Expression of cholera toxin B subunit and assembly as functional oligomers in silkworm.

Abstract

The nontoxic B subunit of cholera toxin (CTB) can significantly increase the ability of proteins to induce immunological tolerance after oral administration, when it was conjugated to various proteins. Recombinant CTB offers great potential for treatment of autoimmune disease. Here we firstly investigated the feasibility of silkworm baculovirus expression vector system for the cost-effective production of CTB under the control of a strong polyhedrin promoter. Higher expression was achieved via introducing the partial non-coding and coding sequences (ATAAAT and ATGCCGAAT) of polyhedrin to the 5' end of the native CTB gene, with the maximal accumulation being approximately 54.4 mg/L of hemolymph. The silkworm bioreactor produced this protein vaccine as the glycoslated pentameric form, which retained the GM1-ganglioside binding affinity and the native antigenicity of CTB. Further studies revealed that mixing with silkworm-derived CTB increases the tolerogenic potential of insulin. In the nonconjugated form, an insulin : CTB ratio of 100 : 1 was optimal for the prominent reduction in pancreatic islet inflammation. The data presented here demonstrate that the silkworm bioreactor is an ideal production and delivery system for an oral protein vaccine designed to develop immunological tolerance against autoimmune diabetes and CTB functions as an effective mucosal adjuvant for oral tolerance induction.

Full text

Page 1

Journal of Biochemistry and Molecular Biology, Vol. 38, No. 6, November 2005, pp. 717-724
Expression of Cholera Toxin B Subunit and Assembly as
Functional Oligomers in Silkworm
Zhao-Hui Gong†,#, Hui-Qing Jin†,#, Yong-Feng Jin†,* and Yao-Zhou Zhang‡,*
†Institute of Biochemistry, College of Life Sciences, Zhejiang University, 268 Kaixuan Road, Hangzhou 310029, China
‡Institute of Biochemistry, College of Life Sciences, Zhejiang Sci-Tech University, Second Avenue, Hangzhou 310018, China
Received 11 August 2005, Accepted 19 September 2005
The nontoxic B subunit of cholera toxin (CTB) can
significantly increase the ability of proteins to induce
immunological tolerance after oral administration, when it
was conjugated to various proteins. Recombinant CTB
offers great potential for treatment of autoimmune disease.
Here we firstly investigated the feasibility of silkworm
baculovirus expression vector system for the cost-effective
production of CTB under the control of a strong polyhedrin
promoter. Higher expression was achieved via introducing
the partial non-coding and coding sequences (ATAAAT
and ATGCCGAAT) of polyhedrin to the 5’ end of the
native CTB gene, with the maximal accumulation being
approximately 54.4 mg/L of hemolymph. The silkworm
bioreactor produced this protein vaccine as the glycoslated
pentameric form, which retained the GM1-ganglioside
binding affinity and the native antigenicity of CTB.
Further studies revealed that mixing with silkworm-
derived CTB increases the tolerogenic potential of insulin.
In the nonconjugated form, an insulin : CTB ratio of 100 :
1 was optimal for the prominent reduction in pancreatic
islet inflammation. The data presented here demonstrate
that the silkworm bioreactor is an ideal production and
delivery system for an oral protein vaccine designed to
develop immunological tolerance against autoimmune
diabetes and CTB functions as an effective mucosal
adjuvant for oral tolerance induction.
Keywords: Autoimmune diabetes, Baculovirus, Cholera toxin
B subunit, Edible vaccine, Oral tolerance, Silkworm
Introduction
Cholera toxin B subunit (CTB) is the pentameric non-toxic
portion of cholera toxin (CT), responsible for the holotoxin
binding to the GM1 ganglioside receptor present on most
nucleated cells (Cuatrecasas, 1973). When conjugated to
autoantigens, the CTB dramatically increases their tolerogenic
potential after oral administration (Pierre et al., 1992; Sun et
al., 1994, 1996 and 2000; Bergerot et al., 1997; McSorley et
al., 1998; Rask et al., 2000). This effect is probably mediated
by the ability of CTB to act as a mucosal carrier system (Sun
et al., 1994), although CTB might also have direct effects on
the immune system (Li and Fox, 1996; Burkart et al., 1999).
Recent studies have showed that CTB is an effective mucosal
adjuvant in potentiating immune responses or increasing
immunological tolerance to corresponding antigens (Tochikubo
et al., 1998; Wu et al., 1998; Yasuda et al., 1998; Sun et al.,
2000; Maeyama et al., 2001; Anjuere et al., 2003; Bregenholt
et al., 2003; Holmgren et al., 2005; Zhang et al., 2005). These
investigations indicate that CTB is a powerful edible vaccine
if expressed in large-scale production in an edible tissues or
organism.
Up to now, the CTB gene has been expressed in Escherichia
coli (Areas et al., 2002), Swiss 3T3 cells (Hashimoto et al.,
1996), transgenic tobacco (Hein et al., 1996; Wang et al.,
2001; Daniell et al., 2001), potato (Arakawa et al., 1997), and
tomato (Jani et al., 2002). However, the recombinant CTB
expressed in Escherichia coli was in an insoluble form, which
required extensive purification. In addition, bacteria-derived
CTB is inappropriate as an edible vaccine because of the
contamination of endotoxin. Despite the suitability of plant
expression systems for the production of CTB as functional
oligomers, the expresssion levels in transgenic plants are not
satisfied with the therapeutic applications in humans.
The development of recombinant protein production in the
silkworm baculovirus expression vector system (BEVS) may
overcome this limitation and thus may facilitate the use of
genetically modified edible proteins for the production and
#These authors contributed equally to this work.
*To whom correspondence should be addressed.
Tel: 86-571-86971414; Fax: +86-571-86971501
E-mail: jinyf@zju.edu.cn; yaozhou@chinagene.com

