Nox1 overexpression potentiates angiotensin II-induced hypertension and vascular smooth muscle hypertrophy in transgenic mice.

ISSN: 1524-4539
Copyright © 2005 American Heart Association. All rights reserved. Print ISSN: 0009-7322. Online
72514
Circulation is published by the American Heart Association. 7272 Greenville Avenue, Dallas, TX
DOI: 10.1161/CIRCULATIONAHA.105.538934
published online Oct 17, 2005; Circulation
Kathy K. Griendling
W. Robert Taylor, Harald H.H.W. Schmidt, Gary K. Owens, J. David Lambeth and
Sergey Dikalov, Alejandra San Martin, Alicia Lyle, David S. Weber, Daiana Weiss,
Anna Dikalova, Roza Clempus, Bernard Lassègue, Guangjie Cheng, James McCoy,
Vascular Smooth Muscle Hypertrophy in Transgenic Mice
Nox1 Overexpression Potentiates Angiotensin II-Induced Hypertension and
http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.105.538934/DC1
Data Supplement (unedited) at:
 
http://circ.ahajournals.org
located on the World Wide Web at:
The online version of this article, along with updated information and services, is
http://www.lww.com/reprints
Reprints: Information about reprints can be found online at
 
journalpermissions@lww.com
410-528-8550. E-mail:
Fax:Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050.
Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters
 
http://circ.ahajournals.org/subscriptions/
Subscriptions: Information about subscribing to Circulation is online at
by on May 18, 2011 circ.ahajournals.orgDownloaded from

Nox1 Overexpression Potentiates Angiotensin II–Induced
Hypertension and Vascular Smooth Muscle Hypertrophy
in Transgenic Mice
Anna Dikalova, PhD; Roza Clempus, MD; Bernard Lassègue, PhD; Guangjie Cheng, PhD;
James McCoy, BS; Sergey Dikalov, PhD; Alejandra San Martin, PhD; Alicia Lyle, BS;
David S. Weber, PhD; Daiana Weiss, MD; W. Robert Taylor, MD, PhD; Harald H.H.W. Schmidt, MD;
Gary K. Owens, PhD; J. David Lambeth, MD, PhD; Kathy K. Griendling, PhD
Background—Reactive oxygen species (ROS) have been implicated in the development of cardiovascular pathologies.
NAD(P)H oxidases (Noxes) are major sources of reactive oxygen species in the vessel wall, but the importance of
individual Nox homologues in specific layers of the vascular wall is unclear. Nox1 upregulation has been implicated in
cardiovascular pathologies such as hypertension and restenosis.
Methods and Results—To investigate the pathological role of Nox1 upregulation in vascular smooth muscle, transgenic
mice overexpressing Nox1 in smooth muscle cells (TgSMCnox1) were created, and the impact of Nox1 upregulation on the
medial hypertrophic response during angiotensin II (Ang II)–induced hypertension was studied. These mice have
increased expression of Nox1 protein in the vasculature, which is accompanied by increased superoxide production.
Infusion of Ang II (0.7 mg/kg per day) into these mice for 2 weeks led to a potentiation of superoxide production
compared with similarly treated negative littermate controls. Systolic blood pressure and aortic hypertrophy were also
markedly greater in TgSMCnox1 mice than in their littermate controls. To confirm that this potentiation of vascular
hypertrophy and hypertension was due to increased ROS formation, additional groups of mice were coinfused with the
antioxidant Tempol. Tempol decreased the level of Ang II–induced aortic superoxide production and partially reversed
the hypertrophic and hypertensive responses in these animals.
Conclusions—These data indicate that smooth muscle–specific Nox1 overexpression augments the oxidative, pressor, and
hypertrophic responses to Ang II, supporting the concept that medial Nox1 participates in the development of
cardiovascular pathologies. (Circulation. 2005;112:2668-2676.)
