Integron cassette insertion: a recombination process involving a folded single strand substrate.

Abstract

Integrons play a major role in the dissemination of antibiotic resistance genes among Gram-negative pathogens. Integron gene cassettes form circular intermediates carrying a recombination site, attC, and insert into an integron platform at a second site, attI, in a reaction catalyzed by an integron-specific integrase IntI. The IntI1 integron integrase preferentially binds to the 'bottom strand' of single-stranded attC. We have addressed the insertion mechanism in vivo using a recombination assay exploiting plasmid conjugation to exclusively deliver either the top or bottom strand of different integrase recombination substrates. Recombination of a single-stranded attC site with an attI site was 1000-fold higher for one strand than for the other. Conversely, following conjugative transfer of either attI strand, recombination with attC is highly unfavorable. These results and those obtained using mutations within a putative attC stem-and-loop strongly support a novel integron cassette insertion model in which the single bottom attC strand adopts a folded structure generating a double strand recombination site. Thus, recombination would insert a single strand cassette, which must be subsequently processed.

Full text

Page 1

Integron cassette insertion: a recombination
process involving a folded single strand substrate
Marie Bouvier1, Gae ¨lle Demarre1
and Didier Mazel*
Unite ´ Postulante Plasticite ´ du Ge ´nome Bacte ´rien, CNRS URA 2171,
Institut Pasteur, Paris, France
Integrons play a major role in the dissemination of anti-
biotic resistance genes among Gram-negative pathogens.
Integron gene cassettes form circular intermediates carry-
ing a recombination site, attC, and insert into an integron
platform at a second site, attI, in a reaction catalyzed by
an integron-specific integrase IntI. The IntI1 integron
integrase preferentially binds to the ‘bottom strand’ of
single-stranded attC. We have addressed the insertion
mechanism in vivo using a recombination assay exploit-
ing plasmid conjugation to exclusively deliver either the
top or bottom strand of different integrase recombination
substrates. Recombination of a single-stranded attC site
with an attI site was 1000-fold higher for one strand than
for the other. Conversely, following conjugative transfer of
either attI strand, recombination with attC is highly un-
favorable. These results and those obtained using muta-
tions within a putative attC stem-and-loop strongly
support a novel integron cassette insertion model in
which the single bottom attC strand adopts a folded
structure generating a double strand recombination site.
Thus, recombination would insert a single strand cassette,
which must be subsequently processed.
The EMBO Journal advance online publication, 8 December
2005; doi:10.1038/sj.emboj.7600898
Subject Categories: genome stability & dynamics
Keywords: antibiotic resistance; DNA; evolution; lateral gene
transfer; tyrosine recombinase
Introduction
Integron cassettes are small DNAunits that carry open reading
frames generally without promoters. They integrate into an
integron platform, consisting of a site-specific recombinase,
an associated primary recombination target called the attI site
and two appropriately orientated (divergent) promoters, one
driving an integrase gene, intI, and the other driving expres-
sion of the cassette-associated gene. The integron is the
generic name for the integron platform–cassette ensemble.
Integrons are key players in the capture and dissemination of
antibiotic resistance genes among Gram-negative bacteria (see
Hall and Collis, 1998). Their importance has recently been
underlined by the discovery of large integrons in the chromo-
somes of a wide range of bacterial species (Rowe-Magnus
et al, 2001). These superintegrons (SI) contain arrays of
hundreds of genes for various adaptive functions. The corre-
sponding recombinases, IntI integrases, belong to the phage l
integrase family of tyrosine (Y) recombinases (see Azaro and
Landy, 2002). The IntI integrases mediate recombination
between their specific attI site and a second type of recombi-
nation site carried by a gene cassette, called the attC site (or
59-base element), and which is formed following circulariza-
tion of the integron cassette. IntI integrases can also catalyze
recombination between two attC sites. Although related to l
int, several lines of evidence imply that Int1-mediated recom-
bination may be quite different from that of phage l.
A unique feature of the integron recombination system is
the structure of the attI and attC recombination sites. These
differ significantly from the canonical Y-recombinase core
sites, which are composed of a pair of highly conserved 9- to
13-bp inverted binding sites separated by a 6- to 8-bp central
spacer region (see Figure 1A). One of the putative IntI binding
sites, within the core of attI, is extremely degenerate and the
spacer region differs widely from that of the partner attC sites
(see Figure 1A and B). IntI1 recombinase binds to four
regions of double-stranded (ds) attI in vitro. Two correspond
to the core repeats and two to direct repeats located upstream
of the core (Figure 1A) (Collis et al, 1998; Gravel et al,
1998a). The role of the two direct repeats of the attI1 site
for the recombination reaction is still unclear (Hansson et al,
1997). The structure of attC is more complex. It consists of
two potential core sites, R00–L00and L0–R0(also called 1L–2L
and 2R–1R (Stokes et al, 1997)), separated by a region that is
variable in sequence and length (Figure 1C). A number of
these have been demonstrated to be efficiently recombined
by IntI1 (Collis et al, 2001; Biskri et al, 2005). While recom-
bination occurs at L0-R0, directed mutagenesis showed that
R00-L00is also essential. All attC sites exhibit extensive poten-
tial cruciform structures (Hall et al, 1991; Stokes et al, 1997;
Rowe-Magnus et al, 2003). Purified IntI1 binds specifically
to the ‘bottom’ strand (bs) of single-stranded (ss) attC site,
attCaadA1, DNA but not to a ds attCaadA1site (Francia et al,
1999). This seminal observation was confirmed, and several
key elements that act as recognition determinants for in vitro
IntI1 binding were identified in the attCaadA1sequence. Some
appear to play important roles in the potential secondary
structure of the attC site (Johansson et al, 2004).
Integron cassettes are thought to move using an excised
circular intermediate (Collis and Hall, 1992). These would
have the capacity to form extensive secondary structures if
produced as a single strand. For most cassettes, self-pairing
on the same single strand can be extended up to the R0and R00
sequences, which usually show a stretch of 9–11 consecutive
complementary nucleotides (Figure 1; Hansson et al, 1997;
Rowe-Magnus et al, 2003). Such a self-paired stem could be
seen as an almost canonical core site consisting of the L00–L0
Received: 12 August 2005; accepted: 11 November 2005
*Corresponding author. Unite ´ Postulante Plasticite ´ du Ge ´nome
Bacte ´rien, CNRS URA 2171, Institut Pasteur, 25 rue du Dr Roux, 75724,
Paris, France. Tel.: þ33 1 4061 3284; Fax: þ33 1 4568 8834;
E-mail: mazel@pasteur.fr
1These authors contributed equally to this work
The EMBO Journal (2005), 1–12|& 2005 European Molecular Biology Organization|All Rights Reserved 0261-4189/05
www.embojournal.org
&2005 European Molecular Biology OrganizationThe EMBO Journal