Page 2

718 Zhao-Hui Gong et al.
delivery of vaccine antigens (Miller, 1988; Wang et al., 1991).
There is the potential for not only low-cost but also high-
capacity production with the capability to scale-up to agricultural
levels. Using the Bombyx mori nuclear polyhedrosis virus
(BmNPV) of the baculovirus expression system also eliminates
concerns regarding pathogens that could potentially be
transmitted to humans. The baculovirus is non-infectious to
vertebral animals, and the system itself is safe (Carbonell and
Miller, 1987; Herrington et al., 1992). Collectively, these
features make the silkworm system an ideal expression and
delivery package for producing oral vaccines.
Generally, silkworm is a high-level expression system (Miller,
1988). The production levels of foreign genes are very different in
the silkworm baculovirus system. Several extra techniques are
used to improve the production level in this system, such as
selecting appropriate codon, introducing 5'-untranslated
sequences and coexpressing chaperones (Kost et al., 2005).
In this paper, the partial non-coding and coding sequences
of polyhedrin are specially fused to the 5'-end of the native
CTB gene and this modified CTB gene were expressed in
BmN cells and silkworm larvae with BEVS. We found that
the production level in silkworm larvae was encouraging,
reaching 54.4mg/L of hemolymph. Furthermore, the expressed
recombinant protein was released into the hemolymph in a
pentameric form, retaining the GM1-ganglioside binding affinity
and the native antigenicity of CTB. The oral administration of
this silkworm-derived CTB and insulin admixtures suppressed
pancreatic islet inflammation in non-obese diabetic (NOD)
mice. This investigation demonstrates the potential of other
oral protein vaccines to be expressed and assembled properly
in the silkworm bioreactor.
Materials and Methods
Reagents, B. mori larvae, cell line and mice
and PCR amplification kit were purchased from TaKaRa
Biomedicals (Japan). The pBacPAK8 transfer vector was obtained
from Clontech (Palo Alto, USA). DOSPER liposomal transfection
reagent, DIG DNA labeling and detection kit and chromogenic
Western blotting kit were supplied by Roche Diagnostics
(Germany). The recombinant plasmid pBlue-CTB was provided by
Dr. Shengwu Ma. Fifth-instar silkworm B. mori larvae (Jingsong ×
Haoyue, Showa) were fed fresh mulberry leaves and reared under a
photoperiod schedule of 12 h light and 12 h darkness at 25 ± 1oC.
BmN cells were cultured in TC-100 medium (Gibco-BRL, Gaithersburg,
USA) containing 10% fetal calf serum (Gibco-BRL) and 50 µg/ml
gentamycin at 27oC. Female non-obese diabetic (NOD) mice were
purchased from Shanghai Laboratory Animal Center (SLAC, CAS,
China) and housed at the central animal facility, where they were
screened for bacterial and viral pathogens.
DNA manipulation
Construction of the recombinant transfer vector pBacPAK-
CTB
In order to introduce the polyhedrin non-coding and coding
sequences (in bold type) up-/down-stream of the start codon of the
coding sequence of the native CTB gene, the primers for PCR
amplication from pBlue-CTB were designed as follows: forward
primer 5' GGGGATCCATAAATATGCCGAATATTAAATTAAA
ATTTGGTGT 3' (BamHI) and reverse primer 5' GGGAATTCTTA
