Glycopeptide resistance vanA operons in Paenibacillus strains isolated from soil.

Abstract

The sequence and gene organization of the van operons in vancomycin (MIC of >256 microg/ml)- and teicoplanin (MIC of > or =32 microg/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX), and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and vanB operons. The vanA(PT) operon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA operons whereas vanA(PA) in P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanA(PA) by PCR mapping, restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of pentadepsipeptide peptidoglycan precursors ending in D-Ala-D-Lac, as demonstrated by D,D-dipeptidase activities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved from a common ancestor.

Full text

Page 1

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 2005, p. 4227–4233
0066-4804/05/$08.00?0doi:10.1128/AAC.49.10.4227–4233.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 49, No. 10
Glycopeptide Resistance vanA Operons in Paenibacillus Strains
Isolated from Soil
Luca Guardabassi,1* Bruno Perichon,1Jean van Heijenoort,2Didier Blanot,2
and Patrice Courvalin1
Unite ´ des Agents Antibacte ´riens, Institut Pasteur, Paris,1and Institut de Biochimie et de Biophysique
Mole ´culaire et Cellulaire, Universite ´ Paris-Sud, Orsay,2France
Received 17 May 2005/Returned for modification 28 June 2005/Accepted 23 July 2005
The sequence and gene organization of the van operons in vancomycin (MIC of >256 ?g/ml)- and teicoplanin
(MIC of >32 ?g/ml)-resistant Paenibacillus thiaminolyticus PT-2B1 and Paenibacillus apiarius PA-B2B isolated
from soil were determined. Both operons had regulatory (vanR and vanS), resistance (vanH, vanA, and vanX),
and accessory (vanY, vanZ, and vanW) genes homologous to the corresponding genes in enterococcal vanA and
vanB operons. The vanAPToperon in P. thiaminolyticus PT-2B1 had the same gene organization as that of vanA
operons whereas vanAPAin P. apiarius PA-B2B resembled vanB operons due to the presence of vanW upstream
from the vanHAX cluster but was closer to vanA operons in sequence. Reference P. apiarius strains NRRL
B-4299 and NRRL B-4188 were found to harbor operons indistinguishable from vanAPAby PCR mapping,
restriction fragment length polymorphism, and partial sequencing, suggesting that this operon was species
specific. As in enterococci, resistance was inducible by glycopeptides and associated with the synthesis of
pentadepsipeptide peptidoglycan precursors ending in D-Ala-D-Lac, as demonstrated by D,D-dipeptidase activ-
ities, high-pressure liquid chromatography, and mass spectrometry. The precursors differed from those in
enterococci by the presence of diaminopimelic acid instead of lysine in the peptide chain. Altogether, the results
are compatible with the notion that van operons in soil Paenibacillus strains and in enterococci have evolved
from a common ancestor.
The glycopeptide antibiotics vancomycin and teicoplanin are
drugs of primary importance for the treatment of hospital
infections caused by multiresistant gram-positive bacteria such
as Staphylococcus aureus, enterococci, and Clostridium difficile.
Glycopeptides act by inhibiting cell wall synthesis (29), and
resistance is due to the synthesis of peptidoglycan precursors
with low affinity for these antibiotics (3, 32). Six types of van
operons conferring glycopeptide resistance have been de-
scribed in enterococci based on gene sequence and organiza-
tion (25, 31). The various operons are designated according to
the name of the gene, which encodes either a D-Ala:D-Lac
(vanA, vanB, and vanD) or a D-Ala:D-Ser (vanC, vanE, and
vanG) ligase for synthesis of peptidoglycan precursors with low
affinity for glycopeptides. The operons coding for a D-Ala:D-
Lac ligase contain genes for a two-component regulatory sys-
tem (vanR and vanS), three resistance genes (vanH, vanA or
vanB or vanD, and vanX), an accessory gene (vanY), and other
genes with unknown functions (vanW or vanZ).
