The carboxyl-terminal of BRCA1 is required for subnuclear assembly of RAD51 after treatment with cisplatin but not ionizing radiation in human breast and ovarian cancer cells.

Abstract

BRCA1 plays an important role in maintaining genomic stability through its involvement in DNA repair. Although it is known that BRCA1 and RAD51 form distinct DNA repair subnuclear complexes, or foci, following environmental insults to the DNA, the role of BRCA1 in this process remains to be characterized. The purpose of the study was therefore to determine the role of BRCA1 in the formation of RAD51 foci following treatment with cisplatin and ionizing radiation. We found that although a functional BRCA1 is required for the subnuclear assembly of BRCA1 foci following treatment with either ionizing radiation or cisplatin, a functional BRCA1 is required for RAD51 foci to form following treatment with cisplatin but not with ionizing radiation. Similar results were obtained in SKOV-3 cells when the level of BRCA1 expression was knocked down by stable expression of a retrovirus-mediated small-interfering RNA against BRCA1. We also found that the carboxyl-terminal of BRCA1 contains uncharacterized phosphorylation sites that are responsive to cisplatin. The functional BRCA1 is also required for breast and ovarian cancer cells to mount resistance to cisplatin. These results suggest that the carboxyl-terminal of BRCA1 is required for the cisplatin-induced recruitment of RAD51 to the DNA-damage site, which may contribute to cisplatin resistance.

Full text

Page 1

The carboxyl-terminal of BRCA1 is required for subnuclear assembly
of RAD51 after treatment with cisplatin but not ionizing radiation
in human breast and ovarian cancer cells
Chenyi Zhou, Peng Huang, Jinsong Liu*
Department of Pathology, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030-4095, USA
Received 22 August 2005
Available online 6 September 2005
Abstract
BRCA1 plays an important role in maintaining genomic stability through its involvement in DNA repair. Although it is known that
BRCA1 and RAD51 form distinct DNA repair subnuclear complexes, or foci, following environmental insults to the DNA, the role of
BRCA1 in this process remains to be characterized. The purpose of the study was therefore to determine the role of BRCA1 in the for-
mation of RAD51 foci following treatment with cisplatin and ionizing radiation. We found that although a functional BRCA1 is
required for the subnuclear assembly of BRCA1 foci following treatment with either ionizing radiation or cisplatin, a functional BRCA1
is required for RAD51 foci to form following treatment with cisplatin but not with ionizing radiation. Similar results were obtained in
SKOV-3 cells when the level of BRCA1 expression was knocked down by stable expression of a retrovirus-mediated small-interfering
RNA against BRCA1. We also found that the carboxyl-terminal of BRCA1 contains uncharacterized phosphorylation sites that are
responsive to cisplatin. The functional BRCA1 is also required for breast and ovarian cancer cells to mount resistance to cisplatin. These
results suggest that the carboxyl-terminal of BRCA1 is required for the cisplatin-induced recruitment of RAD51 to the DNA-damage
site, which may contribute to cisplatin resistance.
? 2005 Elsevier Inc. All rights reserved.
Keywords: BRCA1; Rad51; Cisplatin; c-Radiation; Breast and ovarian cancer
Women with germline mutations in the BRCA1 gene are
particularly susceptible to breast cancer and ovarian cancer
[1,2]. BRCA1 is considered a tumor suppressor gene be-
cause the tumors that arise in these women exhibit loss of
heterozygosity, which is consistent with Knudson?s two-
hit hypothesis with regard to the recessive tumor suppres-
sor gene [3]. The BRCA1 gene encodes a 1863-amino acid,
220 kDa nuclear phosphoprotein with multiple functional
domains, including the carboxyl-terminal domain, which
consists of two tandem BRCA1 carboxyl-terminal repeats
(BRCT) [2,4,5], each of which is approximately 100 amino
acid long. The BRCA1 protein participates in a large num-
ber of cellular processes, including DNA replication, cell
cycle checkpoint control, transcriptional regulation, pro-
tein ubiquitination, apoptosis, and chromatin remodeling
[6–18]. BRCA1 is also part of a large complex of proteins
involved in DNA-damage recognition and repair [15]. In
particular, it interacts with multiple DNA repair/recombi-
nation proteins, including RAD51, the RAD50/MRE11/
NIBRIN complex, Bloom?s helicase, a DEAH helicase
BACH1, and Fanconi?s D2 protein [15,19–21]. This inter-
action of BRCA1 with the DNA repair protein complex
maintains genomic stability and may at least in part ac-
count for its role as a tumor suppressor. Its particular role
in DNA repair is to maintain genomic stability. Lack of the
BRCA1 protein in mice causes them to die early in embryo-
genesis as a result of a high level of genetic instability and
cell proliferation arrest resulting from activation of the
p53/p21 pathway [22].
RAD51 is a nuclear protein showing homology to the
yeast protein, RecA, which is involved in homologous
0006-291X/$ - see front matter ? 2005 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2005.08.197
*Corresponding author. Fax: +1 713 792 5529.
E-mail address: jliu@mdanderson.org (J. Liu).
www.elsevier.com/locate/ybbrc
Biochemical and Biophysical Research Communications 336 (2005) 952–960
BBRC