ATTTGCCATACTAATTG 3' (EcoRI). Then the CTB gene was
inserted into the transfer vector pBacPAK8 downstream of the
polyhedrin promoter. Following confirmation of the DNA
sequences, the recombinant transfer vector pBacPAK-CTB was
constructed and verified.
Transfection and isolation of the recombinant baculovirus Co-
transfection was performed as described in our previous work
(Gong et al., 2005). Briefly, the purifed recombinant transfer vector
pBacPAK-CTB and linearized viral DNA of modified baculovirus
Bm-BacPAK6 digested with Eco81I were used for co-infection in
cultured BmN cells. After purification by three rounds of plaque
isolation, the recombinant virus was selected and then identified
further by PCR amplification and genomic DNA hybridization.
Finally, the recombinant virus stock was prepared and the dilution
of the virus was calculated using the Reed-Muench method.
Expression of recombinant CTB in B. mori cells and larvae
BmN cells (2 × 106 cells/flask) were infected with the recombinant
virus at a medium dose (MOI = 10). The infected cells were
cultured at 27oC. Then the cultured cells were harvested at 2-7 d
post-infection respectively. The BmN cells were resuspended in
0.2 ml of PBS, and then the cells were lysed by repeated freezing
and thawing or gentle sonication. After centrifugation to remove the
insoluble debris, the supernatant was collected. The fifth instar B.
mori larvae were needle inoculated with the recombinant viral
solution (1 × 107 pfu/ml) into the body cavity, using wild-type virus
injection as control. The infected larvae were reared at 25oC.
Hemolymph was then collected at 2-7 d post-inoculation and
centrifuged to remove the insoluble impurities. For further analysis,
the hemolymph samples were stored at −20oC.
ELISA quantification of CTB
levels in BmN cells and silkworm larvae were determined by
quantitative ELISA assay. A 96-well microtiter plate (JET, Canada)
was loaded with serial dilutions of the cell-lysed supernatant or
hemolymph in bicarbonate buffer, pH 9.6 (15 mmol/l NaCO3, 35
mmol/l NaHCO3) and incubated overnight at 4oC. The plate was
washed three times in PBST (phosphate buffered saline (PBS)
containing 0.05% Tween-20). The background was blocked by
incubation in 1% bovine serum albumin (BSA) in PBS (100 µl/
well) for 2 h at 37oC, followed by washing three times with PBST.
The plate was incubated in a 1 : 8000 dilution of rabbit anti-cholera
toxin primary antibody (Sigma) (100 µl/well) at 37oC for 2 h,
followed by washing the wells three times with PBST. Then the
plate was incubated with a 1 : 2000 dilution of anti-rabbit IgG
conjugated with horseradish peroxidase (SABC, China) (100 µl/
well) for 2 h at 37oC and washed three times with PBST. Finally the
chromogenic substrate O-phenylenediamine (SCRC, China) (100
ìl/well) was added to the wells and the plate was incubated for 20
min at 37oC to develop color, followed by adding 2 mol/l H2SO4 (50
µl/well) to stop the reaction. The plate was cooled to room temperature
before the absorbencies were measured in a Labsystems Multiskan
MS ELISA plate reader (Labsystems, Finland) at 492nm. Comparison
of the absorbance at 492 nm of a known amount of bacterial CTB-
The recombinant CTB protein