Key Words: angiotensin
�
hypertension
�
hypertrophy
�
muscle, smooth
�
free radicals
Reactive oxygen species (ROS) such as superoxide andhydrogen peroxide act as intercellular and intracellular
messengers that play physiological and pathophysiological
roles in vascular biology.1,2 They have profound effects on
vascular smooth muscle cell (VSMC) growth and migration,
processes that are critically important in cardiovascular pa-
thology and contribute to the vascular changes associated
with hypertension, arteriosclerosis, and restenosis.3
A major source of ROS in vasculature is the NAD(P)H
oxidase family of enzymes that are distributed throughout the
vessel wall.3 The VSMC NAD(P)H oxidases are structurally
distinct from the classic neutrophil oxidase. In large arteries,
VSMCs lack gp91phox, the catalytic subunit that transfers
electrons from NADPH to molecular oxygen to form super-
Editorial p 2585
Clinical Perspective p 2676
oxide.4 Instead, these cells express the gp91phox homologues
Nox1 and Nox4.4 Although both Nox1 and Nox4 are upregu-
lated after angiotensin II (Ang II) infusion,5 the 2 enzymes are
differentially regulated during restenosis.6 Furthermore,
Nox1 and Nox4 are found in distinct intracellular compart-
ments, suggesting that they serve different functions within
the cell.7 The precise biological roles of specific Nox proteins
thus remain unclear.
A growing body of evidence suggests that Ang II mediates
its potent vasoconstrictor, mitogenic, and hypertrophic effects
at least in part through ROS.8–12 Not only is vascular
Received January 31, 2005; revision received April 26, 2005; accepted May 10, 2005.
From the Division of Cardiology (A.D., R.C., B.L., S.D., A.S.M., A.L., D.S.W., D.W., W.R.T., K.K.G.) and Department of Pathology (G.C., J.M.,
J.D.L.), Emory University, Atlanta, Ga; Department of Pharmacology, Monash University, Clayton, Victoria, Australia (H.H.H.W.S.); and Department
of Molecular Physiology and Biological Physics, University of Virginia School of Medicine, Charlottesville (G.K.O.).
The online-only Data Supplement, which contains additional information about Methods, can be found at http://circ.ahajournals.
org/cgi/content/full/CIRCULATIONAHA.105.538934/DC1.
Correspondence to Kathy K. Griendling, Emory University, Division of Cardiology, 319 WMB, 1639 Pierce Dr, Atlanta, GA 30322. E-mail
kgriend@emory.edu
© 2005 American Heart Association, Inc.
Circulation is available at http://www.circulationaha.org DOI: 10.1161/CIRCULATIONAHA.105.538934
2668
Hypertension
by on May 18, 2011 circ.ahajournals.orgDownloaded from

superoxide elevated after Ang II infusion,5,11–15 but treatment
with antioxidants decreases Ang II–induced hypertension in
rats and mice.16–19 Genetic overexpression of superoxide
dismutase (SOD) also attenuates the rise in blood pressure
stimulated by Ang II.8 One of the hallmarks of hypertension
due to activation of the renin-angiotensin system is medial
hypertrophy of large vessels.20 In vitro, Ang II–induced
VSMC hypertrophy requires ROS derived from NAD(P)H
oxidases, specifically Nox1.4,21,22 Aortic hypertrophy in re-
sponse to Ang II infusion is impaired in gp91phox-deficient
mice, but gp91phox is expressed only in the endothelium and
adventitia and not in the aortic media.11 This raises the
question of whether medial NAD(P)H oxidases regulate
hypertrophy in vivo.
On the basis of these considerations, transgenic mice
overexpressing Nox1 in smooth muscle cells (SMCs) were
created and used to investigate the impact of Nox1 upregu-
lation, as occurs during hypertension and restenosis, on the
pressor and medial hypertrophic response during Ang II–
induced hypertension. We hypothesized that increased Nox1-
derived ROS would exacerbate the increased wall thickness
that occurs during hypertension and thus may also lead to
elevations in blood pressure. We found that upregulation of
Nox1 does indeed potentiate both the pressor and hypertro-
phic responses to Ang II in a ROS-dependent manner,
supporting the concept that medial Nox1 participates in the
development of cardiovascular pathologies.
Methods
Extended methods are provided in the online-only Data Supplement.
Reagents
DNeasy Tissue and RNeasy kits were from Qiagen, Inc. Nytran N
membranes were from Schleicher & Schuell. 1-Hydroxy-3-
methoxycarbonyl-2,2,5,5-tetramethyl-pyrrolidine (CMH) was pur-
chased from Alexis Corp. Dihydroethidium was purchased from
Molecular Probes. Anti-Nox1 rabbit polyclonal antibody was pre-
pared as described.23 The gp91 phox antibody (clone 54.1) was a gift
from Dr Mark Quinn.