Page 2

recombination and double-strand DNA break repair [23].
Upon exposure to ionizing radiation, RAD51 oligomerizes
on DNA, which promotes pairing and strand exchange be-
tween the homologous DNAs. Also in response to ionizing
radiation, RAD51 has been shown to form into distinct
subnuclear complexes, or foci, which are likely to represent
functional multimeric forms of RAD51 that promote DNA
repair [24]. These RAD51 foci represent a critical step in
the assembly of DNA repair complexes in the damaged
sites, and both BRCA1 and BRCA2 have been shown to
possibly play a critical role in this process [6,7,25]. Howev-
er, the underlying mechanism in this process is not clear. In
human cancer cells, BRCA2 but not BRCA1 is required for
RAD51 foci to form after ionizing irradiation [26], whereas
in murine cells, BRCA1 is required for RAD51 foci to form
after treatment with either cisplatin or ionizing radiation
[27]. Genetic studies of yeast cells have shown that
RAD51 foci assembly requires several other proteins,
including RAD52, RAD55, and RAD57, which are also
part of RAD51 foci [28]. Xrcc3 is required for RAD51 foci
formation and double-strand DNA repair in Chinese ham-
ster cells [29]. These collective findings therefore suggest
that the formation of RAD51 foci is a complicated bio-
chemical process involving multiple proteins. In addition,
RAD51 knockout mice displayed embryonic lethality and
sensitivity to ionizing irradiation [30,31]. Further, RAD51
mutants showed a phenotype similar to that of BRCA1
mutants, which suggests that BRCA1 is involved in the
homologous recombination pathway. These findings there-
fore suggest that both RAD51 and BRCA1 play a critical
role in the maintenance of genetic stability [22].
Cisplatin is a widely used chemotherapeutic agent and is
particularly used in the treatment of ovarian cancer, testic-
ular cancer, and other solid tumors. After cisplatin enters
the cells, its chloride ligands are replaced by water, which
forms aquated species that react with the nucleophilic sites
on the DNA, in particular with the linker regions associat-
ed with the histone H1 protein [32–34]. Notably, the DNA-
damaging agent creates bulky lesions that can be removed
by nucleotide excision repair [35–37] or form interstrand
cross-links that can be corrected by double-strand break re-
pair [38]. Similar to ionizing radiation, the interstrand
cross-linking agent mitomycin also induces RAD51 foci
formation, suggesting that RAD51 is involved in the com-
mon DNA repair pathway induced by different DNA-dam-
aging agents [17,39]. BRCA1 has been shown to bind to
RAD51 and co-localize with RAD51 foci following ioniz-
ing irradiation [7]. However, it is unclear whether a func-
tional BRCA1 is essential for this process, in particular
whether it is required in differing ways for different types
of DNA-damaging agents to produce their effects.
The purpose of the study we report here was therefore to
examine the role of BRCA1 in the formation of RAD51
foci following treatment with cisplatin and ionizing radia-
tion. Our results showed that RAD51 foci formation de-
pends on the presence of a functional BRCA1 following
treatment with cisplatin but not with ionizing radiation.
This showed that BRCA1 may function differently depend-
ing on the type of DNA-damaging signal. Detailed infor-
mation on these differences would be useful in the
development of therapies that exploit the effects of the
BRCA1 protein and in the development of therapies for
radiation- and cisplatin-resistant cancers.
Materials and methods
Cell cultures. Cells of the SNU-251 endometrioid ovarian cancer cell
line were cultured as described previously [40], after which they were
maintained in RPMI 1640 medium (Gibco-BRL/Life Technologies,