Page 3

Expression of Recombinant Cholera Toxin B Subunit in Silkworm719
antibody complex (linear standard curve) and that of a known
concentration of transformed plant total soluble protein was used to
estimate CTB expression levels.
Western blot analysis
or pentameric recombinant CTB, the cell-lysed supernatant or
hemolymph samples were electrophoresed in a 12% SDS-PAGE
for 45-60 min at 20 mA in Tris-glycine buffer (25 mM Tris, 250
mM glycine, pH 8.3, 0.1% SDS). Prior to electrophoresis, samples
of the hemolymph were either boiled for 5 min prior to
electrophoresis or loaded directly on the gel without heat treatment.
The separated proteins were transferred from the gel to Hybond-P
membrane (Amersham Biosciences) by electroblotting on a wet
blotter (Bio-Rad, Richmond, USA) at 60 v for 2 h. The following
immunoreaction and detection was performed by using a chromogenic
western blotting kit according to manufacture’s protocol. In this
procedure, a rabbit anti-cholera toxin antiserum (Sigma, St. Louis,
USA) and rabbit anti-insulin primary antibody were used for the
immunoreaction respectively.
For detection of the presence of monomeric
Enzymatic deglycosylation of silkworm-expressed CTB The
cell-lysed supernatant or hemolymph containing CTB protein were
digested with the deglycosylating enzyme peptide N-glycosidase F
and O-glycosidase respectively (Roche) according to the manufacturer’s
instructions with a minor modification. In brief, 10mg of silkworm-
expressed CTB was heated at 100oC for 3 min in 20 mM sodium
phosphate buffer, pH 7.5, containing 20 mM EDTA, 0.5% SDS and
1% 2-mercaptoethanol (only in the N-deglycosylation reaction).
Nonidet P-40 was added to give the final concentration of 1% and
the extract was digested overnight with 50 mU/ml peptide N-
glycosidase F (or 0.2mU/ml O-Glycosidase) at 37oC. After different
enzymatic deglycosylation, the samples were subjected to SDS-
PAGE and Western blot analysis with the anti-CTB antibody.
GM1-ganglioside binding assay
to detect the affinity of silkworm-derived CTB protein for GM1-
ganglioside. The microtiter plate was coated with monosialoganglioside-
GM1 (Sigma) by incubating the plate with 50 µl/well of GM1 (10
µg/ml) in methanol at 4oC overnight. Alternatively, the wells were
coated with 100 µl/well of 1% BSA, and the same dilution of either
hemolymph-infected wild-type baculovirus or bacterial CTB (Sigma)
were used as negative and positive controls respectively. The
remainder of the procedure was identical to the ELISA assay
described above.
A GM1-ELISA was performed
Oral tolerance induction by admixtures of Silkworm-drived
CTB and insulin
Four-week-old female NOD mice were divided
into five groups for different treatments: Group 1, fed 100 µg of
insulin (Novo Nordisk); Group 2, fed 100 µg of insulin+1µg of
CTB; Group 3, fed 100µg of insulin+10µg of CTB; Group 4, fed
10µg of CTB and Group 5, fed equal volume of wild-type
hemolymph used as a control. The silkworm-derived CTB protein
consisted in the hemolymph. At 5 weeks of age, each mouse was
treated every other day until 10 weeks of age (3-4 times per week).
Oral antigen was administrated via a blunt-ended curved feeding tube
inserted into the esophagus/stomach. The animals were killed at 10
weeks of age for histopathological analysis of pancreatic islets.
Histopathological analysis of pancreatic islets
insulitis levels in mice that had been treated by different methods,
the extent of lymphocyte infiltration of islets was measured. Each
group consisted of five mice. At 10 weeks of age, the mice were
killed and the pancreata were removed. Each pancreas was fixed in
10% buffered formalin and embedded in paraffin, and 5-µm
sections were stained with hematoxylin and eosin. The degree of
insulitis was evaluated using a standardized scoring system by an
observer that was blind to the group designations, as described
previously (Charlton and Mandel, 1988). At least 15 islets were
scored for each animal.
For evaluation of
Results
Construction of recombinant baculovirus and expression
of CTB in B. mori cells and larvae
the expression level of the native CTB gene in silkworm is
extremely low (data not published). To improve the
production level of CTB, the partial non-coding and coding
sequences (ATAAAT and ATGCCGAAT) of polyhedrin gene
were introduced to the 5'-end of the native CTB gene. The 15
base-pair (bp) of corresponding homologous region of polyhedrin
enhanced the expression level of foreign genes when this
modified CTB gene was driven by the strong AcMNPV
polyhedrin promoter (Fig. 1). The presence of the CTB gene
in recombinant virus was confirmed by direct PCR of viral
genomic DNA and further analyzed by genomic DNA
hybridization. As expected, the PCR amplification of recombinant
viral genomic DNA showed a specific band of 381 bp. No
nonspecific amplification was observed in any of the samples
(Fig. 2A). Then we used the fragment of the full-length CTB
gene as a probe, and the recombinant plasmid as a positive
control. The Southern blot revealed the presence of a fusion
gene identical to the positive control, while the wild-type
baculovirus did not show the gene-specific band (Fig. 2B).
These evidences indicated that the CTB gene was inserted
into the baculovirus genome immediately downstream of the
polyhedrin promoter. The recombinant baculovirus was thus
successfully constructed. According to the Reed-Muench
formula, the dilution of the recombinant virus was 6.69×108
pfu/ml. After infection by this recombinant virus, BmN cells
and silkworm larvae started to present the typical symptoms
of NPV infection and produced CTB protein in the cytoplasm
and body cavity, respectively.
In our previous work,
Fig. 1. Schematic structure of the transfer vector pBacPAK-CTB.
AcMNPV, Autographa Californica Nuclear Polyhedrosis Virus;
Ph-Pro, AcMNPV polyhedrin promoter; ATAAAT ATGCCGAAT,
partial 5’-non-coding and coding sequences of polyhedrin; poly
A+, polyadenylation signal; LB, left border; RB, right border.