Animals
The nox1 transgene was constructed in a specially designated
pBSCX1-LEL plasmid.24 The final construct consisted of the strong
universal promoter designated CX1 upstream of green fluorescent
protein (GFP) cDNA with a stop codon flanked by loxP DNA
cis-elements and followed by human nox1 cDNA (Figure 1A). CX1
is a hybrid promoter consisting of a portion of the �-actin and
cytomegalovirus enhancer sequences and was designed specifically
for high-level ubiquitous expression in all mouse tissues and cell
types in vivo.24 Two founder lines of these transgenic mice (Tg1nox1
and Tg2nox1) were generated in David Lambeth’s laboratory by the
Emory University transgenic mouse core facility.
Mice containing the nox1 transgene were bred with mice express-
ing a cre transgene composed of cre recombinase cDNA under the
control of the smooth muscle myosin heavy chain-� promoter
(SM-MHC).25 Both strains are on a C57Bl/6 background. In mice
positive for both the nox1 and cre transgenes, Cre recombinase is
expressed only in smooth muscle and excises the floxed GFP cDNA,
leaving nox1 cDNA under the control of the CX1 promoter.
Consequently, the human nox1 transgene is expressed exclusively in
smooth muscle (TgSMCnox1) (Figure 1A).
The presence of human nox1 and cre in mouse genomic DNA was
detected with the use of conventional polymerase chain reaction
(PCR) (Figure 1B) with the primers indicated in Table 1. The human
nox1 primers do not detect the native murine gene because of the
presence of 1.8 kb of intervening intron sequences. Detection of the
nox1 and cre transgenes was also performed by real-time PCR with
the use of genomic DNA from tail clips, as described in the
Figure 1. Creation of transgenic (Tg) mice
specifically expressing human nox1 in SMCs
(TgSMCnox1 mice). A, The human nox1 cDNA
was cloned into a construct containing the
CX-1 promoter and a floxed enhanced GFP
sequence (middle). GFP is present ubiqui-
tously in these mice, but they do not express
human Nox1 because of the stop signal
immediately downstream of GFP. These
mice were then crossed with mice carrying
Cre recombinase driven by the smooth mus-
cle myosin heavy chain promoter (SM MHC)
(top). In the resulting mice (bottom), GFP is
excised by recombination of the loxP sites,
and nox1 expression is driven by CX-1 in
SMCs only, resulting in tissue-specific over-
expression of Nox1. B, Representative PCR
of genomic DNA for each type of mouse.
Tgnox1 mice carry human nox1 in their
genome. TgSMCcre mice carry cre, whereas
TgSMCnox1 mice carry both genes. WT mice
carry neither human nox1 nor cre. C, South-
ern blot analysis of genomic DNA digested
with BamHI and probed with 32P-labeled
human nox1 cDNA (top) and cre cDNA (bot-
tom) confirms the presence of human nox1
and cre in transgenic mice. Note that the
nox1 band is more intense in Tg1SMCnox1 than
in Tg2SMCnox1 mice, indicating the presence of
a higher copy number of the transgene.
Dikalova et al Nox1 Increases Hypertension and Hypertrophy 2669
by on May 18, 2011 circ.ahajournals.orgDownloaded from

online-only Data Supplement. Primer sequences are indicated in
Table 1.
The presence of these transgenes in the breeding pairs was
confirmed by Southern blot analysis in both transgenic lines
(Tg1SMCnox1 and Tg2SMCnox1) (Figure 1C). Transgenic mice heterozy-
gous for Nox1 overexpression in SMCs and their wild-type (WT)
littermates were used in experiments. All mice used in this study
were between 6 and 7 months of age. All procedures were approved
by the Emory University Institutional Animal Care and Use
Committee.