The most common glycopeptide resistance gene clusters in
clinical enterococci are vanA and vanB. Both operons are as-
sociated with transposable elements, i.e., vanA with Tn1546 (2)
and vanB with Tn1547 (28) and Tn1549-Tn5382 (7, 13). The
recent acquisition of the vanA gene cluster by S. aureus (8)
confirms that these genes are able to spread across bacterial
genera. Previous indications of intergenic horizontal transfer
of van operons were provided by the finding of vanA in Bacillus
circulans (18), Oerskovia turbata, and Arcanobacterium haemo-
lyticum (26) and of vanB in Streptococcus bovis (27) and an-
aerobic bacilli (4). All these bacteria were isolated from clinical
specimens, mainly stools, suggesting that dissemination of gly-
copeptide resistance may occur in the intestinal microflora of
patients.
It has been proposed that van operons originate from gly-
copeptide-producing organisms (14, 20, 23). This hypothesis is
based on the observation that the glycopeptide producers con-
tain resistance gene clusters homologous to those in human-
pathogenic bacteria. However, these clusters have relatively
low similarity with the vanA and vanB operons (from 54 to
64% predicted amino acid identity), lack the two-component
regulatory systems, and do not appear to be transferable under
laboratory conditions. Finding of the vanF operon in Paeniba-
cillus popilliae (24) and the recent recovery of genes homolo-
gous to vanA in other Paenibacillus species (15) have raised
interest about a possible role of this genus in the dissemination
of glycopeptide resistance.
In this study, we have characterized the organization of the
van operons in two glycopeptide-resistant Paenibacillus strains
isolated from soil and known to harbor putative D-Ala:D-Lac
ligase genes flanked by vanH- and vanX-like genes (15). The
two operons were closely related to vanA on the basis of both
gene sequence and organization. Glycopeptide resistance was
inducible by vancomycin and teicoplanin and resulted from the
synthesis of peptidoglycan precursors containing diamino-
pimelic acid and ending in D-Ala-D-Lac.
MATERIALS AND METHODS
Bacterial strains and growth conditions. Strains Paenibacillus thiaminolyticus
PT-2B1 and Paenibacillus apiarius PA-B2B were isolated from soil and identified
* Corresponding author. Present address: Department of Veterinary
Pathobiology, The Royal Veterinary and Agricultural University, Stig-
bøjlen 4, 1870 Frederiksberg C., Denmark. Phone: 45-35282745. Fax:
45-35282755. E-mail: lg@kvl.dk.
4227

Page 2

by sequencing 16S rRNA genes (15). Reference strains P. apiarius NRRL B-4299
and NRRL B-4188 were isolated from dead bees and obtained from the collec-
tion of the National Center for Agricultural Utilization Research, U.S. Depart-
ment of Agriculture. Strains were grown at 30°C in brain heart infusion (BHI)
broth or on BHI agar (Difco Laboratories, Detroit, Mich.). The MICs of van-
comycin and teicoplanin were determined by Etest (AB Biodisk, Solna, Sweden)
after 48 h of incubation on Mueller-Hinton agar at 28°C.
TAIL PCR. Thermal asymmetric interlaced (TAIL) PCR (19) was used to
clone the 5? and 3? regions flanking the vanHAX clusters in strains PT-2B1 and
PA-B2B and to determine their sequence. Three PCR steps were performed with
a specific primer targeting the known sequence and arbitrary degenerate primer
AD1 (Table 1 and Fig. 1). The target sequences of the anchor primers used in the
second and third steps were selected at decreasing distance from the ends of the
known sequence in order to obtain PCR products of slightly decreasing size.
Total DNA obtained by use of the High Pure PCR template kit (Roche Diag-
nostics, Mannheim, Germany) was used as a template in the first PCR. The PCR
mixture contained 0.15 ?M specific primer (Table 1), 5 ?M AD1 primer, 200 ?M
of each deoxynucleoside triphosphate, 1? PCR buffer with 22.5 mM MgCl2, and
2.5 U of the enzyme mix supplied by the Expand Long Template PCR system
(Roche Diagnostics). PCR conditions were as previously described (9). The
products obtained from the first and second PCRs were diluted 105and 10 times,
respectively, before being used as DNA templates in the following PCR. The
DNA bands corresponding to the second and third PCRs, which had the length
decrease expected from the positions of the specific primers, were purified using
the QIAGEN PCR purification kit (QIAGEN S.A., Courtaboeuf, France) and
sequenced.