EMBO
JOURNALJOURNAL
THETHE
EMBOEMBO
1

Page 2

duplex and an unpaired central region followed by an R00–R0
duplex (Figure 1D).
In the present study, we have addressed the mechanism of
integron cassette transfer. We have extended previous obser-
vations in vitro (Francia et al, 1999; Johansson et al, 2004)
demonstrating specific binding of IntI to the bs of attCaadA1.
We show that IntI1 has a similar single strand preference for
two additional and structurally distinct attC sites. This de-
monstrates that strand choice is a general phenomenon and is
not associated specifically with attCaadA1. More importantly,
we also present evidence strongly suggesting that integration
occurs via a single strand intermediate and that a specific
single strand of the cassette (that which is bound by IntI) is
used. This conclusion is based on recombination frequencies
obtained following delivery of one or other single strand by
conjugation to a suitable recipient Escherichia coli strain
carrying the integron platform and expressing the appropriate
integrase. While the attC sites recombine in single strand
form, our results suggest that attI must be present in a double
strand configuration. However, although the attC recombina-
tion intermediate may be single stranded, recombination
appears to occur using a ds attC region generated by the
secondary structure within the single strand cassette. Thus,
while mutations disrupting the potential pairing of non-
conserved positions in a putative stem-and-loop structure of
the attC bs decreased the recombination frequency, restora-
tion of the complementarity by mutation of the partner
sequence restored a high frequency of recombination.
We propose an unusual recombination model to explain
the insertion of integron cassettes at the attI site. In this
model, a first strand exchange occurs using the attC bs folded
into a stem-and-loop structure to generate a Holliday junction
(HJ), which is then resolved by replication of the recipient
replicon.
Results
IntI1 in vitro binding properties for single- and double-
stranded forms of the attI1 site and two attC sites
To determine whether bs-specific binding of IntI1 was specific
to attCaadA1(Francia et al, 1999) or is a general feature of attC
sites, we tested two additional unrelated sites: attCaadA7site,
which differs only in two positions from the attCaadA1site,
and VCR2/1, the attC site from a Vibrio cholerae SI cassette,
which is larger and unrelated to these two sites (Figure 1C).
We also repeated IntI1 binding experiments (Francia et al,
1999) using attI1 (68bp). The attCaadA7site was carried on a
76bp DNA fragment and the VCR2/1on a 149bp fragment.
We used an MBP-IntI1 fusion protein in our in vitro binding
experiments, as previous studies had shown that addition of
an MBP tag did not disturb IntI1 function in vitro or in vivo
(Gravel et al, 1998a,b). As previously observed (Francia et al,
1999), we found that 48pmol of IntI1 specifically retarded
0.5pmol of ds attI1 site, but not the corresponding top
strands (ts) or bs (Figure 2A and B). In the case of
attCaadA7ds, there are traces of retarded complex visible in
Figure 1 Integron recombination sites. (A) Sequence of the ds attI1 site. (B) Sequence of the ds attCaadA7site. (C) Multiple sequence alignment
of the attC sites bs studied in this work. (D) Proposed secondary structure for the attCaadA7bs. The inverted repeats L, L0and L00, R, R0and R00
are indicated with black arrow; the asterisk (*) shows the position of the protruding G present in L00relative to L0. The attI1 direct repeats bound
by InI1 are indicated by horizontal lines with an empty arrowhead (Collis et al, 1998; Gravel et al, 1998a). The putative IntI1 binding domains,
as defined by Stokes et al (1997), are marked with gray boxes. Vertical arrows indicate crossover position. The secondary structure was
determined using the MFOLD (Walter et al, 1994) online interface at the Pasteur Institute.
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
2

