RGS16 is a negative regulator of SDF-1-CXCR4 signaling in megakaryocytes.

Abstract

Regulators of G-protein signaling (RGS) constitute a family of proteins involved in the negative regulation of signaling through heterotrimeric G protein-coupled receptors (GPCRs). Several RGS proteins have been implicated in the down-regulation of chemokine signaling in hematopoietic cells. The chemokine stromal-cell-derived factor 1 (SDF-1) activates migration of hematopoietic progenitors cells but fails to activate mature megakaryocytes despite high levels of CXC chemokine receptor 4 (CXCR4) receptor expression in these cells. This prompted us to analyze RGS expression and function during megakaryocyte differentiation. We found that RGS16 and RGS18 mRNA expression was up-regulated during this process. Overexpressing RGS16 mRNA in the megakaryocytic MO7e cell line inhibited SDF-1-induced migration, mitogen-activated protein kinase (MAPK) and protein kinase B (AKT) activation, whereas RGS18 overexpression had no effect on CXCR4 signaling. Knocking down RGS16 mRNA via lentiviral-mediated RNA interference increased CXCR4 signaling in MO7e cells and in primary megakaryocytes. Thus, our data reveal that RGS16 is a negative regulator of CXCR4 signaling in megakaryocytes. We postulate that RGS16 regulation is a mechanism that controls megakaryocyte maturation by regulating signals from the microenvironment.

Full text

Page 1

doi:10.1182/blood-2005-02-0526
Prepublished online July 5, 2005;
2005 106: 2962-2968




Anne Galy, William Vainchenker and Fawzia Louache
Magali Berthebaud, Christel Rivière, Peggy Jarrier, Adlen Foudi, Yanyan Zhang, Daniel Compagno,
megakaryocytes
CXCR4 signaling in
−
RGS16 is a negative regulator of SDF-1

http://bloodjournal.hematologylibrary.org/content/106/9/2962.full.html
Articles on similar topics can be found in the following Blood collections
Updated information and services can be found at:
(1930 articles)Signal Transduction
?
(2497 articles)Hemostasis, Thrombosis, and Vascular Biology
?
(564 articles)Chemokines, Cytokines, and Interleukins
?

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#repub_requests
Information about reproducing this article in parts or in its entirety may be found online at:

http://bloodjournal.hematologylibrary.org/site/misc/rights.xhtml#reprints
Information about ordering reprints may be found online at:

http://bloodjournal.hematologylibrary.org/site/subscriptions/index.xhtml
Information about subscriptions and ASH membership may be found online at:
Copyright 2011 by The American Society of Hematology; all rights reserved.
Washington DC 20036.
by the American Society of Hematology, 2021 L St, NW, Suite 900,
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly




For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom

Page 2

CHEMOKINES, CYTOKINES,AND INTERLEUKINS
RGS16isanegativeregulatorofSDF-1–CXCR4signalinginmegakaryocytes
Magali Berthebaud, Christel Rivie `re, Peggy Jarrier, Adlen Foudi, Yanyan Zhang, Daniel Compagno, Anne Galy, William Vainchenker,
and Fawzia Louache
RegulatorsofG-proteinsignaling(RGS)con-
stitute a family of proteins involved in the
negativeregulationofsignalingthroughhet-
erotrimeric G protein–coupled receptors
(GPCRs). Several RGS proteins have been
implicatedinthedown-regulationofchemo-
kine signaling in hematopoietic cells. The
chemokine stromal-cell–derived factor 1
(SDF-1) activates migration of hematopoi-
etic progenitors cells but fails to activate
mature megakaryocytes despite high levels
of CXC chemokine receptor 4 (CXCR4) re-
ceptor expression in these cells. This
prompted us to analyze RGS expression
andfunctionduringmegakaryocytedifferen-
tiation. We found that RGS16 and RGS18
mRNA expression was up-regulated during
thisprocess.OverexpressingRGS16mRNA
in the megakaryocytic MO7e cell line inhib-
ited SDF-1–induced migration, mitogen-
activatedproteinkinase(MAPK)andprotein
kinase B (AKT) activation, whereas RGS18
overexpression had no effect on CXCR4
signaling.KnockingdownRGS16mRNAvia
lentiviral-mediated RNA interference in-
creasedCXCR4signalinginMO7ecellsand
in primary megakaryocytes. Thus, our data
reveal that RGS16 is a negative regulator of
CXCR4 signaling in megakaryocytes. We
postulatethatRGS16regulationisamecha-
nism that controls megakaryocyte matura-
tionbyregulatingsignalsfromthemicroen-
vironment.(Blood.2005;106:2962-2968)
© 2005 by TheAmerican Society of Hematology
Introduction
Chemokines and their receptor(s) are broadly expressed in different
tissues and regulate cell migration as well as several other important
biologic processes.1The chemokine stromal-cell–derived factor 1
(SDF-1) is a stromal-cell–derived factor that interacts with a specific
receptor CXC chemokine receptor 4 (CXCR4) and plays a role in B
lymphopoiesis and bone marrow myelopoiesis. Studies using mutant
mice with targeted gene disruption have revealed that SDF-1 and
CXCR4 are essential for B-cell differentiation, for colonization of bone
marrowbyhematopoieticstemcells(HSCs)andmyeloidlineageduring
ontogeny as well as for blood-vessel formation in gastrointestinal tract,
cardiac ventricular septum formation, and cerebellar differentiation.2,3
SDF-1CXCR4 signaling appears to be essential for the homing of
hematopoietic stem/progenitor cells because treatment of immature
human hematopoietic progenitor cells with anti-CXCR4 antibodies
prevents their short-term engraftment into nonobese diabetic/severe
combinedimmunodeficient(NOD/SCID)mice.4-6Inaddition,transplan-
tation of CXCR4?/?fetal liver cells results in low numbers of
B-lymphoid and myeloid lineage precursors in bone marrow but
increased numbers in the peripheral blood compared with control
animals.7Proteolytic cleavage of the N-terminus of CXCR4 and of
SDF-1 is one mechanism that has been identified for the regulation of
CXCR4/SDF1signalingincirculatingandmobilizedbloodcells.8
The process of megakaryopoiesis occurs within a complex bone
marrow microenvironment where chemokines, cytokines, and adhesive
interactions play a major role.At the end of their maturation, polyploid
megakaryocytes (MKs) migrate through bone marrow endothelial cells
and release platelets directly into the marrow-intravascular sinusoidal
space or the lung capillaries. The interactions of immature MKs with a
permissive, endothelial-enriched microenvironment is promoted by
chemokines,includingSDF-1.9Consistentwiththisprocess,CXCR4is
expressedallalongthemegakaryocytedifferentiationfromMKprogeni-
torstoplatelets.10-14However,duringMKdevelopment,theoutcomeof
CXCR4 signaling as measured by chemotaxis and extracellular signal
regulated protein kinase (Erk) activation becomes markedly reduced,
indicating the presence of possible negative regulators. Such mecha-
nisms have remained elusive. Recent studies have shown that CXCR4
signaling is regulated by Regulators of G-protein signaling (RGS)
proteins in mature B cells.15,16Reminiscent of the MK differentiation,
CXCR4 expression is maintained all along the B-cell maturation, but
matureBcellsfailtorespondtoSDF-1.17
RGS proteins have emerged as major modulators of signaling
for heterotrimeric guanine nucleotide binding proteins (G pro-
teins). Heterotrimeric G proteins are the link between many
receptors,includingchemokines,anddownstreameffectors.Hetero-
trimeric G proteins are composed of ?, ?, and ? subunits, each
having multiple isoforms; that is, 4 isoforms for the ? subunit: ?i,
?s, ?q, and ?12. Ligand-bound activated receptors catalyze the
exchange of guanosine diphosphate (GDP) by guanosine triphos-
phate (GTP) on the ? subunit, leading to dissociation of the ? form
from the ?? dimer, which both transduce the signal to effectors.
From the Institut National de la Sante ´ et de la Recherche Me ´dicale (INSERM) U
362, Institut Gustave Roussy, Villejuif, France; and the Ge ´ne ´thon, Evry, France.
Submitted February 7, 2005; accepted June 21, 2005. Prepublished online as
Blood First Edition Paper, July 5, 2005; DOI 10.1182/blood-2005-02-0526.
Supported by grants from INSERM, the Gustave Roussy Institute (IGR) (grant
CRI-SPS-2003-02) (F.L.) and the Association pour la Recherche contre le
Cancer (grant 4309) (F.L.), by fellowships from La Ligue Nationale contre le
Cancer (M.B. and C.R.) and Fondation pour la Recherche Me ´dicale (D.C.), and
by theAssociation pour la Recherche contre le Cancer (A.F. and Y.Z.).
M.B. designed and performed the experiments, analyzed the data, and wrote
the paper; C.R. designed and performed the experiments and assisted in
writing the manuscript; P.J., A.F., Y.Z., and D.C. designed and performed the
experiments; A.G. designed the experiments and assisted in writing the
manuscript; W.V. assisted in writing the manuscript; and F.L. designed the
experiments, analyzed the data, and wrote the paper.
An Inside Blood analysis of this article appears in the front of this issue.
Reprints: Fawzia Louache, INSERM U362, Institut Gustave Roussy, PR1, 39
rue Camille Desmoulins, 94805 VILLEJUIF Cedex, France; e-mail: fawl@igr.fr.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
© 2005 by TheAmerican Society of Hematology
2962BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.org From