Cloning of the TAIL PCR products into Escherichia coli. The purified PCR
products were cloned in plasmid PCR2.1 into E. coli TOP10F? using the TA
cloning kit (Invitrogen Corporation, Carlsbad, CA). White colonies were isolated
from BHI agar containing ampicillin (50 ?g/ml) and 5-bromo-4-chloro-3-indoyl-
?-D-galactopyranoside (X-Gal; 80 ?g/ml). Plasmid DNA was isolated according
to the method of Birnboim and Doly (6) and digested with EcoRI (Invitrogen
Corporation) to screen for the presence of an insert.
Nucleotide sequencing. Plasmid DNA or PCR products were labeled using a
dye-labeled ddNTP Terminator Cycle sequencing kit (Beckman Coulter UK
Ltd.) and sequenced with a CEQ 2000 automated sequencer (Beckman). Se-
quences obtained from cloned TAIL PCR products were confirmed by sequenc-
ing PCR products obtained from total DNA using specific primers.
Computer analysis of sequences. Sequences were aligned, translated, and
analyzed using DNA Strider 1.3 (CEA/Saclay, Gif-sur-Yvette, France). Compar-
ison with known genes and proteins was carried out using BlastN and BlastX,
available at the National Center for Biotechnology Information website (http:
//www.ncbi.nlm.nih.gov/BLAST/). Nucleotide identities and fractional GC con-
tents were calculated using EMBOSS Align (gap open 10 and gap extend 0.5)
and EMBOSS Geecee, respectively (http://www.ebi.ac.uk/emboss/).
Restriction fragment length polymorphism (RFLP) analysis. Specific primers
were designed to amplify the entire operons or portions of them (Table 1; Fig.
1). Long PCR (Expand Long Template PCR system; Roche Diagnostics) was
carried out using the following conditions: 2 min of denaturation at 94°C and 30
cycles of 10 s at 94°C, 30 s at 50°C, and 4 to 6 min at 68°C depending on the size
of the product, followed by final extension at 68°C for 7 min. The long PCR
products were partly sequenced and digested for 1 h at 37°C with NaeI (Biolabs,
Saint Quentin Yvelines, France) and DdeI (Invitrogen Corporation) for RFLP
analysis.
Mating experiments. Transfer of glycopeptide resistance was attempted from
Paenibacillus spp. to Enterococcus faecium BM4105 and J64/3 resistant to ri-
FIG. 1. Schematic representation of the van operons in P. thiaminolyticus PT-2B1 (top) and P. apiarius PA-B2B (bottom) and of the PCR
primers used for their characterization. The percentages refer to the levels of identity between the corresponding genes in the two operons. Open
arrows represent coding sequences and indicate the direction of transcription. Solid and dashed small arrows indicate the primers used for TAIL
and long PCR, respectively.
TABLE 1. Oligodeoxynucleotides used for TAIL and long PCR
PrimerSequence (5? to 3?) Positiona
Tpf1
Tpr1
Tpf2
Tpr2
Tpf3
Tpr3
Ad1
Lpf1
Lpf2
Lpr1
Lpf3
Lpr2
Patf
Patr
GTTTCAAAAGGATACGTGGC
GCACATGACATCCAAATCCC
CTTTATCGATTAGACACGGG
ATGTCGCGCAGTACCTTGCC
CAAAATCGCAGACGTTTGCG
ATAATCGGCAACGCTATCCG
TGWGNAGWANCASAGA
TCCAGAGAAGGATATGAC
GAACTGGCATTTCGCAAGGC
GCCCCCATTTCTTGGTAAAG
GCTCCCATCATAGTCAAT
ACTGCGTTTTCAGAGCCTTT
TATCCTACGTGGATAAGCGG
GGGCCAAACTTGAGCACGAT
7419/7438
5625/5606
7482/7501
5548/5529
7587/7606
5438/5419
NAb
5017/5034
1998/2017
8604/8585
?190/?173
6839/6820
2948/2967
9178/9159
aNucleotide numbering begins at the start site (?1) of the transposase gene
preceding the vanAPToperon in P. thiaminolyticus PT-2B1 (accession no.
