Cloning, biochemical properties, and distribution of mycobacterial haloalkane dehalogenases.

Abstract

Haloalkane dehalogenases are enzymes that catalyze the cleavage of the carbon-halogen bond by a hydrolytic mechanism. Genomes of Mycobacterium tuberculosis and M. bovis contain at least two open reading frames coding for the polypeptides showing a high sequence similarity with biochemically characterized haloalkane dehalogenases. We describe here the cloning of the haloalkane dehalogenase genes dmbA and dmbB from M. bovis 5033/66 and demonstrate the dehalogenase activity of their translation products. Both of these genes are widely distributed among species of the M. tuberculosis complex, including M. bovis, M. bovis BCG, M. africanum, M. caprae, M. microti, and M. pinnipedii, as shown by the PCR screening of 48 isolates from various hosts. DmbA and DmbB proteins were heterologously expressed in Escherichia coli and purified to homogeneity. The DmbB protein had to be expressed in a fusion with thioredoxin to obtain a soluble protein sample. The temperature optimum of DmbA and DmbB proteins determined with 1,2-dibromoethane is 45 degrees C. The melting temperature assessed by circular dichroism spectroscopy of DmbA is 47 degrees C and DmbB is 57 degrees C. The pH optimum of DmbA depends on composition of a buffer with maximal activity at 9.0. DmbB had a single pH optimum at pH 6.5. Mycobacteria are currently the only genus known to carry more than one haloalkane dehalogenase gene, although putative haloalkane dehalogenases can be inferred in more then 20 different bacterial species by comparative genomics. The evolution and distribution of haloalkane dehalogenases among mycobacteria is discussed.

Full text

Page 1

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2005, p. 6736–6745
0099-2240/05/$08.00?0 doi:10.1128/AEM.71.11.6736–6745.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Vol. 71, No. 11
Cloning, Biochemical Properties, and Distribution of Mycobacterial
Haloalkane Dehalogenases
Andrea Jesenska ´,1* Martina Pavlova ´,1Michal Strouhal,1Radka Chaloupkova ´,1Iva Te ˇs ˇı ´nska ´,1
Marta Monincova ´,1Zbyne ˇk Prokop,1Milan Bartos ˇ,2Ivo Pavlı ´k,2Ivan Rychlı ´k,2
Petra Mo ¨bius,3Yuji Nagata,4and Jir ˇi Damborsky ´1
Loschmidt Laboratories, Masaryk University, Kamenice 5/A4, 625 00 Brno, Czech Republic1; Veterinary Research Institute,
Hudcova 70, 621 32 Brno, Czech Republic2; Federal Research Institute of Animal Health, Naumburger Str. 96a,
07743 Jena, Germany3; and Department of Environmental Life Sciences, Graduate School of
Life Sciences, Tohoku University, 2-1-1 Katahira, Sendai, 980-8577, Japan4
Received 6 May 2005/Accepted 1 July 2005
Haloalkane dehalogenases are enzymes that catalyze the cleavage of the carbon-halogen bond by a hydrolytic
mechanism. Genomes of Mycobacterium tuberculosis and M. bovis contain at least two open reading frames
coding for the polypeptides showing a high sequence similarity with biochemically characterized haloalkane
dehalogenases. We describe here the cloning of the haloalkane dehalogenase genes dmbA and dmbB from
M. bovis 5033/66 and demonstrate the dehalogenase activity of their translation products. Both of these genes
are widely distributed among species of the M. tuberculosis complex, including M. bovis, M. bovis BCG,
M. africanum, M. caprae, M. microti, and M. pinnipedii, as shown by the PCR screening of 48 isolates from
various hosts. DmbA and DmbB proteins were heterologously expressed in Escherichia coli and purified to
homogeneity. The DmbB protein had to be expressed in a fusion with thioredoxin to obtain a soluble protein
sample. The temperature optimum of DmbA and DmbB proteins determined with 1,2-dibromoethane is 45°C.