Grand Island, NY) supplemented with 10% fetal bovine serum, 100 U/ml
penicillin, and 100 lg/ml streptomycin. The human ovarian cancer cell
lines DOV-13, SKOV-3, SKOV-3 (pcDNA3), SKOV-3 (vector), and
SKOV-3 (small-interfering RNA [siRNA] BRCA1), and the human breast
cancer cell lines MCF-7 and HCC1937 were cultured in Dulbecco?s
modified Eagle?s medium containing 10% fetal bovine serum, 100 U/ml
penicillin, and 100 lg/ml streptomycin. The cancer cell lines DOV-13,
SKOV-3, MCF-7, and HCC1937 were purchased from the American Type
Culture Collection (Manassas, VA). All cells were grown at 37 ?C in a
humidified atmosphere that included 5% CO2.
DNA damage induced by ionizing radiation and cisplatin. The procedure
to induce DNA damage through the application of ionizing radiation was
performed as described previously [27]. Cells were grown on coverslides
for the experiment in which foci formation was induced by ionizing irra-
diation. Cells showing exponential growth phase were irradiated at 12 Gy
and then immediately put into an incubator, where cultures were allowed
to continue for 8 h prior to fixation and staining. For the experiment in
which foci formation was induced by cisplatin and the experiments
examining the time course of the response to cisplatin, cells were washed
three times with serum-free medium before and after incubation with
serum-free medium containing 10 lM cisplatin for 1 h at 37 ?C. After this,
cells were allowed to grow in complete medium for 3 h and then were
stained or began to be collected at different times for Western blot anal-
yses. For the experiments examining the responses of cells to different
doses of cisplatin, cells were treated as above with various concentrations
of cisplatin and then collected after 24 h of treatment.
Immunofluorescent analysis. For the immunofluorescence studies,
coverslides were fixed in methanol at ?80 ?C for 5 min and then washed
with 1· phosphate-buffered saline. A previously described procedure was
used for staining the slides [41]. After permeabilization with 0.2% Triton
X-100 and TBST (50 mM Tris, pH 7.4; 150 mM NaCl; and 0.05% Tween
20), cells were blocked with normal serum and then incubated with a
monoclonal antibody against human RAD51 (Santa Cruz Biotechnology,
Santa Cruz, CA) or BRCA1 (Ab-1; Oncogene Research, Cambridge, MA)
followed by a second antibody conjugated with either fluorescein isothi-
ocyanate or Texas red-conjugated goat anti-mouse IgG (Santa Cruz
Biotechnology). Finally, cell nuclei were stained with 40,6-diamidino-2-
phenylindole, and the cells were mounted. A confocal microscope (Leica
Microsystem, Bannockburn, IL) was used to acquire the microscopic
images, and Adobe Photoshop software (Adobe Systems, San Jose, CA)
was used to process the images.
Construction of BRCA1 siRNA retroviral vector. The strategy we used
to construct a retroviral BRCA1 siRNA expression vector was similar to
that described in previous publications [42,43]. Two complementary DNA
oligonucleotides against nucleotides 103–129 in the BRCA1 coding region
(indicated in bold) were synthesized: GGTCACAGTGTCCTTTATG
TAttcaagagataCATAAAGGACACTGTGATTTTTGGAAA and AGCTT
TTCCAAAAATCACAGTGTCCTTTATGtatctcttgaaTACATAAAGGACT
GTGACC. The HindIII restriction enzyme sites in the oligonucleotides are
underlined. The oligonucleotides in the loop are indicated by lowercase
letters (also see Fig. 2A). The pLNCX-U6 retroviral expression vector was
cut by ApaI, blunted by T4 DNA polymerase, and then cut by HindIII.
Equal amounts of two complementary DNA oligomers were mixed, boiled
at 95 ?C for 5 min, and slowly cooled to room temperature. The annealed,
C. Zhou et al. / Biochemical and Biophysical Research Communications 336 (2005) 952–960
953