Page 3

Figure 2A. This might be explained by sufficient instability of
this 76bp duplex to leave a fraction of non-paired ss material,
which could be bound by IntI1. These complexes likely
correspond to attCaadA7bs–IntI1 complexes, as nuclease S1
treatment led to their elimination (not shown). It is note-
worthy that incubation with the larger (149bp and likely
more stable) VCR2/1ds did not lead to such complexes. Under
the same conditions, IntI1 did not alter the mobility of either
of the ds attCaadA7or VCR2/1sites (Figure 2B). Conversely,
we observed specific retardation when 0.5pmol of either
attCaadA7bs or VCR2/1bs was incubated with 4.8pmol of
IntI1, while incubation with the ts of either of these attC sites
did not lead to any retardation (Figure 2A).
Recombination of attC sites after conjugative transfer
To assess whether an ss structure could be the substrate for
recombination in vivo, we used a recombination assay that
we developed to compare attC?attI site recombination,
which mimics the cassette integration process (Biskri et al,
2005). This assay used conjugation to deliver one of the
recombination substrates into a recipient cell expressing the
IntI1 integrase and carrying a second recombination target
on a pSU38 plasmid derivative (see Figure 3). Conjugative
transfer of plasmids occurs by transfer of a single DNA strand
(rather than duplex DNA) from donor to recipient. In addi-
tion, the orientation of the oriTsequence determines which of
the two strands is transferred. The integron recombination
site provided by conjugation was carried on an R6K-derived
plasmid of the pSW family. Replication of these plasmids
relies on the P protein, provided by a pir gene inserted in the
donor genome (Demarre et al, 2005). Transfer functions are
also provided by the appropriate plasmid genes inserted into
the donor chromosome. Following conjugation, re-circular-
ization of the single transferred strand is catalyzed by the
conjugative relaxase enzyme
Pansegrau and Lanka, 1996). Complete ss transfer and re-
circularization precede the complete second strand synthesis.
Since the recipient does not supply the P protein, the
transferred plasmid is unable to replicate (Figure 3). This
procedure has been called suicide conjugation. Insertion of
attC in one orientation or the other in a given pSW derivative
would lead to transfer of either attC ts or attC bs. If recombi-
(Pansegrauet al,1993;
Figure 2 Gel retardation of ss or ds attI1, attCaadA7and VCR2/1by IntI1. (A) Single strand substrates. A 4.8pmol portion of IntI1 was incubated
with 0.5pmol of ssDNA containing the ts or the bs of attI1, attCaadA7or VCR2/1. Lanes 1–4 show the attI1 ts or bs binding study; lanes 5–8
correspond to the attCaadA7ts or attCaadA7bs binding study; the last four lanes (9–12) show the VCR2/1ts or VCR2/1bs binding study.
(B) Double strand substrates. Lanes 1, 2 and 3 correspond to incubation of 0, 24 or 48pmol of IntI1 with ds attI1, respectively; lanes 4, 5
and 6 correspond to incubation of 0, 24 or 48pmol of IntI1 with ds attCaadA7, respectively; lanes 7, 8 and 9 correspond to incubation of
0, 24 or 48pmol of IntI1 with ds VCR2/1, respectively.
Single strand recombination in integron
M Bouvier et al
&2005 European Molecular Biology Organization The EMBO Journal 3