The melting temperature assessed by circular dichroism spectroscopy of DmbA is 47°C and DmbB is 57°C. The
pH optimum of DmbA depends on composition of a buffer with maximal activity at 9.0. DmbB had a single pH
optimum at pH 6.5. Mycobacteria are currently the only genus known to carry more than one haloalkane
dehalogenase gene, although putative haloalkane dehalogenases can be inferred in more then 20 different
bacterial species by comparative genomics. The evolution and distribution of haloalkane dehalogenases among
mycobacteria is discussed.
Haloalkane dehalogenases catalyze detoxification reactions
and act on a broad range of halogenated aliphatic compounds
(15). Haloalkane dehalogenases have primarily been isolated
from bacterial strains living in soil contaminated with haloge-
nated aliphatic compounds (16, 20, 30, 37, 38, 41, 42, 45). The
enzymes are involved in biochemical pathways enabling bacte-
ria to utilize halogenated compounds, i.e., 1,2-dichloroethane,
1-chloroalkanes, ?-hexachlorocyclohexane, 1,2-dibromoethane,
and 1,3-dichloropropene as the source of carbon and energy.
Database searches revealed the presence of at least two
open reading frames, rv2579 and rv2296, with sequences highly
similar to haloalkane dehalogenases in the genome of the
pathogenic bacterium Mycobacterium tuberculosis H37Rv (4).
Dehalogenating activity was consequently confirmed in M.
tuberculosis H37Rv (19). The same study demonstrated deha-
logenase activity in several saprophytic mycobacterial species.
The first haloalkane dehalogenase originating from a mycobacte-
rial strain was cloned from Mycobacterium sp. strain GP1 (37).
This haloalkane dehalogenase, designated DhaAf, is involved in
the biochemical pathway for biodegradation of 1,2-dibromo-
ethane. Genome sequence analysis has shown that two other
representatives (fast-growing M. smegmatis MC2 155 and slow-
growing M. avium subsp. paratuberculosis K10), possess open
reading frames aal17946, map0345c, and map2057 coding for
putative haloalkane dehalogenases. The first haloalkane dehalo-
genase of a bacterium isolated from animal tissue was cloned
from M. avium subsp. avium N85 (18) designated DhmA. Heter-
ologous expression of the dhmA gene in Escherichia coli resulted
in a dehalogenase hydrolyzing a wide range of haloalkanes. The
origin and function of the haloalkane dehalogenases in patho-
genic mycobacteria is currently unclear.
In a previous study, we compared the homology model of
protein Rv2579 with the crystal structure of haloalkane deha-
logenase LinB from Sphingomonas paucimobilis UT26 (25)
and found that 6 of 19 amino acid residues that form an active
site and entrance tunnel are different between LinB and
Rv2579 (32). Mutations were introduced cumulatively into the
six amino acid residues of LinB resulting in a protein mutant
which was designed to have an active site of Rv2579. This
mutant showed haloalkane dehalogenase activity, confirming
that Rv2579 is a member of haloalkane dehalogenase protein
family.
We describe here the cloning and expression of two putative
haloalkane dehalogenase genes (designated dmbA and dmbB,
corresponding to rv2579 and rv2296 in M. tuberculosis, respec-
tively) from the obligatory pathogen M. bovis, as well as the
biochemical and kinetic characterization of proteins encoded
by these genes. The distribution of mycobacterial genes
dmbA, dmbB, and dhmA genes was studied in isolates of the
M. tuberculosis complex, M. avium subsp. avium, M. avium subsp.
hominissuis, and M. avium subsp. paratuberculosis originating
* Corresponding author. Mailing address: Loschmidt Laboratories,
Masaryk University, Kamenice 5/A4, 625 00 Brno, Czech Republic.
Phone: 420-5-49494694. Fax: 420-5-49492556. E-mail: andreaj@chemi
.muni.cz.
6736

Page 2

from various hosts, including human beings and different geo-
graphical areas from four continents.