Treatment Groups
Male TgSMCnox1 and WT mice were divided into 4 groups: control
(saline infusion), Ang II, Tempol, and Tempol�Ang II. The mice
were anesthetized with an intraperitoneal injection of 375 mg/kg
2,2,2-tribromoethanol, and micro-osmotic pumps were implanted
subcutaneously in the midscapular region. Pumps delivered either
0.9% saline or Ang II at a rate of 0.7 mg/kg per day. For the Tempol
groups, Tempol dissolved in saline was administered in separate
micro-osmotic pumps at a rate of 50 mg/kg per day.18 After 14 days,
the animals were killed by CO2 inhalation, and their aortas were
harvested for study.
Cell Culture
VSMCs were isolated from aortas of male TgSMCnox1 and WT mice by
the explant method with modifications.26 Cells were grown in
DMEM containing 10% FBS, passaged by trypsinization, and used
for experiments at passage 3.
Western Blotting
Aortas were harvested and cleaned of fat and connective tissue.
Proteins from mouse aortas or cultured aortic SMCs from TgSMCnox1
and WT mice were extracted and analyzed by Western blotting as
described previously.7 After incubation with horseradish peroxidase–
conjugated secondary antibody, proteins were detected by ECL
chemiluminescence.
Immunofluorescent Histochemistry
Single-label fluorescent immunohistochemistry was performed on
frozen 5-�m OCT-embedded tissue sections as described previous-
ly6 with the use of a rabbit polyclonal anti-nox1 antibody23 at 1:100
dilution. Serial sections were treated with secondary antibodies alone
to control for nonspecific staining.
Real-Time Quantitative Reverse
Transcriptase–PCR
Total RNA was purified from the indicated TgSMCnox1 and WT tissues
with the use of proteinase K and DNase I digestions and the RNeasy
kit (Qiagen). RNA from tissue and heterologous internal luciferase
standards were reverse transcribed with Superscript II enzyme
(Invitrogen) with random primers. Message expression was quanti-
fied with the use of the Lightcycler instrument (Roche) with SYBR
green dye and specific human or mouse nox1 or mouse gp91phox,
nox4, or p22phox primers and normalized to luciferase and 18S
rRNA.
Detection of Intracellular Superoxide With
High-Performance Liquid Chromatography
To evaluate intracellular production of superoxide, we measured the
formation of oxyethidium from DHE using high-performance liquid
chromatography (HPLC) analysis as recently reported.27 For each
experiment, three 2-mm aortic rings were incubated with 50 �mol/L
dihydroethidium in fresh Krebs/HEPES buffer and homogenized in
300 �L methanol. Separation of ethidium, oxyethidium, and dihy-
droethidium was performed with the use of an acetonitrile gradient
and a C-18 reverse-phase column (Nucleosil 250-4.5 mm) on a
Beckman HPLC System. Oxidized ethidium was expressed per
milligram protein. In some samples, polyethylene glycol (PEG)–
SOD (100 U/mL) was added 1 hour before addition of dihydro-
ethidium. PEG-SOD inhibited the dihydroethidium signal by 60%.
Superoxide Detection by Electron Spin Resonance
Aortas harvested as described above were cut into 2-mm rings, and
3 of each were incubated for 40 minutes at 37°C in 1 mL of
Krebs/HEPES buffer (pH�7.4) containing 5 �mol/L DETC,
50 mmol/L Desferal, and 0.5 mmol/L CMH. Rings were then frozen
in liquid nitrogen, and electron spin resonance (ESR) spectra were
recorded with a Bruker EMX ESR spectrometer and a super-high Q
microwave cavity. The ESR instrument settings were as follows:
field sweep, 50 G; microwave frequency, 9.78 GHz; microwave
power, 20 mW; modulation amplitude, 5 G; conversion time, 327.68
ms; time constant, 5242.88 ms; 512-point resolution and receiver
gain, 1�104. The amplitude of the signal was measured, and the
concentration of CM-radical was determined by calibration with
standard concentrations of CM-nitroxide. The portion of the signal
due to superoxide was determined by preincubation of duplicate
samples with PEG-SOD (100 U/mL) for 3 hours in Krebs/HEPES
buffer. PEG-SOD pretreatment inhibited 65% to 75% of CM-
nitroxide formation. The formation of CM-nitroxide was normalized
to the dry weight of aorta rings.
