F, Frasson M, et al. Differential distribution
of dystrophins inrat retina. Invest Ophthalmol Vis Sci 1999;40:1520–9.
[33] Montanaro F, Carbonetto S, Campbell KP, Lindenbaum M. Dystro-
glycan expression in the wild type and mdx mouse neural retina:
synaptic colocalization with dystrophin, dystrophin-related protein
but not laminin. J Neurosci Res 1995;42:528–38.
[34] Blank M, Koulen P, Blake DJ, Kroger S. Dystrophin and beta-
dystroglycan in photoreceptor terminals from normal and mdx3Cv
mouse retinae. Eur J Neurosci 1999;11:2121–33.
[35] Ueda H, Gohdo T, Ohno S. Beta-dystroglycan localization in the
photoreceptor and Muller cells in the rat retina revealed by
immunoelectron microscopy. J Histochem Cytochem 1998;46:
185–91.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487486

Page 12

[36] Dalloz C, Claudepierre T, Rodius F, Mornet D, Sahel J, Rendon A.
Differential distribution of the members of the dystrophin glyco-
protein complex in mouse retina: effect of the mdx(3Cv) mutation.
Mol Cell Neurosci 2001;17:908–20.
[37] Drenckhahn D, Holbach M, Ness W, Schmitz F, Anderson LV.
Dystrophin and the dystrophin-associated glycoprotein, beta-dystro-
glycan, co-localize in photoreceptor synaptic complexes of the human
retina. Neuroscience 1996;73:605–12.
[38] Schmitz F, Drenckhahn D. Localization of dystrophin and beta-
dystroglycan in bovine retinal photoreceptor processes extending into
the postsynaptic dendritic complex. Histochem Cell Biol 1997;108:
249–55.
[39] Howard PL, Dally GY, Wong MH, et al. Localization of dystrophin
isoform Dp71 to the inner limiting membrane of the retina suggests a
unique functional contribution of Dp71 in the retina. Hum Mol Genet
1998;7:1385–91.
[40] Pillers DA, Weleber RG, Green DG, et al. Effects of dystrophin
isoforms on signal transduction through neural retina: genotype–
phenotype analysis of duchenne muscular dystrophy mouse mutants.
Mol Genet Metab 1999;66:100–10.
[41] Lidov HG, Kunkel LM. Dp140: alternatively spliced isoforms in brain
and kidney. Genomics 1997;45:132–9.
[42] Bies RD, Phelps SF, Cortez MD, Roberts R, Caskey CT,
Chamberlain JS. Human and murine dystrophin mRNA transcripts
are differentially expressed during skeletal muscle, heart, and brain
development. Nucleic Acids Res 1992;20:1725–31.
[43] Ceccarini M, Rizzo G, Rosa G, Chelucci C, Macioce P, Petrucci TC.
A splice variant of Dp71 lacking the syntrophin binding site is
expressed in early stages of human neural development. Brain Res
Dev Brain Res 1997;103:77–82.
[44] Crawford GE, Faulkner JA, Crosbie RH, Campbell KP, Froehner SC,
Chamberlain JS. Assembly of the dystrophin-associated protein
complex does not require the dystrophin COOH-terminal domain.
J Cell Biol 2000;150:1399–410.
[45] Schmitz F, Holbach M, Drenckhahn D. Colocalization of retinal
dystrophin and actin in postsynaptic dendrites of rod and cone
photoreceptor synapses. Histochemistry 1993;100:473–9.
[46] Ueda H, Kobayashi T, Mitsui K, Tsurugi K, Tsukahara S, Ohno S.
Dystrophin localization at presynapse in rat retina revealed by
immunoelectron microscopy. Invest Ophthalmol Vis Sci 1995;36:
2318–22.
[47] Ueda H, Baba T, Terada N, Kato Y, Tsukahara S, Ohno S. Dystrophin
in rod spherules; submembranous dense regions facing bipolar cell
processes. Histochem Cell Biol 1997;108:243–8.
[48] Ueda H, Kato Y, Baba T, et al. Immunocytochemical study of
dystrophin localization in cone cells of mouse retinas. Invest
Ophthalmol Vis Sci 1997;38:1627–30.
[49] Koulen P, Blank M, Kroger S. Differential distribution of beta-
dystroglycan in rabbit and rat retina. J Neurosci Res 1998;51:
735–47.
[50] Claudepierre T, Dalloz C, Mornet D, Matsumura K, Sahel J,
Rendon A. Characterization of the intermolecular associations of
the dystrophin-associated glycoprotein complex in retinal Muller glial
cells. J Cell Sci 2000;113(Pt 19):3409–17.
[51] Winkler J, Hagelstein S, Rohde M, Laqua H. Cellular and cytoskeletal
dynamics within organ cultures of porcine neuroretina. Exp Eye Res
2002;74:777–88.
[52] Khodair MA, Zarbin MA, Townes-Anderson E. Synaptic plasticity in
mammalian photoreceptors prepared as sheets for retinal transplan-
tation. Invest Ophthalmol Vis Sci 2003;44:4976–88.
[53] Balse E, Tessier LH, Fuchs C, Forster V, Sahel J, Picaud S.
Purification of mammalian cone photoreceptors by lectin panning and
their increased survival in glia-conditioned medium. Invest Ophthal-
mol Vis Sci 2005;46(1):367–74.
A. Bordais et al. / Neuromuscular Disorders 15 (2005) 476–487487