Page 4

nation uses a strand-specific ss substrate, a difference in the
recombination rate measured after transfer of either attC ts or
attC bs would be expected. On the other hand, if recombina-
tion involves a ds substrate, and thus requires second strand
synthesis to be effective, no difference in the recombination
rate is expected.
In a first set of experiments, we compared the recombina-
tion of the VCR2/1 bs and VCR2/1 ts after transfer using
plasmids pVCR-B and pVCR-T (Table II), which transfer
respectively the VCR2/1bs and VCR2/1ts in the recipient.
pVCR-B and pVCR-T are identical except for the VCR2/1
fragments, which are carried in opposite orientations. We
established that both plasmids were transferred at similar
rates (2?10?1) using strain UB5201-Pi (a UB5201 derivative
able to sustain pSW replication) as a recipient. We also
determined their IntI1-mediated recombination frequencies
with the target attI1 site carried on the compatible plasmid,
pSU38-attI1, in the same pSW replication permissive context.
This was about 1–5?10?2(Figure 4). We then tested their
recombination frequencies following suicide conjugation
to a UB5201 recipient (i.e. without P) carrying the target
pSU38-attI1 plasmid and expressing IntI1. An overall rate
of 5.5?10?3was obtained for pVCR-B while pVCR-T recom-
bined at a rate of 1?10?6. In order to establish that this
difference was not due to an unknown contextual difference
between plasmids, we inverted the oriTorientation in the two
plasmids, leading to plasmids pVCR-TINV(starting from the
pVCR-T)andpVCR-BINV
(starting
(Table II). Again, these two plasmids were transferred at
similar rates, 2?10?1, yet a 2?104-fold higher recombination
rate was still obtained when the transferred strand contained
the VCR2/1bs (pVCR-TINV; Figure 4). When recombination of
the same constructs was tested in UB5201-Pi, a [pirþ] host
permitting replication, the ratio of recombination frequencies
of the two plasmids obtained with the UB5201 recipient
dropped from 2?104to 68. This 68-fold discrepancy may
be due to the specific plasmid constructions in some way and
is under investigation.
We extended our strand recombination analysis to the
attCaadA7site used in the in vitro electrophoretic mobility
shift assay (EMSA) (Figure 2). Two plasmids, pAttC-B and -T,
were constructed (Table II), allowing the conjugative transfer
of either attCaadA7bs or attCaadA7ts, respectively. As in the
case of pVCR-B and -T, we found that in a [pirþ] host, the B
and T derivatives were recombined at similar rates (2?10?2),
whereas in the suicide conjugation assay, attCaadA7bs recom-
bined at a rate (7.6?102) higher than attCaadA7ts (Figure 4).
To eliminate the possibility that these results were speci-
fically linked to the RP4 transfer machinery, we repeated
several of these experiments using plasmid R388, which
specifies a different transfer system. Using plasmids pSW26
and pSW27, which carry the R388 oriT in opposite orienta-
tions (Demarre et al, 2005), we constructed two derivatives of
fromthepVCR-B)
pSU38-attI1::pAttC-B
pSU38-attI1
[pir–] recipient
bs attC × ds attI1
strand exchange
}
pSU38-attI1
attI1
IntI1
[pir–] recipient
[pir+] donor cell
attC
pAttC-B
(pir dependent)
oriT
RelazosomeRelazosome
Figure 3 Schematic representation of the conjugation–recombina-
tion assay used for the integron cassette integration reaction.
Briefly, the donor cell expresses the P protein, encoded by pir
and required for pAttC replication. This strain also provides the
transfer functions necessary for its conjugation. The recipient is
devoid of a pir gene and therefore cannot sustain pAttC replication.
The recipient also contains a plasmid carrying the attI1 site (pSU38-
attI1) and expresses IntI1 (symbolized by green ovals). Core site
sequences in the attC and attI1 sites are represented as empty boxes,
and correspond to those of Figure 1; red and pink ovals indicate the
oriT; de novo synthesized strands are shown in blue. The relaxo-
some, which cleaves and pumps DNA into the recipient, is shown in
yellow, and the donor and recipient cell walls and membranes are
shown as gray vertical lines. The donor is represented with a pale
yellow background.
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
4