DQ018710).
bNA, not applicable.
4228GUARDABASSI ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Page 3

fampin and fusidic acid. Donor and recipient strains were inoculated on BHI
agar or on 0.45-?m-pore-size nitrocellulose filter (Millipore) placed on BHI
agar. After 2 days of incubation at 28°C, bacteria were resuspended in 1 ml of
BHI broth and plated on Slanetz agar (Oxoid) supplemented with vancomycin
(10 ?g/ml), rifampin (50 ?g/ml), and fusidic acid (10 ?g/ml). Longer mating time
periods (up to 10 days) and selective enrichment in azide dextrose broth (Merck)
supplemented with the three antibiotics were employed for enhancing detection
of low-frequency transfer.
Assays of D,D-dipeptidase (VanX) and D,D-carboxypeptidase (VanY) activities.
The activities of VanX (cytoplasmic D,D-dipeptidase) and VanY (membrane-
associated D,D-carboxypeptidase) were assayed by determining the amount of
D-Ala released by hydrolysis of dipeptide D-Ala-D-Ala (6.56 mM) and pentapep-
tide UDP-MurNAc-L-Ala-?-D-Glu-L-Lys-D-Ala-D-Ala (5 mM), respectively. Cy-
toplasmic and membrane extracts were obtained as previously described (9).
Measurement was obtained through coupled indicator reactions using D-amino
acid oxidase and horseradish peroxidase (1, 30). Specific activity was defined as
the number of nanomoles of product formed at 37°C per minute per milligram
of protein contained in the extract.
Peptidoglycan precursors. UDP-MurNAc-L-Ala-?-D-Glu-meso-A2pm-D-Ala-
D-Ala (UDP-MurNAc-pentapeptide) was obtained as previously described (11).
UDP-MurNAc-L-Ala-?-D-Glu-meso-A2pm-D-Ala (UDP-MurNAc-tetrapeptide)
was generated by removal of the C-terminal D-alanine of UDP-MurNAc-pen-
tapeptide by action of the D,D-carboxypeptidase from Actinomura sp. strain R39
as described previously for the lysine-containing UDP-MurNAc-tetrapeptide (5).
Extraction and quantification of the UDP-MurNAc peptide precursors. The
UDP-MurNAc peptide precursors from mid-log-phase cells grown without and
with vancomycin (32 ?g/ml) were extracted according to the method of Reynolds
et al. (33) and analyzed by high-pressure liquid chromatography (HPLC) as
previously described (21).
Amino acid analysis. Amino acid and amino sugar compositions were deter-
mined with a Hitachi model L8800 analyzer (ScienceTec, Les Ulis, France)
equipped with a 2620MSC-PS column (80 ? 4.6 mm). Prior to analysis samples
were hydrolyzed in 6 M HCl at 95°C for 16 h.
Mass spectrometry analysis. Matrix-assisted laser desorption ionization–time
of flight mass spectra were recorded on a PerSeptive Voyager-DE STR instru-
ment (Applied Biosystems, Foster City, CA) in the reflectron mode with delayed
extraction. The samples were prepared as follows: 1 ?l of a solution of compound
in water at 20 pmol/?l was deposited on the plate and mixed with 1 ?l of a
10-mg/ml solution of 2,5-dihydroxybenzoic acid in 0.1 M citric acid. After evap-
oration, desorption and ionization were obtained by pulses from a 337-nm
nitrogen laser. Spectra were recorded in the negative ion mode at an acceleration
voltage of ?20 kV and an extraction delay time of 200 nanoseconds. A mixture
of UDP-MurNAc, UDP-MurNAc-L-Ala-D-Glu, and UDP-MurNAc-pentapep-
tide was used as an external calibrant.
Nucleotide sequence accession numbers. The sequences were submitted to
GenBank and assigned the following accession numbers: DQ018710 (vanAPT
operon in PT-2B1) and DQ018711 (vanAPAoperon in PA-B2B).