Systolic Blood Pressure Measurement
Systolic blood pressure was measured with the use of tail-cuff
plethysmography (Visitech Systems Inc). Blood pressure was mea-
sured twice before the implantation of osmotic pumps and on days 3,
7, 10, and 14 after pump placement. A set of 10 to 20 measurements
was obtained for each animal, and the mean blood pressure was
calculated. This noninvasive method of measuring blood pressure
correlates well with intra-arterial measurements in normotensive and
hypertensive mice.28
Assessment of Hypertrophy
After euthanasia, the heart and aorta were pressure-perfused at
100 mm Hg with 0.9% sodium chloride solution, followed by
pressure fixation with a 10% formalin solution. Aortas were embed-
ded in paraffin, and three 5-�m cross sections were cut starting 6 mm
from the aortic arch and stained with hematoxylin and eosin. Digital
TABLE 1. Genotyping Primers
Primer
for Primer Sequence 5� to 3�
Expected
Product, bp
Conventional PCR Nox1 Forward: GTGAGGATGTTTTCCAGTATGAAG
Reverse: TGTCAAAGTTTAATGCTGCATGACCA
308
Cre Forward: GAGTGATGAGGTTCGCAAGA
Reverse: GAACGCTAGAGCCTGTTTTG
357
Real-time quantitative PCR Nox1 Forward: TTCACCAATTCCCAGGATTGAAGTGGATGGTC
Reverse: GACCTGTCACGATGTCAGTGGCCTTGTCAA
379
Cre Forward: CGATGGATTTCCGTCTCTGGTGTAGCTGA
Reverse: CTTCCAGGGCGCGAGTTGATAGCTG
123
2670 Circulation October 25, 2005
by on May 18, 2011 circ.ahajournals.orgDownloaded from

images were obtained with the use of a Zeiss Axioskop. To quantify
wall thickness, radial lines were drawn to determine the distance
from internal elastic lamina to the external lamina at a minimum of
10 locations per aortic section, and a mean value was calculated. To
determine cross-sectional wall area (CSWA), the perimeters of the
internal and external elastic laminas were traced. The area inside
each respective perimeter was determined, and the difference be-
tween these areas was reported as the CSWA. All measurements
were completed with the use of NIH Image (version 1.62).
Statistical Analysis
Data are shown as mean�SE. Statistical significance was assessed
by ANOVA on untransformed data, followed by comparison of
group averages by contrast analysis, with the use of the Super-
ANOVA statistical program (Abacus Concepts). A probability value
�0.05 was considered statistically significant.
Results
Characterization of TgSMCnox1 Mice
As shown in Figure 1, successful creation of TgSMCnox1 mice
was confirmed by genetic methods. Overexpression of Nox1
protein in vascular smooth muscle (VSM) was confirmed by
Western analysis of aortas (Figure 2A). Two specific bands
(�55 and 75 kDa) were detected in TgSMCnox1 mice, consistent
with our previous measurements of Nox1 protein.4,7 Both bands
were increased upon Ang II infusion. Smooth muscle–specific
Figure 2. Increased expression of Nox1
protein in TgSMCnox1 mice. A and C, Rep-
resentative Western blots and mean data
for Nox1, Nox4, and gp91phox in aortic
protein extracts from untreated mice or
mice treated with Ang II for 14 days, as
indicated. Bands (lower, most prominent
for Nox1) were quantified by densitome-
try and normalized to the cell cycle pro-
tein CDK4. Values represent mean�SEM
of 4 to 6 independent experiments. *Sig-
nificant increase in Nox1 in Ang II– ver-
sus saline-infused mice of the same ge-
notype (P�0.01); #significant increase in
Nox1 expression in Tg1SMCnox1 mice com-
pared with WT (P�0.01). B, Immunofluo-
rescent detection of Nox1 in WT (left)
and Tg1SMCnox1 (right) mice, showing
increased smooth muscle–specific
expression of Nox1 in Tg1SMCnox1 animals.
There is also endogenous Nox1 expres-
sion in the fatty outer adventitia. There
was no staining in the absence of pri-
mary antibody (data not shown). Green
indicates autofluorescence of elastic
laminae; blue, DAPI staining for nuclei;
and red, Nox1 antibody staining.
Dikalova et al Nox1 Increases Hypertension and Hypertrophy 2671
by on May 18, 2011 circ.ahajournals.orgDownloaded from