Page 5

each containing VCR2/1 in either orientation, leading to
plasmids p388VCR-B and -T, and p388VCR-BINVand -TINV
(Table II). These four plasmids were found to recombine with
attI1 at similar rates when tested in UB5201-Pi, a [pirþ] host
expressing IntI1 (2.7–13?10?2; Figure 5). When measured
after suicide conjugation from strain P1977, which expresses
the R388 transfer machinery, recombination of VCR2/1 bs
occurred at rates 3.4?103
(p388VCR-TINV) higher than VCR2/1 ts, after conjugation
from p388VCR-T and p388VCR-BINV, respectively (Figure 5).
(p388VCR-B) and 6.2?103
Effect of mutations in the potential stem sequence
To test our model of recombination involving the attC bs
folding into a stem-and-loop structure, we introduced muta-
tions that would disrupt the potential base pairing, and
measured their effect on the recombination frequency. As
the last positions involved in the potential stem formed by the
various ss attC sites are not conserved and cannot be in-
volved directly in the chemistry of the reaction (positions
underlined in Figure 1C), we substituted the last 5 nucleo-
tides of the attCaadA7stem (attCaadA7Mut1; Figure 6). These
mutations lead to a 10-fold decrease of the recombination
frequency of the attCaadA7 bs, as established after suicide
conjugation of plasmid pAttC-B-Mut1 (Figure 6). We then
increased the destabilization of the potential secondary struc-
ture by the introduction of three additional substitutions
further down in the stem structure and covering the last
two positions in the L0/L00potential hybrid (attCaadA7Mut3;
Figure 6). These mutations lead to a 90-fold decrease of the
recombination frequency of the attCaadA7. We then tested for
1×10−8
1×10−7
1×10−6
1×10−5
1×10−4
1×10−3
1×10−2
1×10−1
1
Recombination frequencies
1.46×10−2
5.55×10−3
1×10−6
5.31×10−2
4.38×10−3
2.2×10−1
2.48×10−7
3.2×10−3
2.8×10−2
2.02×10−2
3.65×10−5
1.69×10−2
9.68×10−6
1.57×10−3
1.02×10−5
1.99×10−3
1.9×10−7
1
1
5.68×10−8
Recombination site
attI1
λattB
VCR2/1
attCaadA7
Intλ
bs
ts
Orient. 1 Orient. 2
Integrase
bs
ts
bs
ts
bs
ts
Plasmids
++++++++––
pVCR-B
pAttC-B
pAttC-T
pAttl1-B
pAttl1-T
pλattB-B
pλattB-T
pVCR-BINV
pVCR-T
pVCR-TINV
oriTRP4 orientation
IntI1
Strand injected by
conjugation
non-replicative single strand substrate
replicative double strand substrate
Figure 4 Recombination frequencies of the different recombination sites and substrates. For a given substrate, the black bar indicates the
recombination frequencies established in the in vivo recombination assay with non-replicative ss substrate and the light gray bar the
corresponding value in the recombination control assay in replication permissive conditions, as described in Materials and methods.
Recombination frequencies (vertical axis of histogram) correspond to the average of three independent trials. Error bars show standard
deviations. For clarity, the recombination site, the strand–bs (bottom) or ts (top)—injected by conjugation, the orientation (þ) and (?) of the
oriT and the integrase used are indicated below plasmid names.
6.17×10−3
1.00×10−6
1.35×10−3
3.95×10−7
9.00×10−2
2.63×10−2
6.20×10−2
1.32×10−1
1×10−8
1×10−7
1×10−6
1×10−5
1×10−4
1×10−3
1×10−2
1×10−1
1
Recombination frequencies
oriTR388 orientation
Strand injected by
conjugation
Plasmids
p388VCR-B
++––
p388VCR-Tp388VCR-TINV
p388VCR-BINV
bs
ts
bs
ts
non-replicative single strand substrate
replicative double strand substrate
Figure 5 Recombination frequencies of the VCR2/1site obtained
with the R388-based suicide conjugation assay. For a given sub-
strate, the black bar indicates the recombination frequencies estab-
lished in the in vivo recombination assay with non-replicative ss
substrate and the light gray bar the corresponding value in the
recombination control assay in replication permissive conditions, as
described in Materials and methods. Recombination frequencies
(vertical axis of histogram) correspond to the average of three
independent trials. Error bars show standard deviations. For clarity,
the recombination site, the strand—bs (bottom) or ts (top)—in-
jected by conjugation and the type and orientation (þ) and (?) of
the oriTare indicated below plasmid names.
Single strand recombination in integron
M Bouvier et al
&2005 European Molecular Biology OrganizationThe EMBO Journal 5