Page 3

RGS proteins function as guanosine triphosphatase-activating
proteins (GAPs) for G? subunits, accelerating the inactivation rate
of G?-GTP.18-20So far, RGS proteins that have been identified
interact with and activate members of the G?i family, G?q, and
G?12/13 but not G?s.21In addition to their GAPactivity, RGS may
also block signaling by acting as effector antagonists.22,23Overex-
pression of RGS1, RGS3, and RGS4 in a pre–B-lymphoma cell line
has been shown to reduce interleukin 8 (IL-8; CXCR1) and
monocyte chemoattractant protein-1 (MCP-1; CCR2) induced
activation.24RGS16 inhibits IL-8 and RANTES (regulated on
activation normal T cell expressed and secreted) (CCR5)–mediated
signals in lymphocytes.25Leukotriene B4, C5a, and fMLP(formyl-
Met-Leu-Phe) responses are abolished by the introduction of RGS1
in the monocytic cell line THP1.26RGS1 has been shown to be
involved in the down-regulation of chemotaxis mediated by
lymphoid chemokines, including SDF-1.27,28
Megakaryocytes express RGS16 and RGS18 proteins,29,30but
the pattern of expression during differentiation has not been
examined in these studies. We herein describe an up-regulation of
RGS16 and RGS18 expression during MK differentiation. Overex-
pression of RGS16 but not of RGS18 markedly diminished
SDF-1–mediated migration, protein kinase B (AKT), and Erk
activation of MO7e cells. Using RNA interference, we inhibited
RGS16 in MO7e cells and in CD34?-derived MKs, leading to the
increase of CXCR4 signaling. The RGS16 knocking down did not
modify platelet formation and adhesion of MKs to either fibronec-
tin or collagen I. Altogether, results suggest that RGS16 is a
negative regulator of SDF-1/CXCR4 signaling in megakaryocytes.
Materials and methods
Cell culture
MO7e cells were cultured in ?-minimal essential medium (?MEM)
supplemented with 10% fetal calf serum, penicillin/streptomycin/glutamine
(Invitrogen, Cergy-Pontoise, France) and with 10 ng/mL granulocyte-
macrophage colony-stimulating factor (GM-CSF; Novartis, Basel, Switzer-
land). 293 EBNA cells were cultured in Dulbecco modified Eagle medium
(DMEM) supplemented with fetal calf serum (FCS) and antibiotics.
Cord-blood samples from healthy full-term newborn infants were
obtained from a cord-blood bank (Clinique Les Noriets, Vitry-sur-Seine,
France) in agreement with national ethics guidelines. Low-density mono-
nuclear cells (LDMCs) were prepared by centrifugation on Lymphoprep
(Nyegaard, Oslo, Norway). CD34?cells were separated using a magnetic
cell-sorting system (miniMACS; Miltenyi Biotech GmbH, Bergisch Glad-
bach, Germany) according to the manufacturer’s recommendations. The
purity of the recovered CD34?cells was greater than 90%. CD34?cells
were cultured in Iscoves modified Dulbecco medium (IMDM) with
penicillin/streptomycin/glutamine and 11.5 mM ?-thioglycerol (Sigma,
Saint Quentin Fallavier, France) supplemented with 1.5% bovine serum
albumin (BSA; Cohn fraction V; Sigma), sonicated lipids, and iron-
saturated human transferrin (Invitrogen) and were stimulated with the
combination of recombinant human thrombopoietin (TPO; 10 ng/mL) and
stem-cell factor (SCF; 50 ng/mL) (generous gifts of Kerin Brewery, Tokyo,
Japan and Amgen, Thousand Oaks, CA, respectively) (MK medium) as
previously described.31Cells were stained with anti-CD34–fluorescein
isothiocyanate(FITC),anti-CD41–allophycocyanin(APC),andanti-CD42–
phycoerythrin (PE) antibodies (BD Biosciences, le Pont de Claix, France).
Different populations (CD34?CD41?CD42?, CD41?CD42low, and
CD41?CD42?) were sorted on a fluorescence-activated cell sorting (FACS)
DIVAcytometer (Becton Dickinson, Rungis, France).
Plasmid constructions
The complete coding region of RGS16 (1.3 kilobase [kb]) was amplified by
polymerase chain reaction (PCR) from DAUDI cDNA using 5? and 3?
primers each containing a KpnI site (underlined), as follows: sense,
5?-ACGGGTACCATGTGCCGCACCCTGGCCGC-3?, and antisense, 5?-
TCCCCATGGTCAGGTGTGTGAGGGCTCGTC-3?.TheamplifiedcDNA
was subcloned into the PCR-TOPOII (topoisomerase II) expression vector
(Invitrogen) and sequenced. RGS16 cDNA was then inserted at the
C-terminal end of the enhanced green fluorescent protein (eGFP) into a
retroviral vector pSF1N (kindly provided by Dr Ostertag, Germany). The
RGS18 cDNA (Guthrie cDNA Resource Center, Sayre, PA) was inserted
into the retroviral vector Migr-IRES-GFP.
To inhibit RGS16 expression, we designed small interfering RNA(siRNA)
using Ambion software (Ambion, Huntingdon, United Kingdom). From these
sequences,smallhairpinswerecreatedaspreviouslydescribed.32,33Oligonucleo-
tidesshorthairpin(sh)RGS16listedinTable1weresynthesized(Invitrogen)and
inserted into a pBlue Script containing the human H1 promoter. The H1-
shRGS16 or H1-SCR (scramble sequence) unit was inserted into a HIV-derived
lentiviralvector(pRRLsinPGKeGFPWPRE;Ge ´ne ´thon,Evry,France).
Viral infectious particles production
The retrovirus-producing cell line 293 expressing Epstein-Barr virus
nuclear antigen-1 (EBNA) was maintained in DMEM with 10% FCS and
250 ?g/mL G418 (Invitrogen). Vesicular stomatitis virus glycoprotein
(VSV-G) pseudotyped retroviruses were produced by transient transfection
of 293 EBNA with 3 different constructs. The expression plasmids,
pCMV-G, which contained the VSV-G coding sequence, and pCMV-gag-
pol, which contained the Gag-Pol coding sequence, were kindly supplied by
Dr J. Morgenstern (Millenium, Boston, MA). The third vector was the
retroviral vector pSF1N, containing individual GFP-RGS coding sequence
or Migr for RGS18. Transfection was performed using the Exgen reagent
(Euromedex, Mundolsheim, France) according to the manufacturer’s
protocolexceptthat500ngofeachplasmidand7.5?LExgenwereusedfor
each 36-mm well. Supernatant containing infectious retroviral particles was
recovered after 2 and 3 days of culture. Viral titers were determined by
limitingdilutionassaywithNIH3T3cells,onthebasisofGFPfluorescence.
Lentiviral stocks were prepared by transient cotransfection in human 293T
cells of 3 plasmids (pRRL with SCR or shRGS16 sequence, the packaging
plasmid pCMV?R8,74, and the VSV-G protein envelope plasmid pMD.G).
Lipofectamine 2000 (Invitrogen) was used for transfection according to the
manufacturer’s instructions. The concentration of viral particles was defined by
limitingdilutionassaywithNIH3T3cellsasforretroviruses.
Test of pBS-H1-shRGS16 on EBNA cells
EBNA cells were transfected using the Exgen technique as just described
with 2 plasmids pBS-H1-shRGS16 and MIGR-IRES-eGFP as a marker of
transfection efficiency. Cells containing plasmid with different sequences of
shRGS16 were analyzed 48 hour after transfection and sorted on the eGFP
level using a FACS DIVAflow cytometer (Becton Dickinson).
Cell infection
MO7e cells were infected with supernatant, using a multiplicity of infection
(MOI) of 10 viruses per cell, in the presence of 4 ?g/mL hexadimethrine
bromide (Sigma). Cells were cultured for 24 hours and then reinfected in the
sameconditions.GFP-expressingcellsweresortedusingFACSVantage(Becton
Dickinson)andmaintainedinculturein?MEMmediumcontainingGM-CSF.
MKs were infected after 2 days of stimulation of CD34?cells with
TPO (10 ng/mL) and SCF (50 ng/mL) in MK medium. Cells were
infected twice with a multiplicity of infection of 50, in the presence of 4
Table 1. Oligonucleotide short hairpin sequences (SEQs) used
for RGS16 inhibition
shRGS16
SEQ2
SEQ15
SEQ24
SEQ43
SEQ68
SEQ73
GACACGTCTGGGGATCTTTttcaagagaAAAGATCCCCAGACGTGTC
GATCCGATCAGCTACCAAGttcaagagaCTTGGTAGCTGATCGGATC
GAGAGGTTGAGTCACCCATttcaagagaATGGGTGACTCAACCTCTC
GGGCTAATGATGAGGGTTGttcaagagaCAACCCTCATCATTAGCCC
ATAAGTCTCTTGGCGGTCCttcaagagaGGACCGCCAAGAGACTTAT
AGAGATGCCCCGAGATAGAttcaagagaTCTATCTCGGGGCATCTCT
RGS16 SIGNALING IN MEGAKARYOCYTES 2963BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom

Page 4

?g/mL hexadimethrine bromide (Sigma). Cells were stained with an
anti-CD41–APC antibody and sorted to obtain CD41?GFP?and
CD41?GFP?populations for mRNA analysis and proplatelet formation.
Cells were stained with an anti-CD34–PE antibody and sorted to obtain
CD34?GFP?populations for MK colony-forming unit (CFU-MK) assay.
mRNA analysis using real-time RT-PCR
Total RNAwas isolated from sorted megakaryocytes, platelets, MO7e cells,
and EBNA cells using the SV total RNA isolation kit (Promega, Charbon-
nie `res, France). cDNA was generated by reverse transcription using
Superscript II RNase H-reverse transcriptase (Invitrogen). The expression
levels of RGS and the internal reference ?2-microglobulin (?2m) were
measured by triplicate PCR which were performed using the ABI PRISM
GeneAmp 5700 sequence Detection system and theTaqMan Universal PCR
master Mix (PE Applied Biosystems, Courtaboeuf, France). The primers
and probes were designed using Primer Express software and are listed in
Table 2.Acomparative threshold cycle (CT) method was used to determine
gene expression. Indeed, the RGS CTvalue was normalized to the ?2m CT
value using the formula: 2?(CTRGS ? CT?2m). RNAsamples were not used that
exhibited fluorescein amidite (FAM)–labeled reverse transcription-
quantitative polymerase chain reaction (RT-QPCR) products with CTvalues
greater than 37. This is because inaccurate and unreliable relative expres-
sion values might be obtained. All samples demonstrated CTvalues less
than 27 for FAM-labeled RT-QPCR products, indicating the samples
contained undegraded cDNAthat could be amplified.
Chemotactic assay
Cell migration was quantified through 5-?m pore filters for the MO7e cell
line and 8-?m pore filters for MKs (Transwell, 24-well cell clusters; VWR,
Strasbourg, France). Serum-free medium (200 ?L) containing 2 ? 105cells
was placed in the upper well of the transwell. In the lower chamber, 600 ?L
medium containing 300 ng/mL SDF-1? (Abcys, Paris, France) was added.
After 4 hours at 37°C in 5% CO2, the cells of the lower chamber and the
starting population were recovered in equal volumes, and the percentage of
migration was calculated according to the following formula: number of
cells in the lower well divided by the total cells put in the transwell at the
beginning. The number of cells and their GFP levels were analyzed on a
FACSsort (Becton Dickinson). For megakaryocytes, cells in the lower
chamber and the total cells were stained using anti-CD41–APC and
anti-CD42–PE antibodies after migration and analyzed on a FACSsort.
Analysis of p42/44MAP kinase and AKT activation
by Western blot
After 12 hours of serum and GM-CSF starvation, stably infected MO7e
cells (RGS16, RGS18 or GFPalone) were stimulated or not with 300 ng/mL
SDF-1 for 1 and 5 minutes. Equal amounts of proteins (30 ?g) were
transferred onto nitrocellulose. Endogenous mitogen-activated protein
(MAP) kinase activity was detected with an antibody specific for the p42/44
phosphorylated forms of MAP kinase (Cell Signaling, Beverly MA). AKT
activity was detected by an antibody against phospho-AKT (Cell Signal-
ing). Goat anti–rabbit horseradish peroxidase (HRP)–conjugated antibodies
(Santa Cruz Biotechnologies, Santa Cruz, CA) were used to detect bound
primary antibodies by enhanced chemiluminescence. The membranes were
reprobedwithanantibodydirectedagainsttotalp42/44MAPkinaseortotalAKT
(CellSignaling)tocheckthatproteinamountswerepresentineachsample.
Cell adhesion
Fibronectin(50?g/mL;Sigma)andcollagentypeI(100?g/mL)wereincubated
in 48-well plates for 2 hours at room temperature. After washing, plates were
blocked with BSA for 1 hour at room temperature. pRRL-SCR or pRRL-24
CD41?/GFP?sorted cells were then plated (5000 cells/well in 200 ?L MK
medium) for 15 minutes at 37°C, and SDF-1 (300 ng/mL) was added or not for
another15minutesat37°C.Wellswereemptiedandwashed.Adherentcellswere
then fixed in 2% paraformaldehyde and counted under an inverted microscope.
The percentage of cell adhesion corresponds to the number of adherent cells
versusthenumberoftotalcellsplated(5000cells/well).
CFU-MK assay
pRRL-SCR or pRRL-24 CD34?/GFP?sorted cells were performed by the
plasma clot technique, as previously described.34Briefly, 2000 cells/dish
were plated in MK medium supplemented with bovine plasma fibrinogen (1
mg/mL; Sigma), ? amino caproic acid (0.01 mol/L; Sigma), thrombin (6
mU/mL),TPO (10 ng/mL), and SCF (50 ng/mL). Petri dishes were cultured
at 37°C for 12 days. Colonies were quantified by an indirect immunophos-
phatase alkaline labeling technique using an anti–glycoprotein III (GpIIIa)
polyclonal antibody (Dako, Glostrup, Denmark). CFU-MK were counted
under an inverted microscope.
Quantification of proplatelet formation
pRRL-SCR or pRRL-24 CD41?/GFP?sorted cells were cultured in
96-well plates at the concentration of 200 cells/well in 100 ?LMK medium
plus TPO and SCF for 8 days at 37°C. Proplatelets were defined as cells
exhibiting one or more cytoplasmic processes with constriction areas. MK
and proplatelets were counted under an inverted microscope.
Statistical analysis
Results of experimental points obtained from 3 repeated experiments are
reported as the mean plus or minus standard deviation (SD). Statistical
significance was determined using Student t test.
Results
RGS16 and RGS18 mRNA expression is enhanced during
megakaryocyte maturation
It has been previously reported that RGS16 and RGS18 mRNA are
expressed by megakaryocytes.29,30,35This prompted us to analyze
whether these RGSs were regulated during the process of MK differen-
tiation which is known to be associated with reduced SDF-1 response.
MKswerederivedfromcultureofcord-bloodCD34?cells,andcellsat
various stages of development were obtained from these cultures using
flowcytometriccellsortingonthebasisoftheCD34,CD41,andCD42
markers (Figure 1A). CD34?cells constitute progenitor cells, whereas
CD41?CD42lowcellsareenrichedinimmatureMKsandCD41?CD42?
cellsinmaturemegakaryocytes.TotalmRNAwasisolatedfromeachof
these 3 populations, and the level of RGS16 and RGS18 was analyzed
by quantitative RT-PCR. To control for differences in mRNA loading,
the intensity of RGS16 and RGS18 signal was normalized to the
housekeeping ?2-microglobulin gene (Figure 1B). RGS18 transcripts
weredetectedinall3populations.RGS18expressionincreased13-fold
fromimmatureprogenitors(CD34?CD41?CD42?)tothemoremature
cells (CD41?CD42?). The amounts of RGS16 transcripts were mark-
edly lower than RGS18 transcripts in all 3 populations. Similarly to
RGS18, RGS16 mRNA expression increased 6-fold from immature
progenitors (CD34?CD41?CD42?) to the more mature cells
Table 2. Primers and probes designed with Primer Express
Human geneSequence (5?33?)
RGS16
Forward
Reverse
FAM probe
RGS18
Forward
Reverse
FAM probe
?2-Microglobulin
Forward
Reverse
FAM probe
TCCAGGGCACACCAGATCTT
TGGCAGTCTGCAGGTTCATC
CAGTGAGGCCCCTAAAGAGGTCAACATTG
TGAATTCAGTGAGGAGAACATTGAAT
TTTCTCATAGATTGCCTTTGCTTTTA
CTTCAAGAAATGCAAGGAACCTCAACAAATCAT
GCGGCATCTTCAAACCTCC
TGACTTTGTCACAGCCCAAGATA
TGATGCTGCTTACATGTCTCGATCCCACTT
2964 BERTHEBAUD et alBLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom

Page 5

(CD41?CD42?). In contrast to RGS16, RGS18 mRNA expression
remains high in platelets (Figure 1C). These results indicate that both
RGS16andRGS18mRNAareup-regulatedduringMKdifferentiation.
RGS16 but not RGS18 inhibits SDF-1–induced chemotaxis,
AKT and Erk activation in the MO7e cell line
RGS proteins are involved in the negative regulation of G
protein–coupled receptors (GPCRs) and have been shown to
modulate CXCR4 signaling.36-38To probe the regulatory activity of
RGS16 and RGS18 on CXCR4 signaling, we constructed a
retroviral vector encoding an RGS16-GFPfusion protein according
to previous studies which showed that RGS1, RGS3, and RGS4
fusion proteins have similar activities as the wild-type RGS
proteins.24This construct was inserted into the pSF1N retrovirus
and the RGS18 cDNA into the MIGR retrovirus, which gave both
efficient transduction and high transgene expression in hematopoi-
etic cells. Because of both the MK phenotype and efficient
migratory response to SDF-1, the MO7e cell line was chosen for
further study. Infection rates were evaluated to be about 80% as
assessed by GFP expression in populations of stably transduced
cells. GFP?polyclonal populations (MO7e GFP, MO7e RGS16,
and MO7e RGS18) were isolated by flow cytometry, and levels of
expression of the various RGS constructs were evaluated by
RT-PCR. As shown in Figure 2A, RGS16 mRNA level in MO7e
RGS16 cells was 200-fold higher than RGS16 mRNA level in
MO7e GFP cells. Similarly, RGS18 mRNA was 150-fold higher
than endogenous RGS18 mRNAlevel obtained in MO7e GFPcells
(Figure 2B). In MO7e RGS16 cells, overexpression of RGS16 did
not alter the expression of RGS18 and vice versa.
Then we studied the effects of RGS16 and RGS18 overexpres-
sions on SDF-1–induced chemotaxis in MO7e cells. RGS18
overexpression did not affect SDF-1–induced chemotaxis (Figure
2C). In contrast, RGS16 overexpression in MO7e cells was very
effective in inhibiting SDF-1–mediated migration (75% inhibition
compared with control cells transduced with GFP only). We
subsequently tested the effect of these RGS overexpressions on the
SDF-1–induced MAPK and AKT activation by Western blot. As
shown in Figure 2D, MO7e GFP cells exhibited a strong Erk and
AKT phosphorylation in response to SDF-1.Activation of CXCR4
by SDF-1 also induced a significant Erk and AKT activation in
MO7e RGS18 cells. In contrast, MO7e RGS16 exhibited a lower
Erk and AKT phosphorylation in response to SDF-1 as compared
with MO7e GFP and MO7e RGS18. Thus, RGS16 protein overex-
pression led to the inhibition of SDF-1–mediated migration and
intracellular signaling.
Inhibition of RGS16 expression using lentiviral-delivered short
hairpin RNA
Results on the MO7e cell line prompted us to check whether
RGS16 was implicated in SDF-1/CXCR4 signaling in primary
megakaryocytes,usingRNAinterference.siRNAsequencesspecificfor
RGS16 mRNAwere designed using theAmbion software available on
the Internet and constructed as shRNA composed by forward and
reverse sequences coding for siRNA linked by a short hairpin as
described.33ThedifferentcDNAshRNAs(shRGS16)wereinsertedinto
apBlueScriptvectorcontainingthehumanH1polymeraseIIIpromoter
(Figure 3A). These different expression vectors were transfected into
EBNA cells to assess endogenous RGS16 mRNA inhibition. EBNA
cells were cotransfected with MIGR, a retrovirus vector containing the
eGFP, which was used as a marker of transfection efficiency. GFP?
Figure 1. Expression of RGS16 and RGS18 during MK differentiation. Cord-
blood CD34?cells were cultured in MK medium with TPO and SCF. (A) Flow
cytometry analysis of MK culture. Different fractions were sorted using the CD34,
CD41, and CD42 markers. Cells were acquired in a morphologic gate which excluded
dying cells. CD34?CD41?CD42?subsets were sorted after staining cells with an
anti-CD34–FITC antibody. Numbers in the quadrants represent the percentage of
each population in the culture. (B) Level of mRNA expression in these fractions. ?
indicates the immature CD34?-cell fraction (CD34?, CD41?, CD42?); u, the
immature MKs (CD41?, CD42low); f, the mature fraction (CD41?, CD42?). *P ? .01.
Data are mean ? SD of 3 independent experiments performed in triplicate. (C) Level
of RGS16 and RGS18 mRNA expression in platelets. mRNA was extracted from
these cells, and quantitative RT-PCR with specific primers for RGS was performed as
described in “Materials and methods.” ?2-Microglobulin amplification was used to
confirm that the samples contained similar amounts of cDNAs. Data represent the
mean ? SD of 3 independent experiments.
Figure 2. Overexpression of RGS16 and RGS18 in MO7e cell line. MO7e cells were infected with retroviruses containing RGS16 or RGS18. These and the control cells,
which contain only the GFP, were sorted and analyzed. (A) Level of overexpression of RGS16 in MO7e RGS16 cells. Quantitative RT-PCR was performed, and RGS mRNA
level was compared with the ?2m mRNA level. This histogram represents the mRNA quantity of exogenous RGS in MO7e RGS16 and in MO7e RGS18. (B) Level of
overexpressionofRGS18inMO7eRGS18cellline.QuantitativeRT-PCRwasperformed,andRGSmRNAlevelwascomparedwiththe?2mmRNAlevel.Thishistogramrepresentsthe
mRNAquantityofRGSinMO7eRGS16andMO7eRGS18cells.(C)SDF-1–inducedmigrationofMO7eGFP,MO7eRGS16,andMO7eRGS18cells.Datarepresentthepercentageof
migratedcellscomparedwithtotalinputcells.Thegraphshowsthemean?SDof4independentexperimentsperformedinduplicate.*P ? .01.(D)EffectofRGSproteinoverexpression
on the Erk andAKT activation pathway. MO7e GFP, MO7e RGS16, and MO7e RGS18 cell lines were starved of serum and GM-CSF for 12 hours and were stimulated or not with 300
ng/mLSDF-1 for the times indicated. (D) Erk andAKTactivation was analyzed by Western blot analysis using an anti–phospho-Erk (P-Erk) antibody and an anti–phospho-AKT(P-AKT)
antibody.Proteinloadingwasassayedbylabelingwithananti-Erkantibody(TotalErk)andananti-AKTantibody(TotalAKT).
RGS16 SIGNALING IN MEGAKARYOCYTES 2965BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.org From