MATERIALS AND METHODS
Mycobacterial isolates. Isolates of the M. tuberculosis complex (M. tuberculosis,
M. bovis, M. bovis BCG, M. africanum, M. caprae, M. microti, and M. pinnipedii),
M. avium subsp. avium, M. avium subsp. hominissuis, and M. avium subsp. paratu-
berculosis were acquired from the collection of the Veterinary Research Institute,
Brno, Czech Republic, and were selected to represent a variety of hosts and coun-
tries of origin. M. avium subsp. paratuberculosis isolates were grown on Herrold Egg
Youlk Medium with Mycobactin J, whereas the rest of the mycobacterial isolates
were grown on solid Lo ¨wenstein-Jensen and Ogawa’s medium (19).
Confirmation of mycobacterial DNA. DNA was purified as described previ-
ously (18). The concentration of the isolated DNA was determined spectropho-
tometrically, diluted to a final concentration of 100 ?g/ml, and used as a template
for the PCR. The isolated DNA was tested for bacterial origin by PCR with 16S
rRNA-targeted primers UNB51 and UNB800 (Table 1). Primers UNB51 and
UNB800 were designed on the basis of the E. coli 16S rRNA gene sequence, and
the resulting product of amplification (800 bp) served to reliably identify bacte-
rial DNA. The PCR conditions used were as follows: denaturation at 94°C for
5 min, 3 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 2 min, and
extension at 72°C, followed by another 30 cycles of denaturation at 94°C for 20 s,
annealing at 55°C for 1 min, and extension at 72°C for 1 min. The final extension
was conducted at 72°C for 7 min (21). Moreover, the isolated DNA was tested for
the presence of sequence motifs specific for Mycobacterium spp. (gene encoding
heat-shock protein DnaJ [28]), M. tuberculosis complex (IS6110 [43]), M. avium
subsp. avium (IS901 [23, 34]), and M. avium subsp. paratuberculosis (IS900 [13]).
The method of Nagai et al. (28) was used to detect a specific region (230 bp) of
the heat shock protein-encoding dnaJ gene using the primers YNP9 and YNP10
that target all mycobacteria (Table 1). The PCR program consisted of the
following steps: denaturation at 94°C for 1 min, 30 cycles of denaturation at 94°C
for 1 min, annealing at 58°C for 2 min, and extension at 72°C for 1 min, with a
final extension at 72°C for 7 min. The DNA of M. avium subsp. paratuberculosis
was analyzed for the presence of the insertion sequence IS900, which is specific
for this subspecies. The oligonucleotides P90 and P91 (Table 1) designed by
Green et al. were used in PCR to distinguish M. avium subsp. paratuberculosis
from other mycobacterial species. The product of 412 bp was amplified by PCR
as follows: a denaturation step at 94°C for 3 min, followed by 30 cycles of
denaturation at 94°C for 1 min, annealing at 65°C for 45 s, and extension at 72°C
for 2 min, with a final extension at 72°C for 2 min (13). The amplification
products were separated on a 2% agarose gel, stained with ethidium bromide,
and photographed under UV transillumination.
Gene cloning and sequencing. The enzymes used for DNA manipulation were
obtained from New England Biolabs, Inc. (Beverly, MA), and TaKaRa Shuzo
Co. (Kyoto, Japan). All other chemicals were purchased from Sigma-Aldrich
(St. Louis, MO). Primer pairs flanking the rv2579 and rv2296 genes of
M. tuberculosis were designed and used in a PCR with the total DNA of M. bovis
5033/66. The primers for the cloning of the dmbA gene were designated DMBAf
and DMBAr, and the primers designated DMBBf1 and DMBBr1 were used for
cloning of the dmbB gene (Table 1). To enable cloning into plasmid pUC18,
forward and reverse primers were 5? end modified by using the EcoRI and
HindIII restriction sites, respectively. In addition, reverse primers also contained
5? end modification, allowing the in-frame introduction of the His6tail into C
terminus of cloned DmbA and DmbB. PCR was carried out in 50-?l volumes
using the Taq PCR Master Mix Kit (QIAGEN, Hilden, Germany) according to
the instructions of the manufacturer. The PCR cycle for dmbA gene amplifica-
tion consisted of a denaturation step for 4 min at 94°C, followed by 30 cycles of
denaturation at 94°C for 40 s, annealing at 62°C for 30 s, and extension at 72°C
for 90 s, with a final extension step at 72°C for 5 min. The cycling parameters for
dmbB gene amplification were 94°C for 4 min, followed by 30 cycles of 94°C for
40 s, 55°C for 40 s, and 72°C for 90 s, with a final elongation step for 10 min. The
same cycling parameters were used for the combinations of primers DMBBf1
and DMBBr1 and primers DMBBf2 and DMBBr2. Prior to the digestion with
restriction endonucleases, the PCR products were purified with the QIAquick gel
extraction kit (QIAGEN, Hilden, Germany) and ligated with the pUC18 plasmid
(Invitrogen, Groningen, The Netherlands) digested and purified in the same way.