Page 6

both mutants the effect of restoration of complementarity,
which would stabilize the attCaadA7Mut1 and attCaadA7Mut3
bs folding, on the recombination frequency. In both cases,
these secondary mutations restored a level of recombination
similar to the one obtained with the wild-type (WT) attCaadA7
site (attCaadA7Mut2 and attCaadA7Mut4; Figure 6), after sui-
cide conjugation of the corresponding bs from pAttC-B-Mut2
and pAttC-B-Mut4.
k phage attB?attP recombination using the suicide
conjugative transfer assay
To confirm that these results truly reflect a single strand
preference, we investigated the related phage l recombina-
tion system that is known to require two strands. Here,
orientation should have no effect on recombination. We
used the l phage integration, since its mechanism is known
in detail (reviewed by Azaro and Landy, 2002). In this
reaction, recombination between the phage attP and chromo-
somal attB sites requires ds substrates and is catalyzed by the
l integrase, Intl. The attP site was cloned into pSU38 and
introduced into the recipient, which supplied the accessory
and necessary host protein IHF. The attB site was cloned in
both orientations into pSW23T to create plattB-1 and plattB-
2 (Table II). When tested in a [pirþ] host containing pSU38-
lattP and a plasmid expressing IntIl, a 90min induction was
sufficient to obtain 100% attP?attB cointegrate formation
with plattB-1 and plattB-2. Recombination of each of the
lattB strands was then tested following suicide conjugation
ofeitherplattB-1orplattB-2
DattBHaadA E. coli that contained pSU38-lattP as recombi-
nation target and expressed Intl. Conjugation was for 2h and
transconjugants were selected for the plattB marker. This
resulted in cointegrate formation (integration) frequencies of
2?10?7and 0.6?10?7for lattB-1 and lattB-2, respectively
(Figure 4). Interestingly, increasing the conjugation time up
to 3h resulted in an E103increase of cointegrate formation
for both lattB ss substrates. This suggested that the increased
time allowed for an increase in the amount of complementary
strand synthesis in the recipient, generating the ds sequences
necessary for an efficient attB?attP recombination to be
catalyzed.
intoMG1657-PIl,a
Recombination properties of the attI1 site after suicide
conjugative transfer
From EMSA assays, neither the ts nor bs DNA of the other
recombination partner attI1 appeared to be bound by IntI1,
although ds attI1 site was clearly recognized (Figure 2). To
determine whether this is also reflected in recombination, we
tested recombination proficiency after suicide conjugative
transfer. The attI1 site was cloned in both orientations in
pSW23T, leading to pAttI1-B and pAttI1-T, and the attCaadA7
wasinsertedintopSU38,
(Table II). When tested in a [pirþ] host expressing IntI1,
pAttI1-B and pAttI1-T were found to recombine with the
target pSU38-attCaadA7 at similar rates of 1.6–2?10?3
(Figure 4). These results, which do not significantly differ
from those obtained when recombination sites and vector
plasmids were reciprocally reversed, showed that under
conditions that permit autonomous replication of all plas-
mids, the properties of the different recombination sites were
independent of the backbone plasmid. Conversely, recombi-
nation following suicide conjugative transfer of either attI1
strands with the attCaadA7 site on pSU38 in the recipient
was found to occur at identical low rates, about 1?10?5
(Figure 4), strongly suggesting that ss attI1 are not bona fide
substrates.
leadingtopSU38-attCaadA7
Recombination of attC and kattB sites after
transformation using double-stranded non-replicative
plasmids
To determine whether the ds attC can be used as a recombi-
nation substrate, for example by adopting the necessary
structure recognized by IntI1, without single strand passage,
we transformed the ds circular plasmids pVCR-B and pVCR-T
into the [pir?] strain UB5201-I1. This strain expresses IntI1
and carries the target plasmid pSU38-attI1. Competent cells
were then transformed with 1, 10 and 50mg of each of the
pVCR derivatives and selected for CmRtransformants, as
cointegration between the VCR2/1and the attI1 site carried
on the pSU38 would lead to viable CmRtransformants. No
transformants were obtained for either of the tested plasmids,
although the frequency of transformation for a compatible
control plasmid, pSC101, was 1.1?105transformants/mg. The
maximal recombination frequencies for the ds test plasmids
ATGTCTAACG TT ATTAAGCCGC
TACAGATTGT AA TAATTCGGCG
T
A
G
A
T
G
G
C
GA
GCCGC
GTATC
ATGTCTAACG TT ATTAAGCCGCGCCGC
TACAGATTGT AA TAATTCGGCGCGGCG
G
T
R′′
A
G
A
T
G
C
GA
ATGTCTAACG TT ATTAAGCCGCCATAG
TACAGATTGT AA TAATTCGGCGGTATC
G
T
A
G
A
T
G
C
GA
attCAADA7WT
attCAADA7Mut1
attCAADA7Mut2
attCAADA7Mut3
attCAADA7Mut4
ATGTCTAACG TT ATTAA GC
TACAGATTGT AA TAATT CG
T
A
G
A
T
G
G
C
GA
GCCGC
GTATC
GCC
GCC
ATGTCTAACG TT ATTAACGGGCCATAG
TACAGATTGT AA TAATTGCCCGGTATC
G
T
A
G
A
T
G
C
GA
R′
L′
L′′
single strand substrate (non-replicative)
1×10–5
attCAADA7
1×10–4
1×10–3
1×10–2
1×10–1
2.80×10–2
3.69×10–2
2.80×10–3
3.24×10–4
1.17×10–2
WTMut1 Mut2Mut3Mut4
Recombination frequencies
1
A
B
Figure 6 Proposed secondary structure for the attCaadA7mutants
bottom strand (A) and their recombination frequencies (B), as
established in the suicide conjugation assay. Red letters indicate
mutations introduced in the attCaadA7. Symbols are as in Figure 1.
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
6