Page 6

EBNAcells were sorted and analyzed by quantitative RT-PCR to assay
the mRNA level of RGS16. Five of 6 shRGS16 sequences inhibited
RGS16 mRNAlevels by 2-fold or more (Figure 3 B). SEQ24 was the
mosteffective(a3-folddecrease)andwaschosen,aswellastheSEQ15
orascramblecontrolirrelevantsiRNA,toconstructlentiviralvectorsto
stablyexpressanti-RGS16siRNAintomegakaryocytes.
Inhibition of RGS16 expression in megakaryocytes
up-regulates SDF-1/CXCR4 signaling
MO7e cells were infected with different lentiviral vectors encoding
shRNASEQ15, shRNASEQ24, or SCR control shRNA, together
with a reporter GFP gene. Transduced GFP?cells were purified
and analyzed by quantitative RT-PCR. A 3-fold decrease in the
expression of RGS16 mRNAwas observed with the pRRL-SEQ24
in comparison to pRRL-SCR, whereas no inhibition was observed
with pRRL-SEQ15 (Figure 4A).The lack of efficacy of the SEQ15
constructed in the lentiviral vector was surprising compared with
the inhibition obtained by transfection of SEQ15 plasmid in EBNA
cells. This difference may be due to a lower number of SEQ15
siRNA obtained after transduction compared with transfection.
Nevertheless, the lentiviral vector encoding SEQ24 was efficient
and allowed the study of SDF-1–induced migration in MO7e cells
(Figure 4B). Cell migration was increased by 68% in cells with
pRRL-SEQ24, confirming that RGS16 modulates the SDF-1/
CXCR4 signaling in MO7e cell line.
We have shown that RGS16 expression increased during MK
differentiation. This correlates with the SDF-1 responsiveness of
the mature MKs. Thus, the effect of an inhibition of RGS16
expression on SDF-1–induced migration of primary MKs was
evaluated. Cord-blood CD34?cells were stimulated 2 days with
TPO and infected twice with the RGS16 siRNA. After 7 days of
culture, pRRL-SCR GFP?/CD41?, pRRL-SEQ24 GFP?/CD41?,
and GFP?/CD41?were obtained by flow cytometry cell sorting.
Analysis of RGS16 mRNA expression (Figure 5A) revealed a
2-fold decrease in pRRL-SEQ24 GFP?/CD41?in comparison to
the 2 control populations, which exhibited similar RGS16 mRNA
levels. Moreover, the SDF-1–induced MK migration was investigated.
Figure 5B illustrates the percentage of CD41?/CD42?cells that
migrated in response to SDF-1. SDF-1–induced migration of MK
expressing RGS16 siRNA was increased by 57%, suggesting that
RGS16modulatesnegativelyCXCR4signalinginprimaryMKs.
Adhesion assays of pRRL-SCR GFP?/CD41?and pRRL-
SEQ24 GFP?/CD41?cells on fibronectin and collagen I were
performed as described in “Materials and methods.” As shown in
Figure 5C, a significant fraction of megakaryocytes were shown to
adhere to fibronectin and collagen I. However, we did not find any
change in the adhesion to these extracellular matrix after RGS16
knocking down either in the presence or absence of SDF-1,
suggesting that the level of RGS16 expression did not modify basal
or SDF-1–induced adhesion to either fibronectin or collagen I.
Effects of RGS16 knocking down on megakaryopoiesis
and platelet production
We studied whether inhibition of RGS16 expression affects
CFU-MK formation by performing CFU-MK assays. pRRL-SCR
GFP?/CD34?, pRRL-SEQ24 GFP?/CD34?cells were obtained by
flow cytometry cell sorting and grown in plasma clot in the presence of
TPO and SCF to reveal their MK potential. Results of 3 experiments
performed from cord-blood CD34?cells are summarized in Figure 6A.
Cloning efficiency of CFU-MK was quite similar in pRRL-SCR
GFP?/CD41?andpRRL-SEQ24GFP?/CD41?.
We also analyzed the proplatelet formation from pRRL-SCR
GFP?/CD41?and pRRL-SEQ24 GFP?/CD41?cells (Figure 6B).
For this purpose, sorted cells were stimulated by SCF and TPO for
7 days, and proplatelet production was assessed. These analyses
revealed comparable numbers of proplatelets between pRRL-SCR
GFP?/CD41?, pRRL-SEQ24 GFP?/CD41?cells, suggesting that
RGS16 knocking down did not modify platelet formation in these
culture conditions.
Discussion
SDF-1, also called pre–B-cell growth-stimulating factor-1 (PBSF),
is a CXC chemokine constitutively produced by bone marrow
stromal cells and is the major chemoattractant of HSCs and
committed progenitors.39This chemokine may be involved also in
the retention of hematopoietic precursor cells in the bone mar-
row.5,6The SDF-1 receptor CXCR4 is expressed all along the MK
differentiation pathway from CFU-MK to platelets. However, the
chemotaxis mediated by SDF-1 markedly decreases during MK
differentiation.10-14The negative regulation of CXCR4 signaling at
the postreceptor level has also been described for mature B
cells.15-17In this cell lineage, it has been suggested that RGS
proteins may be involved in the negative regulation of chemotaxis
mediated by SDF-1 and other chemokines.
Figure 4. Inhibition of RGS16 expression in MO7e cells. MO7e cells were
transduced with pRRL-SCR (control) or with pRRL-SEQ15 or with pRRL-SEQ24. (A)
GFP?cells were sorted and analyzed by quantitative RT-PCR for RGS16 expression.
(B) SDF-1–induced migration of MO7e cell lines. MO7e pRRL-SCR (control) and
MO7e pRRL-SEQ24 migrated in response to 300 ng/mL SDF-1. The percentage
represents the proportion of migrated cells compared with input cells. The graph
shows the mean ? SD of 4 independent experiments performed in duplicate.
*P ? .01
Figure 3. Inhibition of RGS16 expression. (A) Construction of an expression
plasmid bearing shRNA and a lentiviral expression vector coding for shRGS16. (B)
Test of different sequences of shRGS16 in 293 EBNA cells. 293 EBNA cells were
cotransfected with pBS-H1 bearing different sequences of shRGS16 and MIGR as a
marker of transfection efficiency. EBNAcells were sorted as shown on the GFP level.
GFP?cells were analyzed for RGS16 expression by quantitative RT-PCR using ?2m
as reference. The graph shows the mean ? SD of 4 independent experiments.
2966BERTHEBAUD et al BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom

Page 7

In this study we show that expression levels of RGS16 and
RGS18 mRNA are up-regulated during MK differentiation. The
observations reported here are consistent with the notion that