Recombinant plasmids harboring inserts of the correct size were sequenced by using
an ABI Prism 310 genetic analyzer (Perkin-Elmer, Norwalk, CT).
Expression and protein purification. For the protein expression, dmbA and
dmbB genes were recloned to pAQN (29). In this plasmid, His-tagged DmbA
and DmbB were expressed under the control of the tac promoter. E. coli
BL21(DE3) transformed with the plasmid pAQN containing dmbA or dmbB,
respectively, was grown in 4 liters of Luria broth with ampicillin (100 ?g/ml) at
37°C. When the culture reached an optical density of 0.6 at 600 nm, protein
expression was induced by the addition of IPTG (isopropyl-?-D-thiogalacto-
pyranoside) to a final concentration of 1 mM. Since DmbB was repeatedly
purified with a low yield, in an attempt to increase its recovery, the dmbB was
cloned into pTrxFus vector (Invitrogen, Amsterdam, The Netherlands) by using
the primers DMBBf2 and DMBBr2. In this plasmid, His-tagged DmbB was fused
to thioredoxin and expressed under the control of the PLpromoter. In this case,
E. coli GI724 was grown in 4 liters of medium containing 0.2% Casamino Acids,
0.5% glucose, 1 mM MgCl2, Na2HPO4(6 g/liter), KH2PO4(3 g/liter), NaCl
(0.5 g/liter), NH4Cl (1 g/liter), and ampicillin (100 ?g/ml) at 30°C. When the
culture reached an optical density of 0.5 at 600 nm, protein expression was
induced by the addition of L-tryptophan to a final concentration of 100 ?g/ml.
TABLE 1. Oligonucleotides used for identification of mycobacterial DNA and cloning and screening of dehalogenase genes
Primer Target gene(s) Sequence (5?-3?)a
Position
Source or
reference
UNB51
UNB800
YNP9
YNP10
P90
P91
DMBAf
DMBAr
DMBBf1
DMBBr1
DMBBf2
DMBBr2
RV1f
RV5f
RV7r
RV8f
TBC4r
TBC5f
TBC6r
TBC7f
Bacterial 16S rRNA
Bacterial 16S rRNA
dnaJ (heat shock protein)
dnaJ (heat shock protein)
Insertion sequence IS900
Insertion sequence IS900
dmbA
dmbA
dmbB
dmbB
dmbB
dmbB
dmbA
dmbA
dmbA
dmbA
dmbB
dhmA
dmbB, dhmA
dmbB, dhmA
GAGTTTGATCCTGGCTCA
GGACTACCAGGGTATCTAAT
GGGTGACGCGGCATGGCCCA
CGGGTTTCGTCGTACTCCTT
GAAGGGTGTTCGGGGCCGTCGCTTAGG
GGCGTTGAGGTCGATCGCCCACGTGAC
GCCGAATTCTAAGGAGGAATATCGATGACAGCATTCGGC
GCCAAGCTTTCAGTGATGGTGATGGTGATGGACGCCGGCGGCCGCCGACCG
GCCGAATTCTAAGGAGGAATATCGATGGATGGATGTCCTACGC
GCCAAGCTTTTAGTGATGGTGATGGTGATGCGTTGCCTGCTGCCAGGA
GCCGGATCCTATGGATGTCCTACGCACC
GCNCTGCAGTTAGTGATGGTGATGGTGATGCGTTGCCTGCTGGGAG
GCTATAGCTATGGCGAGCAA
GTTGTCGTGGCCACGAAAC
GCTGTCCTCCTGAACGAAAT
GGGACCCGACCGCTATAGC
CGGGGAAAGGTGCATCGTAG
TTCGAAAACCTGGAGGACTAC
GAAAGCCGTTGGCCACCACC
GCACGGCGAGCCCACCTGGAG
8–2721
21
28
28
13
13
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
787–806
13–32
229–248
15–41
401–427
Cloning primerb
Cloning primer
Cloning primer
Cloning primer
Cloning primer
Cloning primer
239–258
615–633
818–837
228–246
585–604
31–51
429–448
156–176
aRestriction sites are underlined.