Page 7

were therefore lower than 5.5?10?6. We performed the same
type of experiment using plasmids plattB-1 and plattB-2,
and transforming the [pir?] strain MG1657-PIl expressing
Intl and containing the target plasmid pSU38-lattP. We
obtained CmRtransformants at frequencies of 2.1?104
transformants/mg (plattB-1) and 3.4?104transformants/mg
(plattB-2), compared to 7.2?104transformants/mg of the
control plasmid pSC101. This gives recombination frequen-
cies of 2.9?10?1and 4.7?10?1, respectively, for these ds
substrates.
Discussion
We have analyzed the mechanism of IntI1-mediated recom-
bination that occurs during integron cassette acquisition and
provide evidence that cassette integration occurs by recom-
bination between ss attC and ds attI. Johansson et al (2004)
reported covalent complex formation between IntI1 and the
attCaadA1bs, demonstrating that IntI1 not only recognized the
bs (Francia et al, 1999), but was also able to catalytically
cleave this substrate without the necessity of a complex
cruciform structure formed from both attC strands. We have
extended these studies to the related attCaadA7and the poorly
related VCR2/1sites. Like attCaadA1, IntI1 bound only to the bs
of ss attCaadA7and ss VCR2/1. These observations led us to
consider a model in which recombination would only involve
a structured attC bs and a canonical ds attI site. The attC bs
can potentially adopt a ds DNA-like structure by annealing of
L00to L0and R00to R0, which has almost all the structural
features of a canonical recombination site (Figure 1D). These
regions would be separated by an unpaired central segment.
In most circularized cassettes, self-pairing of the same single
strand could cover almost the entire attC site and even extend
slightly further. Indeed, in most cases, the 7bp R0and R00
sequence complementarity is extended on the external part,
to form a stretch of 9–11 consecutive complementary nucleo-
tides (Hansson et al, 1997; Rowe-Magnus et al, 2003). In
addition, comparison of the secondary structure adopted by
the different attC sites, which are efficiently recombined by
IntI1, shows that apart from the conserved AAC and GTT
in the R0and R00boxes, and the flipped out G present in all
L0/L00stem, all the other positions show no conservation
(Supplementary Figure 1).
This hypothesis was tested in vivo using suicide conjuga-
tive transfer of one of the recombination sites, in order to
provide an ss substrate (Figure 3). Conjugative transfer of
mobile plasmids, such as RP4, occurs by transfer of a single
DNA strand from donor to recipient. In addition, the orienta-
tion of the oriTsequence determines which of the two strands
is transferred. Furthermore, re-circularization of the trans-
ferred RP4 strand, catalyzed by the relaxase enzyme, occurs
between ss substrates (Pansegrau et al, 1993; Pansegrau and
Lanka, 1996). Thus, complete ss transfer and re-circulariza-
tion precede complete second strand synthesis. In E. coli,
second strand synthesis had been shown to be initiated by
either a specific primase (TraC) cotransferred with the DNA,
or by DnaG (Lanka and Barth, 1981). In our case, specific
priming is unlikely, as the transferred plasmid carries only a
small piece of the original RP4, a 256bp fragment centered on
the nick site defining the origin of transfer and sufficient to
ensure optimal transfer of the carrier plasmid (Demarre et al,
2005). Using this assay, in which the transferred plasmid is
unable to replicate in the recipient (suicide conjugation),
we can potentially deliver largely ss circularized DNA as a
substrate for recombination by IntI1. Our in vivo recombina-
tion assays showed that suicide transfer of the attC bs, be it
attCaadA7or a VCR (the attC site specific of the V. cholerae
super-integron cassettes), led to cointegrate formation at
rates similar to those obtained in the classical assay, which
involvesrecombinationbetween
(Figure 4). In contrast, recombination was three orders of
magnitude lower with attC ts and the VCR1/2ts. It is note-
worthy that these in vivo results correlate with the EMSA
results.
In addition, we showed that mutations potentially disrupt-
ing the putative attC bs folding in a stem-and-loop structure
lead to a significant decrease of the recombination frequency
of the corresponding bs site (Figure 6). Furthermore, we
showed that there was a correlation between the potential
destabilization of the secondary structure and the recombina-
tion rates (Figure 6). We also showed that compensatory
mutations introduced in order to re-establish a stem-and-loop
structure similar to the one folded from the WT bs, comple-
tely restored the recombination properties of the mutated
sites. These observations clearly support the model we
propose, in which, the global folding of the bs structure is
essential for the recombination to proceed.
If the recombination substrate was not the bs but any other
structure involving both strands of the site, we would expect
to obtain identical low rates of recombination irrespective
of the transferred strand since the limiting step would be
synthesis of the strand complementary to that injected
by conjugation. Results of this type were observed for
lattB?lattP recombination following suicide transfer, for
which recombination rates after injection of either strand
were found to be 6 orders of magnitude lower than recombi-
nation between replicative plasmids in identical conditions
(Figure 4). It is noteworthy that a similar but less extreme
result was obtained after suicide transfer of either attI1 strand
(Figure 4). These last results are in complete agreement with
those obtained by EMSA, showing that IntI1 recognizes only
the ds attI1.
Finally, inversion of oriT in each plasmid resulted in a
reciprocal exchange of recombination rates, and identical
recombination biases for ts or bs following suicide transfer
were also observed using the R388 conjugative system,
strengthening the observations we made using the RP4 con-
jugative machinery (Figure 5).
Although DNA is not generally maintained in an ss form in
vivo, ss DNA is formed during both replication and transcrip-
tion. It is possible that binding of IntI1 to attC bs somehow
stabilizes this form. This model would explain the lack of attC
site recombination when sites are delivered on non-replica-
tive ds plasmids by transformation into the recipient cell, in
comparison to the high rate of recombination obtained after
delivery of the lattB site in similar tests.
Recognition by IntI1 of the folded structure that can be
adopted by the bs of attC, and recombination of this structure
with a canonical ds attI site would lead to an HJ intermediate
that could be productively resolved through an additional
replication step (Figure 7). Indeed, once the first strand
exchange occurred, resolution of the HJ by a second pair of
strand exchanges would lead to the formation of dead-end,
linear, covalently closed molecules (axis B in Figure 7).
replicative plasmids
Single strand recombination in integron
M Bouvier et al
&2005 European Molecular Biology Organization The EMBO Journal 7