dynamic control of specific RGS protein expression acts as a
general mechanism for controlling the duration of G protein–
coupled receptor signaling. Results of RGS16 and RGS18 protein
overexpression in MO7e cells demonstrated that CXCR4 signaling
was significantly inhibited by RGS16 but not by RGS18. This
effect was further documented by reduced Erk and AKT signaling.
Note that MAPkinase activation is constitutively (without agonist)
higher in MO7e cells overexpressing RGS16 or RGS18 as com-
pared with MO7e GFP cells, suggesting that RGS proteins may
affect signaling events leading to activation of MAP kinase. The
mechanisms leading to this high MAPK activation are presently
unclear. In addition to this effect on basal MAPK signaling, MAPK
activation by SDF-1 was also markedly inhibited by RGS16
overexpression but not by RGS18. MAP kinase activation is
mediated by free G?? subunits.40Thus, the decrease in CXCR4
signaling induced by RGS proteins is probably due to the GAPactivity
of RGS proteins themselves, increasing the rate of reassociation of G
protein with ?? complexes and decreasing the amount of free ??
dimers. This is consistent with the most accepted model for RGS
proteins, which bind directly to activated G proteins, stimulating GTP
hydrolysisandpromotingG-proteindeactivation.18,41-46
Few studies have addressed the issue of RGS protein effects in
CXCR4 signaling. RGS1 has been reported to be an effective
inhibitor of chemotaxis toward SDF-1 in human or murine B
lymphocytes.47,48A short form of RGS3 was shown to impair
CXCR4 signaling in a mature B-cell line.28In another study,
transientlytransfectedcellswithconstructsencodingRGS1,RGS3,
and RGS4 but not RGS2 exhibited inhibition of chemoattractant-
induced migration.24Neill et al49found that receptor-induced
increases in inositol triphosphate levels were strongly reduced only
in cells transfected with RGS3. In the present study, RGS16 and
RGS18 proteins differentially affected CXCR4 signaling, suggest-
ing that functional specificity of RGS proteins may depend on
receptor and/or G?-protein selectivity. In fact, we found that
RGS18 is highly expressed in mature megakaryocytes and plate-
lets. A report showed that RGS18 exhibits GAP activity toward
G?i.29,30,35Binding assays of RGS18 with megakaryocytic-cell
lysates demonstrated that RGS18 specifically binds G?i and
G?q,35suggesting that the dynamic control of this RGS acts as a
mechanism for controlling the duration of one or more G-protein–
coupled receptors expressed in megakaryocytes and platelets.
Indeed, a recent work shows that RGS18 is phosphorylated in
thrombin receptor-activating peptide (TRAP)–activated platelets,50
suggesting that RGS18 may be involved essentially in the protease-
activated receptor 1 (PAR-1)/G?i or G?q signaling in megakaryo-
cytes. RGS knock-out mice may help to precisely understand the
role of this RGS on MK differentiation and platelet production.
To further demonstrate that RGS16 plays a key role in CXCR4
signaling, a lentiviral-delivered short hairpin RNA was used to
inhibit RGS16 expression in MKs. A 3-fold decrease of RGS16
mRNA was achieved and led to an increase in CXCR4 signaling.
Indeed, the SDF-1–induced migration of MKs was augmented in
the presence of lentiviral vectors expressing anti-RGS16 siRNA.
RGS16 has been already described to be important for lymphocyte
activation and trafficking by attenuating the signaling of chemo-
kine receptors such as CXCR4.36,51Our experiment describes that
RGS16 is also important in the MK lineage. Indeed, this may be
part of the mechanism by which CXCR4 signaling is down-
regulated during MK differentiation, leading to the release of
mature MKs from the bone marrow microenvironment and to their
interaction with the vascular endothelium for efficient platelet
production. The up-regulation of RGS16 and RGS18 during MK
differentiation suggests that RGS16 and RGS18 proteins are
important targets for the biologic responses of MKs, and this is
particularly true for RGS16 in CXCR4 signaling in these cells.
Further experiments performed on RGS knock-out mice may help
to precisely understand the role of RGS on MK differentiation and
platelet production.
Acknowledgments
We thank Frederic Larbret and Yann Lecluse (IFR54, Villejuif,
France) for cell sorting experiments.
Figure 5. Inhibition of RGS16 expression in primary MKs. Cord-blood CD34?cells were cultured in MK medium with TPO and SCF. Cells were transduced with pRRL-SCR
or pRRL-SEQ24 and sorted using the GFPand the CD41 marker. (A) Quantitative RT-PCR of CD41?/GFP?and CD41?/GFP?sorted cells. RGS16 expression was normalized
with the ?2m one. (B) SDF-1–induced migration of MK pRRL-SCR and MK pRRL-SEQ24. Migrated cells were marked with anti-CD41 and anti-CD42 antibodies for flow
analysis.The data represent the percentage of CD41?/CD42?migrated cells compared with CD41?/CD42?total input cells.The graph shows the mean ? SD of 4 independent
experiments performed in duplicate. *P ? .01 (C) Cell adhesion. pRRL-SCR and pRRL-SEQ24 CD41?/GFP?sorted cells were plated in 48-well plates coated with collagen I or
fibronectin in the presence or not of SDF-1 (300 ng/mL). Data represent the mean ? SD of 3 independent experiments.
Figure 6. Effect of RGS16 knocking down on CFU-MK and platelet production.
Cord-blood CD34?cells were cultured in MK medium with TPO and SCF. Cells were
transduced with pRRL-SCR or pRRL-SEQ24 and sorted using GFP, CD34, CD41
markers. (A) CFU-MK assay. pRRL-SCR or pRRL-SEQ24 CD34?/GFP?sorted cells
were grown in plasma clot in the presence ofTPO and SCF.The histograms show the
number of CFU-MKs obtained after 12 days of culture for 2000 cells plated per dish.
(B) Proplatelet production. pRRL-SCR or pRRL-SEQ24 CD41?/GFP?sorted cells
were plated in the presence of TPO and SCF. The histograms represent the number
of MKs and proplatelets found per well. Data represent the mean ? SD of 3
independent experiments.
RGS16 SIGNALING IN MEGAKARYOCYTES 2967BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom

Page 8

References
1. Rollins B. Chemokines. Blood. 1997;90:909-928.
2. Nagasawa T, Hirota S, Tachibana K, et al. Defects
of B-cell lymphopoiesis and bone marrow myelo-
poiesis in mice lacking the CXC chemokine
PBSF/SDF-1. Nature. 1996;382:635-638.
3. Zou YR, KottmannAH, Kuroda M, Taniuchi I, Litt-
man DR. Function of the chemokine receptor
CXCR4 in haematopoiesis and in cerebellar de-
velopment. Nature. 1998;393:595-599.
4. PeledA, Petit I, Kollet O, et al. Dependence of
human stem cell engraftment and repopulation of
NOD/SCID mice on CXCR4. Science. 1999;283:
845-848.
5. AiutiA, Webb IJ, Bleul C, Springer T, Gutierrez-
Ramos JC. The chemokine SDF-1 is a chemoat-
tractant for human CD34?hematopoietic progeni-
tor cells and provides a new mechanism to
explain the mobilization of CD34?progenitors to
peripheral blood. J Exp Med. 1997;185:111-120.
6. Broxmeyer HE, Kohli L, Kim CH, et al. Stromal
cell-derived factor-1/CXCL12 directly enhances
survival/antiapoptosis of myeloid progenitor cells
through CXCR4 and G(alpha)i proteins and en-
hances engraftment of competitive, repopulating
stem cells. J Leukoc Biol. 2003;73:630-638.
7. Kawabata K, Ujikawa M, Egawa T, et al.Acell-
autonomous requirement for CXCR4 in long-term
lymphoid and myeloid reconstitution. Proc Natl
Acad Sci U SA. 1999;96:5663-5667.
8. Levesque JP, Hendy J, Takamatsu Y, Simmons
PJ, Bendall LJ. Disruption of the CXCR4/CXCL12
chemotactic interaction during hematopoietic
stem cell mobilization induced by GCSF or cyclo-
phosphamide. J Clin Invest. 2003;111:187-196.
9. Avecilla ST, Hattori K, Heissig B, et al. Chemo-
kine-mediated interaction of hematopoietic pro-
genitors with the bone marrow vascular niche is
required for thrombopoiesis. Nat Med. 2004;10:
64-71.
10. Wang JF, Liu ZY, Groopman JE. The alpha-che-
mokine receptor CXCR4 is expressed on the
megakaryocytic lineage from progenitor to plate-
lets and modulates migration and adhesion.
Blood. 1998;92:756-764.
11. Hamada T, Mohle R, Hesselgesser J, et al. Trans-
endothelial migration of megakaryocytes in re-
sponse to stromal cell-derived factor 1 (SDF-1)
enhances platelet formation. J Exp Med. 1998;
188:539-548.
12. Kowalska MA, Ratajczak J, Hoxie J, et al.
Megakaryocyte precursors, megakaryocytes and
platelets express the HIV co-receptor CXCR4 on
their surface: determination of response to stro-
mal-derived factor-1 by megakaryocytes and
platelets. Br J Haematol. 1999;104:220-229.
13. Rivie `re C, Subra F, Cohen-Solal K, et al. Pheno-
typic and functional evidence for the expression
of CXCR-4 receptor during megakaryocytopoı ¨-
esis. Blood. 1999;93:1511-1523.
14. MathurA, Hong Y, Martin J, Erusalimsky J.
Megakaryocytic differentiation is accompanied by
a reduction in cell migratory potential. Br J
Haematol. 2001;112:459-465.
15. Bleul CC, Schultze JL, Springer TA. B lymphocyte
chemotaxis regulated in association with micro-
anatomic localization, differentiation state, and B
cell receptor engagement. J Exp Med. 1998;187:
753-762.
16. Moratz C, Harrison K, Kehrl JH. Role of RGS pro-
teins in regulating the migration of B lympho-
cytes.Arch Immunol Ther Exp (Warsz). 2004;52:
27-35.
17. Honczarenko M, Douglas RS, Mathias C, Lee B,
Ratajczak MZ, Silberstein LE. SDF-1 responsive-
ness does not correlate with CXCR4 expression
levels of developing human bone marrow B cells.
Blood. 1999;94:2990-2998.
18. Berman DM, Wilkie TM, GilmanAG. GAIP and
RGS4 are GTPase-activating proteins for the Gi
subfamily of G protein alpha subunits. Cell. 1996;
86:445-452.
19. Berman DM, Kozasa T, GilmanAG. The GTPase-
activating protein RGS4 stabilizes the transition
state for nucleotide hydrolysis. J Biol Chem.
1996;271:27209-27212.
20. Watson N, Linder ME, Druey KM, Kerhl J, Blumer
KJ. RGS family members: GTPase-activating
proteins for heterotrimeric G-proteins alpha-sub-
units. Nature. 1996;383:172-175.
21. Hepler JR. Emerging roles for RGS proteins in
cell signalling. Trends Pharmacol Sci. 1999;20:
376-382.
22. Hepler JR, Berman DM, GilmanAG, Kozasa T.
RGS4 and GAIP are GTPase-activating proteins
for Gq alpha and block activation of phospho-
lipase C beta by gamma-thio-GTP-Gq alpha.
Proc NatlAcad Sci U SA. 1997;94:428-432.
23. Yan Y, Chi PP, Bourne HR. RGS4 inhibits Gq-
mediated activation of mitogen-activated protein
kinase and phosphoinositide synthesis. J Biol
Chem. 1997;272:11924-11927.
24. Bowman EP, Campbell JJ, Druey KM,
ScheschonkaA, Kehrl JH, Butcher EC. Regula-
tion of chemotactic and proadhesive responses to
chemoattractant receptors by RGS (regulator of
G-protein signaling) family members. J Biol
Chem. 1998;273:28040-28048.
25. Beadling C, Druey KM, Richter G, Kehrl JH,
Smith KA. Regulators of G protein signaling ex-
hibit distinct patterns of gene expression and tar-
get G protein specificity in human lymphocytes.
J Immunol. 1999;162:2677-2682.