Page 3

double-stranded siRNA BRCA1 was ligated above the pLNCX-U6 vector
flanked by the blunted end and HindIII to create the pLNCX (siRNA
BRCA1) retroviral expression vector.
Retroviral infection. We used a previously described retroviral trans-
fection procedure from our laboratory [42,43]. Briefly, a package cell line,
AmphoPack 293, was infected with pLNCX (BRCA1 siRNA) by using the
calcium phosphate method. After a 2-day infection, viruses were collected
to infect the SKOV-3 cells twice. Cells were recovered by growing them in
fresh culture medium for 24 h and then were selected by growing them in a
neomycin-containing medium for 14 days.
Clonogenic survival assay. A previously described clonogenic survival
assay method was followed [27]. Briefly, 1–2 · 103cells were plated onto
35-cm2plates for 24 h before exposure to cisplatin at various doses for 1 h.
After this, the medium was changed to complete medium, and the cells
were incubated at 37 ?C in an atmosphere containing 5% CO2for 8–10
days. Colonies were then counted after staining with crystal violet. Each
sample was prepared in triplicate, and each experiment was repeated three
times.
MTT assays. The MTT assay was performed as previously described by
Zhou et al. [40]. Briefly, cells were grown for 24 h on a 6-well plate before
transienttransfection.TheplasmidpcDNA3vector(wild-typeBRCA1)[40]
or pcDNA3 vector (2 lg) was transiently transfected into the cells by using
Fugene 6 (Roche Applied Science, Indianapolis, IN). The green fluorescent
protein expression plasmid was used to assess transfection efficiency. After
24 h of transfection, cells were diluted and plated onto a 96-well plate con-
taining various doses of cisplatin for 24 h. The viability of cells was deter-
mined by using WTS-1 kits (Promega, Madison, WI).
Immunoblotting. The immunoblotting procedures used were those de-
scribed in detail by Zhou et al. [40]. Briefly, cells were washed with ice-cold
phosphate-buffered saline and lysed in 1· lysis buffer (50 mM Tris–HCl,
pH 8.0; 120 mM NaCl; and 0.5% Nonidet P-40), 50 mM NaF, 1 mM
sodium orthovanadate, 100 lg/ml phenylmethylsulfonyl fluoride, 20 lg/
ml aprotinin, and 10 lg/ml leupeptin for 1 h on ice. Protein extracts were
run on a 6% sodium dodecyl sulfate–polyacrylamide gel and transferred to
a nitrocellular membrane (Bio-Rad, Hercules, CA). The membrane was
incubated with dried skim milk for 1 h and then blotted with a primary
mouse anti-BRCA1 monoclonal antibody (1:100, Ab-1; Oncogene Re-
search) or RAD51 (1:1000). The membranes were washed three times for
10 min each with Tris-buffered saline (0.9% sodium chloride and 20 mM
Tris–HCl, pH 7.4) supplemented with 0.05% Tween 20 (TBST). The
peroxidase-conjugated horse anti-mouse antibody (1:5000, Amersham
Pharmacia Biotech, Piscataway, NJ) was added, and the membranes were
then washed with TBST three times for 10 min each. An enhanced
chemiluminescence kit was used to detect the signals (Amersham Phar-
macia Biotech).
Immunoprecipitation with anti-tyrosine antibody and phosphatase
treatment. SKOV3 cells were cultured in 10 cm tissue to 60% confluence
and treated with or without 10 mM cisplatin for 24 h and the cell lysates
(up to 1 mg protein) were incubated with 5 lg anti-p-tyrosine antibody
(Zymed Laboratories, San Francisco, CA) at 4 ?C for 4 h. Twenty
microliters of protein A–Sepharose beads was added to the lysates and
rotated at 4 ?C overnight. The immune complexes were collected, washed
four times, and inoculated with 400 units of lamda protein phosphates