RESULTS
Glycopeptide resistance phenotypes. P. thiaminolyticus PT-
2B1 and P. apiarius PA-B2B were resistant to high concentra-
tions (MIC of ?256 ?g/ml) of vancomycin. An atypical growth
response by PT-2B1 was observed with Etest, since the strain
grew at high vancomycin concentrations (up to 256 ?g/ml) but
showed a thin inhibition zone at concentrations between 3 and
4 ?g/ml. A similar observation was made by disk agar diffusion,
the strain growing at the point of contact with the 30-?g van-
comycin disk but displaying a thin zone of inhibition at a
distance from the disk (Fig. 2). PA-B2B displayed reduced
growth at vancomycin concentrations above 4 ?g/ml in the
Etest but grew in liquid medium containing higher concentra-
tions of the antibiotic. The MIC of teicoplanin was higher for
PT-2B1 (?256 ?g/ml) than for PA-B2B (32 ?g/ml).
Transfer of glycopeptide resistance from PT-2B1 or PA-B2B
to E. faecium BM4105 and J64/3 could not be obtained, even
when the mating mixtures were incubated for 10 days and
selective enrichment was used for detection of transconjugants.
Strain PT-2B1 inhibited the growth of E. faecium as indicated
by the absence of growth around colonies of the donor strain
(Fig. 2).
Organization of the van operon in PT-2B1. Two TAIL PCR
products of approximately 7 kb each were obtained from the
upstream and downstream regions of the vanHAX cluster in
PT-2B1 (Fig. 1). Sequencing revealed the same organization as
in enterococcal vanA operons, with the vanHAX resistance
gene cluster preceded by genes (vanR and vanS) for a two-
component regulatory system and followed by a gene (vanY)
coding for a putative D,D-carboxypeptidase. The percentage of
identity to the corresponding genes in the vanA operon of
Tn1546 in E. faecium BM4147 (2) varied between 83% and
94% (Fig. 3). Homology with the vanA operon of Tn1546 was
also observed in the vanS-H (85%) and vanX-Y (74%) inter-
genic regions. As in Tn1546, vanS overlapped with vanR over
FIG. 2. Phenotypic characteristics of P. thiaminolyticus PT-2B1. A.
Atypical inhibition zone centered on a 30-?g vancomycin disk. B.
Inhibition of E. faecium BM4105 by a colony of PT-2B1.
VOL. 49, 2005vanA OPERONS IN PAENIBACILLUS4229

Page 4

23 bp and vanA with vanH over 8 bp. Due to the high similarity
with vanA operons in both gene sequence and organization,
the cluster was designated vanAPT. All the genes had the same
length as the corresponding genes in BM4147, except for
vanSPT, which had a 6-bp insertion at the beginning of the
gene, and vanYPT, which was shorter (885 versus 912 bp). A
sequence homologous to vanZ (40% identity) was located
downstream from vanYPT. The region upstream from vanRPT
contained two open reading frames, ORF1 and ORF2. ORF1
(1,263 bp) encoded a hypothetical protein with 39% identity
and 58% similarity to a putative transposase in Lactococcus
lactis (accession no. AAC72261) (34). The predicted amino
acid sequence encoded by ORF2 (405 bp) had 35% identity
and 48% similarity with an acetyltransferase of the GCN5-
related N-acetyltransferase (GNAT) superfamily (37) present
in the genome of Bacillus cereus (accession no. AAP09041) and
of other Bacillus spp.