bCloning primer, primers designed in reference to flanking regions of cloned genes. To the 5? end of each primer specific restriction sequences were added.
VOL. 71, 2005 HALOALKANE DEHALOGENASES FROM MYCOBACTERIA6737

Page 3

The cells were harvested 4 h after the induction and disrupted by sonication using
a Soniprep 150 (Sanyo Gallenkamp PLC, Loughborough, United Kingdom).
After centrifugation at 21,000 ? g for 1 h, the supernatant was filtered through
a 0.45-?m-pore-size filter and further purified on Ni-nitrilotriacetic acid Sepha-
rose column (QIAGEN, Hilden, Germany). The His-tagged protein was bound
to the resin equilibrated with a buffer containing 20 mM potassium phosphate,
0.5 M sodium chloride, and 10 mM imidazole (pH 7.5). Unbound and weakly
bound proteins were washed out by a buffer with 20 mM potassium phosphate,
0.5 M sodium chloride, and 65 mM imidazole (pH 7.5), and the His-tagged
haloalkane dehalogenase was eluted by using an elution buffer (20 mM potas-
sium phosphate, 0.5 M sodium chloride, 225 mM imidazole [pH 7.5]). Protein
homogeneity was verified by sodium dodecyl sulfate-polyacrylamide gel electro-
phoresis (SDS-PAGE), and the proteins were stored in a 50 mM phosphate
buffer (pH 7.5) at 4°C.
CD spectra and thermal denaturation curves. Circular dichroism (CD) spectra
were recorded at room temperature with a Jasco J-810 spectrometer (Jasco,
Tokyo, Japan). The data were collected from 185 to 260 nm at 100 nm/min, with
a 1-s response time and a 2-nm bandwidth using a 0.1-cm quartz cuvette con-
taining 0.15 mg of protein/ml in a 50 mM potassium phosphate buffer (pH 7.5).
Each spectrum shown is the average of 10 individual scans and is corrected for
absorbance caused by the buffer. For thermal denaturation, the protein solutions
were heated from 22 to 72°C at 1°C/min. The changes in the ellipticity were
monitored at 221, 225, and 221 nm for LinB, DmbA, and DmbB, respectively.
The protein concentration of the samples was checked throughout the denatur-
ation experiment. The recorded thermal denaturation curves of each protein
were normalized to represent signal changes between approximately 1 and 0 and
sequentially fitted to sigmoidal curves. The melting temperatures were evaluated
from the collected data as a midpoint of the normalized thermal transition.
Biochemical characterization. The mycobacterial putative haloalkane dehalo-
genases were purified to homogeneity and characterized for their pH and tem-
perature optimum and their catalytic activity. The pH dependence of haloalkane
dehalogenase activity was tested by varying the buffer components in the assay.