26. Denecke B, MeyerdierksA, Bottger EC. RGS1 is
expressed in monocytes and acts as a GTPase-
activating protein for G-protein-coupled chemoat-
tractant receptors. J Biol Chem. 1999;274:26860-
26868.
27. Mohle R, Bautz F, Rafii S, Moore MA, Brugger W,
Kanz L. The chemokine receptor CXCR-4 is ex-
pressed on CD34?hematopoietic progenitors
and leukemic cells and mediates transendothelial
migration induced by stromal cell–derived fac-
tor-1. Blood. 1998;91:4523-4530.
28. Reif K, Cyster JG. RGS molecule expression in
murine B lymphocytes and ability to down-regu-
late chemotaxis to lymphoid chemokines. J Im-
munol. 2000;164:4720-4729.
29. Yowe D, Weich N, Prabhudas M, et al. RGS18 is
a myeloerythroid lineage-specific regulator of G-
protein-signalling molecule highly expressed in
megakaryocytes. Biochem J. 2001;359:109-118.
30. Nagata Y, Oda M, Nakata H, Shozaki Y, Kozasa
T, Todokoro K.Anovel regulator of G-protein sig-
naling bearing GAP activity for Galphai and Gal-
phaq in megakaryocytes. Blood. 2001;97:3051-
3060.
31. Riviere C, Subra F, Cohen-Solal K, et al. Pheno-
typic and functional evidence for the expression
of CXCR4 receptor during megakaryocytopoiesis.
Blood. 1999;93:1511-1523.
32. Abbas-Terki T, Blanco-Bose W, Deglon N,
Pralong W,Aebischer P. Lentiviral-mediated RNA
interference. Hum Gene Ther. 2002;13:2197-
2201.
33. Brummelkamp TR, Bernards R,Agami R.Asys-
tem for stable expression of short interfering
RNAs in mammalian cells. Science. 2002;296:
550-553.
34. Debili N, Coulombel L, Croisille L, et al. Charac-
terization of a bipotent erythro-megakaryocytic
progenitor in human bone marrow. Blood. 1996;
88:1284-1296.
35. GagnonAW, Murray DL, Leadley RJ. Cloning and
characterization of a novel regulator of G protein
signalling in human platelets. Cell Signal. 2002;
14:595-606.
36. Lippert E, Yowe DL, Gonzalo JA, et al. Role of
regulator of G protein signaling 16 in inflamma-
tion-induced T lymphocyte migration and activa-
tion. J Immunol. 2003;171:1542-1555.
37. Shi GX, Harrison K, Wilson GL, Moratz C, Kehrl
JH. RGS13 regulates germinal center B lympho-
cytes responsiveness to CXC chemokine ligand
(CXCL)12 and CXCL13. J Immunol. 2002;169:
2507-2515.
38. Estes JD, Thacker TC, Hampton DL, et al. Fol-
licular dendritic cell regulation of CXCR4-medi-
ated germinal center CD4 T cell migration. J Im-
munol. 2004;173:6169-6178.
39. Nagasawa T, Kikutani H, Kishimoto T. Molecular
cloning and structure of a pre-B-cell growth-
stimulating factor. Proc NatlAcad Sci U SA.
1994;91:2305-2309.
40. Lopez-Ilasaca M. Signaling from G-protein-
coupled receptors to mitogen-activated protein
(MAP)-kinase cascades. Biochem Pharmacol.
1998;56:269-277.
41. Druey KM, Blumer KJ, Kang VH, Kehrl JH. Inhibi-
tion of G-protein-mediated MAP kinase activation
by a new mammalian gene family. Nature. 1996;
379:742-746.
42. CavalliA, Druey KM, Milligan G. The regulator of
G protein signaling RGS4 selectively enhances
alpha 2A-adreoreceptor stimulation of the GT-
Pase activity of Go1alpha and Gi2alpha. J Biol
Chem. 2000;275:23693-23699.
43. De Vries L, Elenko E, McCaffery JM, et al. RGS-
GAIP, a GTPase-activating protein for Galphai
heterotrimeric G proteins, is located on clathrin-
coated vesicles. Mol Biol Cell. 1998;9:1123-1134.
44. De Vries L, Zheng B, Fischer T, Elenko E, Far-
quhar MG. The regulator of G protein signaling
family.Annu Rev Pharmacol Toxicol. 2000;40:
235-271.
45. Popov S, Yu K, Kozasa T, Wilkie TM. The regula-
tors of G protein signaling (RGS) domains of
RGS4, RGS10, and GAIP retain GTPase activat-
ing protein activity in vitro. Proc NatlAcad Sci
U SA. 1997;94:7216-7220.
46. Zerangue N, Jan LY. G-protein signaling: fine-
tuning signaling kinetics. Curr Biol. 1998;8:R313-
R316.
47. Moratz C, Kang VH, Druey KM, et al. Regulator of
G protein signaling 1 (RGS1) markedly impairs Gi
alpha signaling responses of B lymphocytes.
J Immunol. 2000;164:1829-1838.
48. Moratz C, Hayman JR, Gu H, Kehrl JH.Abnormal
B-cell responses to chemokines, disturbed
plasma cell localization, and distorted immune
tissue architecture in Rgs1?/?mice. Mol Cell Biol.
2004;24:5767-5775.
49. Neill JD, Duck LW, Sellers JC, Musgrove LC,
Kehrl JH.Aregulator of G protein signaling,
RGS3, inhibits gonadotropin-releasing hormone
(GnRH)-stimulated luteinizing hormone (LH) se-
cretion. BMC Cell Biol. 2001;2:21.
50. GarciaA, Prabhakar S, Hughan S, et al. Differen-
tial proteome analysis of TRAP-activated plate-
lets: involvement of DOK-2 and phosphorylation
of RGS proteins. Blood. 2004;103:2088-2095.
51. Moratz C, Harrison K, Kehrl JH. Regulation of
chemokine-induced lymphocyte migration by
RGS proteins. Methods Enzymol. 2004;389:15-
32.
2968BERTHEBAUD et al BLOOD, 1 NOVEMBER 2005?VOLUME 106, NUMBER 9
For personal use only. by guest on August 29, 2012. bloodjournal.hematologylibrary.orgFrom