Page 4

720Zhao-Hui Gong et al.
ELISA quantification of CTB expression
level of CTB expression in BmN cells and silkworm larvae,
the infected cells and hemolymph of larvae were collected at
1-6d post-infection and detected by quantitative ELISA. The
ELISA results showed that the highest detectable level of
CTB protein in cells yielded up to 5.6 µg/2 × 106 cells at the
fifth day post-infection (Fig. 3A). At the late phase of
infection, the infected cells started to lyse. In the infected
silkworm larvae, the recombinant fusion protein was efficiently
released into the larval hemolymph. On average, 0.4 ml of
hemolymph was obtained per larva. At the sixth day post-
infection, the maximum amount of the recombinant CTB in
the hemolymph reached 54.4 mg/L (Fig. 3B).
To confirm the
Silkworms produce CTB protein in a pentameric form In
unboiled samples, silkworm-expressed CTB appeared as
70 kDa-pentamers (Fig. 4A, lanes 4 and 5). However, a
nonspecific band with an apparent molecular weight of 50
kDa was found in all samples. This is due to nonspecific
cross-reaction between anti-cholera toxin antibodies and
silkworm protein. We found that the oligomeric fusion protein
was dissociated into monomers by boiling for 5 min and
subsequently migrated as two or three specific bands in both
boiled silkworm cell and hemolymph samples (Fig 4A, lanes
3 and 6). This is not due to inadequate boiling or low
concentrations of dithiothreitol or β-mercaptoethanol. Increasing
these agents to reduce disulfide bridges or increasing duration
of boiling did not alter polypeptide profiles significantly. In
addition, the size of these bands is not identical to dimers,
trimers or multimers of CTB. We presumed that these
polypeptide profiles might result from the various degrees of
glycosylation of silkworm-expressed CTB. The arrows in Fig
4A indicated the presence of various glycosylated proteins of
CTB in BmN cells and hemolymph. The subsequent
experiments of enzymetic deglycosylation supported this
scientific hypothesis.
Silkworm-expressed CTB is partially glycosylated
verify that the silkworm-expressed CTB is glycosylated, the
expressed products were treated with PNGase F and O-
glycosidase respectively. No evident change of CTB proteins
was found after O-glycosidase treatment (Fig. 4B, lanes 1c
and 2c). However, after PNGase F treatment, a new band
(indicated by arrow) was detected in silkworm cells and
hemolymph respectively (Fig. 4B, lanes 1b and 2b). Owing to
the incomplete deglycosylation, the apparent molecular
weight of this new band was larger than the nonglycosylated
CTB. These results indicate the recombinant CTB proteins in
silkworm were partially glycosylated at various degrees.
To
Silkworm-derived CTB demonstrates a strong affinity for
GM1-ganglioside
For confirmation of the specific affinity
of the pentameric protein for GM1-ganglioside, we used a
GM1-ELISA method with GM1-ganglioside as the capture
molecule and the bacterial pentameric CTB to produce a
Fig. 2. Identification of the recombinant baculovius by PCR and
southern blot. (A) PCR amplification of the recombinant baculovirus.
M, DNA ladder; PC, positive control, the recombinant plasmid
pBacPAK-CTB; lane 1, genomic DNA of the recombinant virus;
lane 2, wild-type genomic viral DNA. The arrow indicates the
size of CTB gene. (B) Southern blot of genomic viral DNA
(digested with BamHI and EcoRI). Lane 1, wild-type genomic
viral DNA; lane 2, genomic DNA of recombinant virus; PC,
positive control, recombinant plasmid pBacPAK-CTB.
Fig. 3. Quantitative analysis of protein production levels in BmN
cells (A) and silkworm larvae (B). Data are presented as the
mean concentration ± SD on each day.