The buffer containing 50 mM potassium acetate was used in the range from pH
4.0 to 6.0, the 50 mM phosphate buffer varied from pH 6.0 to 8.0, and the
100 mM glycine buffer varied from pH 8.0 to 10.0. The temperature dependence
of the enzyme was determined by conducting the dehalogenation reaction at a
temperature ranging from 20 to 60°C and the subsequent determination of
products of dehalogenase activity by gas chromatography. The 1,2-dibromo-
ethane was used as a substrate for the testing of biochemical properties of DmbA
and DmbB. All activity assays were conducted in triplicates for DmbA, whereas
replicated experiments could not be performed with DmbB due to the low
expression yields. Steady-state kinetic constants were determined for DmbA only
using two substrates: 1-chlorobutane and 1,3-dibromopropane. The kinetic data,
i.e., the rate of the enzymatic reaction v against the substrate concentration [S],
were fitted to the Michaelis-Menten equation as follows: v ? ([E] · [S] · kcat)/
(Km?[S]). The steady-state kinetic constants (kcat, Km, and Ksi) were calculated
by using the computer program EZ-Fit Version 1.1 (F. W. Perrella). The turn-
over number, kcat, is the number of molecules converted per second by one
enzyme molecule under substrate saturation conditions. The Michaelis-Menten
constant, Km, is the dissociation constant and quantifies the substrate concen-
tration at which 50% of the maximal velocity (0.5 · kcat· [E]) has been reached.
The substrate inhibition constant, Ksi, is the dissociation constant for the inactive
complex of enzyme with more than one substrate in the active site.
Activity assays. The activities of purified mycobacterial dehalogenases were
determined by a microtiter plate colorimetric assay using the reagents of Iwasaki
(14) described previously (26). The amount of 0.2 mg of pure DmbA per ml in
the glycine buffer (pH 8.5) was incubated with the halogenated substrate at a
final concentration 10 mM. The progress of the reaction was monitored after 10,
20, and 30 min by measuring the activity of pure DmbA and DmbB. A more
precise determination of activities was achieved by using gas chromatography (3).
The reaction conditions were the same as those for the spectrophotometric assay.
Steady-state kinetics were assessed by the determination of the substrate and
product concentrations by using a gas chromatograph Trace GC 2000 (Finnigen,
San Jose, CA) equipped with a flame ionization detector and the capillary
column DB-FFAP (30 m by 0.25 mm by 0.25 ?m; J&W Scientific, Folsom, CA).
Gene screening. Primers used for the screening of putative haloalkane deha-
logenase genes (Table 1) were designed according to the sequences of the dmbA
(accession code Z77724), dmbB (accession code Z77163), and dhmA (accession
code AJ314789). PCRs were carried out in a 20-?l volume using the Taq Master
Mix Kit (QIAGEN). Three different combinations of oligonucleotides were used
for screening of the dmbA gene (RV1f?RV7r, RV5f?RV7r, and RV7r?RV8f),
whereas two combinations of oligonucleotides were used for screening of the
dmbB (TBC4r?TBC7f and TBC6r?TBC7f) and dhmA (TBC5f?TBC6r and
TBC6r?TBC7f) genes. The PCR protocol consisted of an initial denaturation
step at 95°C for 3 min, followed by 35 cycles of denaturation at 94°C for 40 s and
annealing for 80 s, with a final extension at 72°C for 3 min. The annealing
temperatures varied for each oligonucleotide combination and were optimized
by using gradient PCR. The annealing temperatures were as follows: 55°C for
primer combinations RV5f-RV7r and RV7r-RV8f, 57°C for primer combina-
tions RV1f-RV7r and TBC5f-TBC6r, 59°C for primer combination TBC4r-
TBC7f, and 59°C for primer combination TBC6r-TBC7f.
Nucleotide sequence accession numbers. The nucleotide sequences of dmbA
and dmbB have been deposited in EMBL/GenBank/DDBJ databases under
accession numbers AJ784272 and AJ784273, respectively.
RESULTS
Cloning and sequencing of putative haloalkane dehaloge-
nase genes dmbA and dmbB. The open reading frames rv2579
and rv2296 present in the genome of M. tuberculosis H37Rv
have been previously identified as putative haloalkane dehalo-
genase genes based on the comparison of known haloalkane
dehalogenases with the sequences deposited in genetic data-
bases (19). The third open reading frame rv1833c showing a
distant relationship with haloalkane dehalogenases (31.7%
identity) was not considered in our study. The genome se-
quence of M. tuberculosis H37Rv provided data necessary for
designing primers complementary to the regions flanking
haloalkane dehalogenase-like genes. The DNA of M. bovis,
showing a 99.9% identity of the entire genome at nucleotide
level with M. tuberculosis H37Rv, was used for the cloning of
genes designated dmbA and dmbB (for dehalogenases from M.