(kppase) from New England Biolab (Beverly, MA) in 50 ll of reaction
mixture at 30 ?C for 30 min. The immune complexes were resolved using
6.5% SDS–PAGE gel, transferred to nitrocellular membrane, and exposed
to a mouse anti-BRCA1 monoclonal antibody (1:100, Ab-1; Oncogene
Research). The signals were detected using same methods described above.
Results
Carboxyl-terminal of BRCA1 is required for BRCA1 foci
formation induced by cisplatin and ionizing radiation
To understand the role of BRCA1 in cancer cells after
exposure to cisplatin or ionizing radiation, we examined
the subnuclear formation of BRCA1 foci after treatment
with cisplatin or ionizing radiation. Both the SNU-251
ovarian cancer cells and HCC1937 breast cancer cells
expressed the carboxyl-terminal-truncated BRCA1 pro-
tein and were used for comparisons with the SKOV-3 ovar-
ian cancer cells, which expressed full-length BRCA1
(Fig. 1A). Approximately 74% and 58% of SKOV-3 cells
had BRCA1 foci after ionizing radiation and cisplatin
treatment, respectively (Figs. 1B and E). In contrast, there
was a great decrease in the proportion of SNU-251 cells
with BRCA1 foci (12%) and virtually no such foci detected
in HCC1937 cells (0.5%) after ionizing radiation treatment
compared with the proportion of SKOV-3 cells with these
foci (74%) (Figs. 1B–E). The decrease was even greater for
SNU-251 (4%) and HCC1937 (0.5%) cells after cisplatin
treatment (Figs. 1C–E). These data showed that the car-
boxyl-terminal of BRCA1 is critical for BRCA1 foci to
form after cisplatin and ionizing radiation treatment.
Carboxyl-terminal of BRCA1 is required for assembly of
RAD51 and BRCA1 complex after cisplatin but not ionizing
radiation treatment
It has been reported that BRCA1 could co-localize with
RAD51 after exposure to ionizing radiation [6,7,25]. To
determine whether BRCA1 is required for the subnuclear
assembly of RAD51 after cisplatin treatment, SNU-251,
HCC1937, and SKOV-3 cells were double stained with
the anti-BRCA1 and anti-RAD51 antibody after ionizing
radiation or cisplatin treatment. About 73% of SNU-251
cells and 54% of HCC1937 cells had RAD51 foci after ion-
izing radiation; 66% of SKOV-3 cells had these foci (Figs.
1B, C, D, and F). This indicates that the carboxyl-terminal
of BRCA1 is not required for the subnuclear assembly of
RAD51 after ionizing irradiation. In contrast, only 37%
of SNU-251 cells and 7% of HCC1937 cells had RAD51
foci after cisplatin treatment, while 55% of SKOV-3 cells
had these foci after cisplatin treatment (Figs. 1B, C, D,
and F). The co-localization of BRCA1 and RAD51 was
detected in 2% of SNU-251 cells and 26% of SKOV-3 cells,
as shown in the merged pictures (Figs. 1B, C, D, and F).
These results therefore suggest that the carboxyl-terminal
of BRCA1 is essential for recruiting RAD51 to the DNA
repair site after exposure to the DNA-damaging agent cis-
platin, but it is only minimally involved in RAD51 assem-
bly after ionizing irradiation.
Depletion of BRCA1 reduces RAD51 foci formation after
cisplatin but not ionizing radiation treatment
To further show that BRCA1 is required for RAD51
foci to form after cisplatin treatment, we sought to reduce
the expression of the BRCA1 protein by using an siRNA
technique in SKOV-3 cells that normally express high levels
of BRCA1 so that the effect of RAD51 subnuclear assem-
bly could be tested against an identical genetic background.
In this experiment, we used previously described procedures
954
C. Zhou et al. / Biochemical and Biophysical Research Communications 336 (2005) 952–960