Page 5

Expression of Recombinant Cholera Toxin B Subunit in Silkworm721
standard curve. An increase in the concentration-specific absorption
signal was observed, indicating that the recombinant CTB
protein existed as a pentamer, because only pentameric CTB
can bind to GM1-ganglioside (Fig. 5A). However, the heat-
treated protein completely lost its affinity for GM1-
ganglioside (Fig. 5B). The silkworm-derived CTB protein
exhibited the biochemical and antigenic properties necessary
for the purposes of this study. The GM1 binding ability also
suggests proper folding of CTB molecules resulting in the
functional pentameric structure.
Silkworm-synthesized CTB is a mucosal adjuvant for oral
tolerance induction in NOD mice
silkworm-synthesized CTB would be effective mucosal
adjuvant in the reduction of insulitis, female NOD mice were
treated with insulin and silkworm-derived CTB admixtures,
beginning at 5 weeks of age. After 5 weeks of supplementation,
To investigate whether
the mice were killed, their pancreatic tissues were harvested,
and the islets of each animal were scored. A representative
islet from an animal fed insulin and CTB admixtures showing
focal peri-islet lymphocyte infiltration was given an insulitis
score of 1 (Fig. 6A). Pancreatic islets from an animal fed CTB
had an insulitis score of 2 (Fig. 6B), whereas animals fed
insulin or wild-type hemolymph had insulitis scores of 3 and 4
(Fig. 6C and 6D). Student’s t-test revealed a significant
reduction of insulitis in mice fed 100 µg of insulin and 1 µg of
CTB admixtures compared with that in mice fed insulin alone
(Fig. 7; 1.97 ± 0.56 vs. 2.5 ± 0.4, p < 0.05). In addition, this
suppressive effect of insulin was increased further when the
CTB concentration was lowered. This result indicated that the
adjuvant effect of CTB was presented. No significant differences
in the insulitis scores were found in two groups of mice fed
insulin and CTB admixtures. Interestingly, the recombinant
CTB alone had the direct effect on the immune system, as
there was a marked reduction of insulitis in animals fed 10 µg
Fig. 4. (A) Western blot analysis of CTB expression in silkworm
cell and larvae. Lane 1, boiled wild-type hemolymph; lane 2,
unboiled wild-type hemolymph; lane 3, boiled cell extracts
containing CTB protein; lane 4, unboiled cell extracts containing
the same protein; lane 5, unboiled hemolymph containing the
same protein; lane 6, boiled hemolymph containing the same
protein. Numbers on the left indicate the positions of protein size
markers. Asterisks indicate the nonglycosylated form of CTB.
Various glycosylated form of CTB is indicated by arrows. (B)
Deglycosylation of the recombinant CTB produced in BmN cells
and silkworm larvae. The silkworm-expressed CTB were treated
with PNGase F and O-glycosidase. Lane 1a, untreated cell
extracts; lane 1b, PNGase F-treated cell extracts; lane 1c, O-
glycosidase-treated cell extracts; lane 2a, untreated hemolymph;
lane 2b, PNGase F-treated hemolymph; lane 2c, O-glycosidase-
treated hemolymph. The deglycosylated form of recombinant
CTB is indicated by arrows.
Fig. 5. Analysis of the binding affinity for the GM1-ganglioside
pentameric CTB by GM1-ELISA. (A) Reactivity of CTB with
the GM1-ganglioside and the antibody to CTB in GM1-ELISA
in comparison with a native CTB control. WT indicate the
hemolymph infected by wild-type virus. All samples were
serially diluted two-fold and incubated for 1 h prior to the
addition of the CTB-specific antibody. (B) Boiling induced
pentamer dissociation into monomers. Approximately equal
amounts of the three different samples indicated were used to
measure A492 signal levels. Data represent the mean A492
values ± SD of each sample.