Organization of the van operon in PA-B2B. TAIL PCR
products of approximately 3 and 4 kb were obtained from the
regions upstream and downstream from the vanHAX cluster in
PA-B2B (Fig. 2). The operon in this strain was a hybrid be-
tween vanA and vanB operons based on the relative gene
organization: vanW was located upstream from vanHAX as in
vanB operons whereas vanY was positioned downstream from
vanHAX as in vanA operons (Fig. 3). However, the operon was
designated vanAPAsince the sequence of the genes was closer
to that in vanA operons. The percentages of identity to the
corresponding genes in the vanA operon of Tn1546 varied
between 79% and 94% (Fig. 3). The vanWPAgene was 75%
identical to vanW in the vanB operon of reference Enterococ-
cus faecalis V583 (10). The typical overlaps between vanR and
vanS and between vanH and vanA were also present in this
operon. Similarly to vanSPT, a 12-bp insertion was found at the
beginning of vanSPArelative to vanS in Tn1546, and vanYPA
was followed by a putative vanZPA(Fig. 3). The vanRPAand
vanSPAregulatory genes had sequences nearly identical to
those of vanRPTand vanSPTwhereas the remaining genes in
vanAPAwere less closely related to the corresponding genes in
vanAPT(Fig. 1). The region downstream from vanYPAended
with a partial open reading frame (ORF3) homologous to btrU
(79% identity), a gene in the aminoglycoside butirosin biosyn-
thetic operon of B. circulans (accession no. CAD41946) (22).
PCR mapping and RFLP analysis of long PCR products.
PCR products of the expected size were obtained using specific
primers (Table 1 and Fig. 1). Primers Patf and Patr allowed
amplification of the entire operons in PT-2B1 and PA-B2B as
well as in the two reference P. apiarius strains, NRRL B-4299
and NRRL B-4188. The van operons in the three P. apiarius
strains had the same size and were indistinguishable based on
RFLP analysis (data not shown) and partial sequencing of the
long PCR products.
D,D-Peptidase activities. Vancomycin and teicoplanin in-
duced
(VanY) activities in both strains (Table 2). No baseline enzy-
matic activity could be detected in the absence of antibiotic.
There was good correlation between the D,D-peptidase and the
nature of late peptidoglycan precursors. In particular, VanY
activity was associated with an increase in UDP-MurNAC-
tetrapeptide.
D,D-dipeptidase (VanX) and
D,D-carboxypeptidase
FIG. 3. Organization of vanA operons (E. faecium B4147, accession no. M97297), vanB (E. faecalis V583, accession no. U35369), vanF (P.
popilliae ATCC 14706, accession no. AF155139), vanAPT(P. thiaminolyticus PT-2B1, accession no. DQ018710), and vanAPA(P. apiarius PA-B2B,
accession no. DQ018711). For every gene, identity to the corresponding gene of the vanA operon in Tn1546 and the GC content are indicated
above and below the gene, respectively. Arrows indicate extent of the genes and direction of transcription.
4230GUARDABASSI ET AL.ANTIMICROB. AGENTS CHEMOTHER.

Page 5

HPLC and mass spectrometry of peptidoglycan precursors.
The crude cell wall extract from PT-2B1 was composed of ca.
25% A2pm-containing peptidoglycan. The main precursor
peak detected in the HPLC profile of the cytoplasmic extract
from untreated cells was eluted at 33 min (Fig. 4) and identi-
fied as A2pm-containing UDP-MurNAc-pentapeptide by its
coelution with an authentic sample under two different HPLC
conditions.
In the extract from vancomycin-treated PT-2B1 cells, the
UDP-MurNAc-(A2pm) pentapeptide peak was practically ab-
sent and replaced by two major peaks eluted at 18 and 50 min,
respectively (Fig. 4). Both peaks were recovered and purified
again by HPLC. The 18-min peak coeluted with an authentic
sample of A2pm-containing UDP-MurNAc-tetrapeptide under
two different HPLC conditions. This identification was con-
firmed by mass spectrometry which led to an [M-H]?ion with
an m/z ratio of 1,121.13 in agreement with an A2pm-containing
UDP-MurNAc-tetrapeptide, C38H60N8O27P2, having a mono-
isotopic mass of 1,122.30 g/mol.