Page 4

used in our laboratory to first create a retroviral expression
vector expressing siRNA against BRCA1 [42,43]; the sche-
matic of the siRNA against BRCA1 in the retroviral
expression vector is shown in Fig. 2A. Western blot analy-
sis confirmed that BRCA1 expression was decreased by
about 80% in the SKOV-3 (siRNA BRCA1) cells com-
pared with the level in the SKOV-3 (vector) cells
(Fig. 2B). After ionizing radiation, BRCA1 foci were
detected in only 15% of SKOV-3 (siRNA BRCA1) cells
transfected with siRNA BRCA1 compared with 75% of
SKOV-3 (vector) cells containing the empty vector
(Fig. 2C). After cisplatin treatment, only 5% of SKOV-3
(siRNA BRCA1) cells showed BRCA1 foci compared with
65% of SKOV-3 (vector) cells. Therefore, BRCA1 foci
0
10
20
30
40
50
60
70
80
90
SK-OV3 SNU-251HCC1937
0
10
20
30
40
50
60
70
80
90
SK-OV3 SNU-251HCC1937
A
C
SNU-251
Control
γ γ-radiation
cisplatin
BRCA1 RAD51 Merge DAPI
F
SKOV-3
Control
γ γ-radiation
Cisplatin
BRCA1 RAD51 Merge DAPI
B
D
HCC1937BRCA1 RAD51 Merge DAPI
Control
γ γ-radiation
Cisplatin
E
i c
o f
1
A
C
R
B
h t i
w
i e l c
u
n
f o
%
BRCT1BRCT2
11863aa
Ring-fingerNLS BRCT1 BRCT2
16461815aa
wtBRCA1
truncatedBRCA1
truncatedBRCA1
1646173717601859aa
16461754aa
SKOV-3
SNU251
HCC1937
γ-radiation
Cisplatin
γ-radiation
Cisplatin
i c
o f
1
5
D
A
R
h t i
w
i e l c
u
n
f o
%
Fig. 1. (A) BRCA1 mutations in SKOV-3, SNU-251, and HCC1937 cells. aa, amino acid; NLS, nuclear localization signal; BRCT1 or BRCT2, BRCA C-
terminal tandem repeat 1 or 2. (B–D) Formation of BRCA1 and RAD51 subnuclear foci and co-localization of BRCA1 and RAD51 after ionizing c-
radiation and cisplatin treatment in SKOV-3 (B), SNU-251 (C), and HCC1937 (D) cells. The cells were double stained with anti-BRCA1 antibody and
anti-RAD51 antibody. The first column shows BRCA1 subnuclear foci (red dots) after treatment consisting of 15 Gy of ionizing c-radiation or 10 lM
cisplatin for 3 h; the second column shows RAD51 subnuclear foci (green dots); the third column shows merged pictures depicting the co-localization of
BRCA1 and RAD51 co-localization (indicated by yellow dots); and the fourth column shows the cell nuclei (blue) stained by 40,60-diamidino-2-
phenylindole. Control represents no treatment. (E) Histogram shows the percentages of nuclei containing detectable BRCA1 foci after treatment with
15 Gy of ionizing c-radiation for 8 h or 10 lM cisplatin for 3 h. (F) Histogram shows the percentages of nuclei containing detectable RAD51 foci after
treatment with 15 Gy of ionizing c-radiation or 10 lM cisplatin for 3 h. Two different individuals counted 200 cells of each cell line. (For interpretation of
the references to color in this figure legend, the reader is referred to the web version of this paper.)
C. Zhou et al. / Biochemical and Biophysical Research Communications 336 (2005) 952–960
955