bovis, paralogs A and B, respectively). Sequencing of the dmbA
gene revealed 100% identity with that isolated from M. bovis
MU11 (accession no. AJ243259). The translation product of
the dmbA gene differs from the translation product of rv2579 of
M. tuberculosis by one amino acid. The DmbA protein carries
glutamine in position 293 instead of arginine present in the
FIG. 1. SDS-PAGE of purified haloalkane dehalogenases from
M. bovis. The proteins were stained in 0.25% Coomassie blue R-250.
6738 JESENSKA ´ ET AL.APPL. ENVIRON. MICROBIOL.

Page 4

protein encoded by rv2579. The highest sequence identity
(68%) found with biochemically characterized proteins was
identified with LinB from S. paucimobilis UT26 (31). DmbB
does not differ from the translation product rv2296 of M. tu-
berculosis. The translation product of M. tuberculosis gene
dmbB shares 82% sequence identity with the haloalkane de-
halogenase DhmA from M. avium subsp. avium N85 (18) and
39% sequence identity with the haloalkane dehalogenase
DhlA from Xanthobacter autotrophicus GJ10 (17). The G?C
content of both genes (dmbA [63.7%] and dmbB [66.5%]) does
not significantly differ from an average G?C content in the
genome of M. bovis and M. tuberculosis.
Expression and purification of haloalkane dehalogenases
DmbA and DmbB. Haloalkane dehalogenase DmbA was pu-
rified with a yield of 0.1 mg per g of cell mass. Although the
dmbA gene contains approximately the same number of
codons rarely used in E. coli as linB gene (29), the level of
expression was one magnitude lower compared to LinB using
the same expression system. Haloalkane dehalogenase DmbB
was purified with a yield of 0.01 mg per g of cell mass. Purified
haloalkane dehalogenases DmbA and DmbB migrated as sin-
gle bands on SDS-PAGE with a molecular masses of 34.5 and
34.1 kDa, respectively (Fig. 1). Proper folding of the purified
DmbA and DmbB was verified by CD spectroscopy. The CD
spectra of mycobacterial haloalkane dehalogenases DmbA and
DmbB were compared to the spectra of haloalkane dehaloge-
nases with known tertiary structures, i.e., LinB, DhaA, and
DhlA (25, 33, 44).
Thermostability of haloalkane dehalogenases DmbA and
DmbB. The CD spectra of mycobacterial dehalogenases were
initially measured to identify suitable wavelengths for the mon-
itoring of their thermal denaturation. Thermal denaturation
was tested with LinB, DmbA, and DmbB. DmbB without fu-
sion protein was used for thermostability measurements to
prevent artifacts due to the denaturation of thioredoxin. All
three proteins showed changes in ellipticity while being heated
(Fig. 2). The intensity of this signal decreased with tempera-
ture for each protein following the sigmoidal curve. The melt-
ing temperatures were different for respective proteins: 42.2°C
for LinB, 47.4°C for DmbA, and 57.4°C for DmbB. Compari-
son of the CD spectra before heating from 22 to 72°C with the
heating rate 1°C/min and after heating, i.e., after cooling back
in 50 min using the same heating rate and incubation at room
temperature (22°C) for 10 min, is summarized in Fig. 3. All
native dehalogenases showed CD spectra typical for predom-
inantly ?-helical conformation with two negative features at
about 221 and 208 nm and a positive peak at about 195 nm. In
comparison to the CD spectrum of native protein, the intensity
of the CD spectrum of LinB after thermal denaturation was
significantly lower (Fig. 3A). Moreover, these two CD spectra
differ in the ?222/?208ratio, indicating some structural varia-
tion. The CD spectrum of the DmbA protein (Fig. 3B) showed
the typical shape of a random coil structure with dominant-
negative features at about 200 nm and a broad negative ellip-
ticity for 230 to 215 nm after thermal denaturation. This indi-
cates that the DmbA protein lost its ?-helical conformation
entirely upon heating to the denaturation temperature. Unlike
LinB and DmbA, the CD spectrum of DmbB had the same
shape before and after thermal denaturation (Fig. 3C). The
spectrum of the DmbB protein after heating keeps character-
FIG. 2. Thermal denaturation curves of haloalkane dehaloge-
nases LinB, DmbA, and DmbB (dotted lines). The global fit of the
sigmoidal model to the data of protein denaturation curves is shown
as a solid line.
