Article

Transport of drugs in the kidney by the human organic cation transporter, OCT2 and its genetic variants.

Department of Biopharmaceutical Sciences, University of California San Francisco, USA.
Journal of Pharmaceutical Sciences (Impact Factor: 3.01). 02/2006; 95(1):25-36. DOI: 10.1002/jps.20536
Source: PubMed

ABSTRACT The human organic cation transporter 2 (OCT2, SLC22A2) is a multispecific transporter of organic cations, including many clinically used drugs. OCT2 is primarily responsible for the uptake of organic cations across the basolateral membrane of renal tubular epithelial cells and is considered a major transporter in the active secretion of organic cations in the kidney. Uptake of organic cations by OCT2 is driven by the inside-negative membrane potential and is pH-sensitive. Regulation of OCT2 at the transcriptional level by steroid hormones and at the protein level by various protein kinases has been described. Several human genetic variants in the coding region of OCT2 have been identified and functionally characterized, including both polymorphic and rare variants. A variety of structurally diverse compounds have been shown to interact with OCT2, including endogenous compounds, drugs, and dietary supplements.

0 Bookmarks
 · 
82 Views
  • [Show abstract] [Hide abstract]
    ABSTRACT: Veliparib (ABT-888) is largely eliminated as parent drug in human urine (70% of the dose). Renal unbound clearance exceeds glomerular filtration rate, suggesting the involvement of transporter-mediated active secretion. Clinically relevant pharmacokinetic interactions in the kidney have been associated with OAT1, OAT3, OCT2, MATE1, and MATE2K. In the present study, interactions of veliparib with these transporters were investigated. Veliparib inhibited OAT1, OAT3, OCT2, MATE1, and MATE2K with IC50 values of 1371, 505, 3913, 69.9, and 69.5 μM, respectively. The clinical unbound maximum plasma concentration of veliparib after single oral dose of 50 mg (0.45 μM) is manyfold lower than IC50 values for OAT1, OAT3, OCT2, MATE1, or MATE2K. These results indicate a low potential for drug-drug interaction (DDI) with OAT1/3, OCT2, or MATE1/2K. Additional studies demonstrated that veliparib is a substrate of OCT2. In Oct1/Oct2 double-knockout mice, the plasma exposure of veliparib was increased by 1.5-fold, and the renal clearance was decreased by 1.8-fold as compared with wild-type mice, demonstrating that organic cation transporters contribute to the renal elimination in vivo. In summary, the in vitro transporter data for veliparib predicts minimal potential for an OAT1/3-, OCT2-, and MATE1/2K-mediated DDI given the clinical exposure after single oral dose of 50 mg. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association J Pharm Sci.
    Journal of Pharmaceutical Sciences 10/2013; · 3.13 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Lung cancer is one of the most common cancers and is the leading cause of death worldwide. Platinum-based chemotherapy is the main treatment method in lung cancer patients. Our previous studies indicated that single nucleotide polymorphisms (SNPs) in some transporter genes played important role in platinum-based chemotherapy efficacy. The aim of this study was to investigate the association of SNPs in transporter genes and platinum-based chemotherapy efficacy. The main polymorphisms on transporters OCT2, LRP, AQP2, AQP9 and TMEM205 genes were genotyped in 338 lung cancer patients. The rs195854 in genotypic model, rs896412 in genotypic and recessive models for all subjects showed significant association with chemotherapy response. In stratification analysis, TMEM205 rs896412, OCT2 rs1869641 and rs195854, AQP9 rs1516400 and AQP2 rs7314734 showed significant relation to chemotherapy response. In conclusion, the genetic polymorphisms in OCT2, AQP2, AQP9 and TMEM205 may contribute to chemotherapy response in lung cancer patients.
    PLoS ONE 03/2014; 9(3):e91967. · 3.53 Impact Factor
  • [Show abstract] [Hide abstract]
    ABSTRACT: Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0 %, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5 %, respectively.
    Molecular Biology Reports 11/2014; · 1.96 Impact Factor