Page 5

formation was reduced by about 60–65% by siRNA
BRCA1 in SKOV-3 cells after ionizing radiation or cisplat-
in treatment. However, depletion of the BRCA1 protein in
the SKOV-3 cells resulted in an approximate 60% decrease
in RAD51 foci formation after cisplatin treatment com-
pared with that in SKOV-3 (vector) cells (Fig. 2D). After
ionizing radiation treatment, about 70% of SKOV-3 (siR-
NA BRCA1) and 68% of SKOV-3 (vector) cells had
RAD51 foci (Fig. 2D). These results thus further showed
that BRCA1 is required for the recruitment of RAD51
for DNA-damage repair in cells treated with cisplatin but
not ionizing radiation.
Carboxyl-terminal of BRCA1 is involved in BRCA1
phosphorylation induced by cisplatin
To determine whether the carboxyl-terminal of BRCA1
is required to mediate the effect of RAD51 assembly after
cisplatin treatment, we examined the phosphorylation of
BRCA1 in SKOV-3, SNU-251, and HCC1937 cells, as
reflected by the shift in BRCA1 protein size. In SKOV-3
cells, the level of regular BRCA1 gradually decreased
and phosphorylated BRCA1 began to be detected after
4 h of exposure to cisplatin (Fig. 3A, lanes 1–5). After
24 h of cisplatin treatment, phosphorylated BRCA1 could
BRCA1
Vector
siRNA BRCA1
β-actin
% of nuclei with BRCA1
0
10
20
30
40
50
60
70
80
90
Vector
siRNABRCA1
GGTCACAGTGTCCTTTATGTA
AAGGTTTTTAGTGTCACAGGAAATACAT
ttcaa
g
a
g
at
103 bp123 bp
% of nuclei with RAD51
0
10
20
30
40
50
60
70
80
γ-radiationCisplatin
γ-radiationCisplatin
Vector
siRNABRCA1
A
B
C
D
Fig. 2. Depletion of BRCA1 in SKOV-3 cells by siRNA and foci formation following treatment of c-radiation and cisplatin. (A) Predicted siRNA
BRCA1 structure. (B) BRCA1 expression level in SKOV-3 (siRNA BRCA1) and SKOV-3 (vector) cells was analyzed by Western blot. (C,D) SKOV-3
(siRNA BRCA1) and SKOV-3 (vector) cells were treated with either 10 lM cisplatin or 12 Gy of c-ionizing radiation. The cells were then double stained
with anti-BRCA1 antibody and anti-RAD51 antibody, BRCA1 and RAD51 foci were visualized and counted as described in Figs. 1B and C. The relative
number of positive foci is shown in histograms.
A
B
β-actin
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
RAD51
p-BRCA1
BRCA1
0 1 4 8 24
HCC1937
0 1 4 8 24
SNU-251
0 1 4 8 24
Hour
SKOV-3
Cisplatin
Hour
BRCA1
RAD51
β-actin
0 1 4 8 24 0 1 4 8 24 0 1 4 8 24
SNU-251SKOV-3
IR
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
HCC1937
C
Fig. 3. Carboxyl-terminal of BRCA1 is involved in BRCA1 phosphorylation induced by cisplatin. (A) The expression of BRCA1 and RAD51 was
detected using Western blots after SKOV-3, SNU-251, and HCC1937 cells were treated with 10 lM cisplatin (B) or 12 Gy of ionizing c-radiation (IR) for
various times. b-Actin was used as a loading control. (C) The phosphorylated BRCA1 protein can be immunoprecipitated by anti-tyrosine antibody. The
cell extracts were first immunoprecipitated with anti-tyrosine antibody following cisplatin treatment. Then the immunoprecipitates were treated with
lamda phosphatase and probed with antibody BRCA1 antibody as described in Materials and methods.
956
C. Zhou et al. / Biochemical and Biophysical Research Communications 336 (2005) 952–960