FIG. 3. Far-UV CD spectra of LinB (A), DmbA (B), and DmbB (C) dehalogenating enzymes. Solid lines represent the CD spectra of proteins
before heating, and dotted lines represent the CD spectra of proteins after heating from 22°C to 72°C, cooling, and incubation at 22°C for 10 min.
VOL. 71, 2005 HALOALKANE DEHALOGENASES FROM MYCOBACTERIA6739

Page 5

istics of ?-helical conformation with somewhat smaller inten-
sity. A significant decrease of the DmbB concentration was not
observed after thermal denaturation experiment, suggesting
that the decrease of CD spectrum intensity of this protein is
not caused by the loss of the protein from the solution but
rather by a partial loss of the helical structure. The thermal
denaturation is most likely irreversible in the case of LinB and
DmbA enzymes, with no recovery of native structure after
being heated to 72°C, whereas denaturation of the DmbB
enzyme seems to be partially reversible.
Activity profiles of haloalkane dehalogenases DmbA and
DmbB. The pH optimum of DmbA and DmbB was determined
over the range of pH between 4.0 and 10.0. The haloalkane
dehalogenase DmbA showed more than one pH optimum
(Fig. 4) with maximal activity at pH 9.0. The high activity of the
enzyme at the alkaline pH was in agreement with the pH
optimum of other characterized haloalkane dehalogenases.
The potassium phosphate buffer had a strong inhibitory effect
on DmbA. DmbB was characterized as a fusion protein with
thioredoxin to overcome problems with its insolubility. The
dependence of haloalkane dehalogenase DmbB activity on pH
showed a different trend. The highest activity was observed at
pH 6.5 in the phosphate buffer. Both haloalkane dehaloge-
nases, DmbA and DmbB exhibited similar temperature optima
at ca. 45°C (Fig. 5). Above this temperature both enzymes
rapidly became inactivated. At 20°C, 32.5% of the maximum
activity was observed for DmbA, whereas DmbB did not show
any activity. We note that the temperature profiles of the two
dehalogenases from M. bovis cannot be directly compared
since DmbB was characterized in the form of a fusion protein.
Catalytic activity of DmbA. Michaelis-Menten kinetic con-
stants of the haloalkane dehalogenase DmbA were compared
to the sixfold mutant of LinB (F143W, Q146A, D147V, L177A,
I211L, and L248I), which was designed to possess an active site
and an entrance tunnel of DmbA. Sixfold mutant LinB had
FIG. 4. Effect of pH on activity of M. bovis haloalkane dehaloge-
nases DmbA (top panel) and DmbB (bottom panel). The data for
DmbA are expressed as relative activities, and error bars represent the
standard errors. Experiments with DmbB were not replicated due to
insufficient protein material. Measurements were made with the sub-
strate 1,2-dibromoethane at 37°C in 100 mM buffers: potassium ace-
tate (F), potassium phosphate (■), or glycine buffer (Œ).
FIG. 5. Effect of temperature on activity of haloalkane dehaloge-
nases DmbA (top panel) and DmbB (bottom panel). The activities
were determined with the substrate 1,2-dibromoethane. 2-Bromo-
ethanol was identified as a reaction product by using gas chromatog-
raphy. The data for DmbA are expressed as relative activities, and
error bars represent the standard errors. Experiments with DmbB
were not replicated due to insufficient protein material. The specific
activity of DmbA under optimal conditions is 0.2125 ?mol s?1mg of
protein?1; the specific activity of DmbB is 0.0044 ?mol s?1mg of
protein?1.
6740 JESENSKA ´ ET AL.APPL. ENVIRON. MICROBIOL.