Analysis of the 50-min peak (0.9 Mur, 1 A2pm, 1.1 Glu, and
1.5 Ala) was compatible with a precursor containing at least a
MurNAc-(A2pm)tetrapeptide
analysis led to an [M-H]?ion with an m/z ratio of 1,193.40,
which was in agreement with a lactic acid-containing UDP-
MurNAc-pentadepsipeptide, C41H64N8O29P2, having a mo-
noisotopic mass of 1,194.32 g/mol. It was noteworthy that a low
level of this UDP-MurNAc-pentadepsipeptide was detectable
in cells grown without vancomycin (Fig. 4). Furthermore, both
UDP-MurNAc-tetrapeptideand
sipeptide were also found to be predominant peaks in an ex-
tract from vancomycin-treated PA-2B1.
moiety. Massspectrometry
UDP-MurNAc-pentadep-
DISCUSSION
This study shows that the genetic and biochemical basis of
glycopeptide resistance in Paenibacillus from soil is the same as
in enterococci and in other human-pathogenic bacteria. In
particular, the glycopeptide resistance operons in Paenibacillus
have primary sequences and gene organizations very similar to
those of enterococcal vanA operons (Fig. 3). Furthermore, as
in clinical isolates, resistance is inducible by glycopeptides (Ta-
ble 2) and results from synthesis of peptidoglycan precursors
terminating in D-Ala-D-Lac (Fig. 4). The pentadepsipeptide
precursors differ from those in glycopeptide-resistant entero-
cocci by the presence of diaminopimelic acid instead of lysine
in the peptide chain. To the best of our knowledge, this is the
first report of D-Ala-D-Lac-ending pentadepsipeptide precur-
sors containing diaminopimelic acid. Diaminopimelic acid has
been previously shown to be a normal constituent of pepti-
doglycan in various Paenibacillus species (17, 38, 39).
Occurrence of van operons in members of the genus Paeni-
bacillus has been reported in the biopesticide P. popilliae
ATCC 14706 (24). However, the level of identity with entero-
coccal operons is markedly lower than those reported in this
study and the organization of the vanF operon in P. popilliae
differs from those of vanA and vanB because of the presence of
vanZ and vanY between the regulatory and the resistance
genes (Fig. 3). In contrast, the vanAPToperon in P. thiami-
nolyticus had the same organization as the vanA operon (Fig.
3). Furthermore, as opposed to vanF, the similarity of vanAPT
and vanAPAwith enterococcal vanA operons was not limited to
the resistance genes but extended to vanR and vanS with re-
spect to both sequence and GC content (Fig. 3).
Irrespective of their sources and times of isolation, the three
FIG. 4. HPLC analysis of peptidoglycan precursors of P. thiami-
nolyticus PT-2B1 grown without (A) or with (B) vancomycin (32 ?g/
ml). Samples (one-fifth of the extracts) were applied to a ?-Bondapak
C18column (300 ? 3.9 mm), and isocratic elution was performed with
0.05 M ammonium phosphate (pH 4.4) at a flow rate of 0.5 ml/min.
The main peaks detected by absorbance at 254 nm were identified as
UDP-MurNAc-pentapeptide (1), UDP-MurNAc-pentadepsipeptide
(2), and UDP-MurNAc-tetrapeptide (3) and quantitated by their uri-
dine content. Peak 1 in panel A, 1.2 nmol; peak 2 in panel A, 0.2 nmol;
peak 2 in panel B, 1.5 nmol; peak 3 in panel B, 0.9 nmol.
TABLE 2. D,D-Dipeptidase (VanX) and D,D-carboxypeptidase
(VanY) activities in cytoplamic and membrane extracts
from Paenibacillus strainsa
Strain and
glycopeptide
Glycopeptide
concn (?g/ml)
Activity (nmol/min/mg protein)
Cytoplamic extract
(VanX activity)
Membrane extract
(VanY activity)
PA-B2B
Vancomycin4108 ? 21
142 ? 7
24 ? 2
86 ? 9
14 ? 4
19 ? 9
1 ? 0.5
5 ? 2
64
Teicoplanin8
32
PT-2B1
Vancomycin 21 ? 0.5
13 ? 4
1.5 ? 0.6
22 ? 4
37 ? 10
81 ? 2
1 ? 0.5
53 ? 8
64
Teicoplanin4
32
aThe reported mean values were calculated based on three separate measure-
ments.
VOL. 49, 2005vanA OPERONS IN PAENIBACILLUS4231