Page 8

However, if this HJ intermediate was replicated, this would
generate the original attI1 site together with the integrated
product. Such a model can also be applied to cassette deletion
through attC?attC site recombination, which would also
only involve the attC bs. The production of circular cassettes
at a very low but undetermined frequency has been demon-
strated from an array of three complete cassettes driven by
IntI1 (Collis and Hall, 1992). These circular cassettes were
mainly ds, covalently closed molecules. At first sight, these
results are in contradiction with the recombination model we
propose. However, the lifetime of ss, non-replicating circular
molecules could be short; the synthesis rate inside the cell of
the complementary strand is unknown. In addition, open
circular molecules were also detected but were attributed to
the plasmid preparation protocol used. These could also
correspond to single strand molecules in which complemen-
tary strand synthesis was incomplete. The same authors also
claimed that cassette integration occurred through recombi-
nation of ds substrates (Collis et al, 1993). This was based on
the recovery of cointegrates following transformation with ds
circular cassettes produced in vitro. This was carried out in a
similar manner to the experiment described here, in which
we were unable to detect cointegrates following transforma-
tion using a ds cassette. However, a careful analysis of their
data reveals that the events observed occurred at a very low
frequency. Indeed, in their assay, recombination proficiency
was measured through the number of cointegrates obtained
after electroporation of 0.1mg of cassette into a recipient
strain expressing IntI1. This varied from 3 to 28 using
different cassettes. Although the competence of the cells
was not determined, it is reasonable to estimate a transfor-
mation frequency of about 107transformants/mg for these
electrocompetent DH5a cells. This would give frequencies
of cointegrate formation of between 3?10?6and 3?10?5.
Such low rates are of the same order as the background
recombination rates we obtained after transfer of the attC ts
and might correspond to either the erratic production of the
attC bs or reflect a poor IntI1 recombination activity on the ds
attC substrate, compared to attC bs substrate.
Our model involving the attC bs as a substrate for recom-
bination may also in part explain the characteristic low
recombination rate of the integron machinery. Indeed for
canonical Y-recombinase catalyzed reactions in vivo, such
as l phage integration or the yeast 2mm FRT?FRT inversion
catalyzed by Flp, recombination yields are almost 100%. In
integron reactions, even in conditions of IntI1 overexpres-
sion, the recombination yield never exceeds a few percent
(e.g. Collis et al, 2001). This might directly reflect the relative
abundance of ss substrate accessible to IntI1 that is generated
through replication and/or transcription processes during the
cell cycle. Indeed, the recombination rates measured after
delivery of attC bs was identical to that obtained in the
classical in vivo assay that employs ds attC and ds attI
sites, that is, carried on compatible replicative plasmids. It
is likely that the IntI1 binding on the attC bs stem-and-loop
could stabilize this otherwise transient structure, rendering it
prone for recombination. The rest of the cassette sequence
can be maintained in a canonical ds DNA form; this will not
interfere with the attC bs?attI ds recombination reaction or
with its resolution through a replication step.
These results suggest a novel site-specific recombination
mechanism that uses a non-canonical substrate. They also
explain why the overall complementarity is more conserved
than the primary sequence in the different attC sites found in
the integron cassettes. This model may be more general and
not limited to the integron recombination system. Indeed, we
have recently obtained evidence that integration of the single
strand V. cholerae CTX phage genome into the dimer resolu-
tion site of chromosome 1 by the XerCD recombinases
depends on the formation of a stem-and-loop structure (Val
et al, 2005). The selective advantages that have led to the
development of these ss recombination sites and processes
are still elusive. However, this might be linked to the phe-
nomenon of gene dissemination by horizontal transfer, which
in many cases goes through an ss stage, as demonstrated for
filamentous phages, for conjugation and for natural transfor-
mation in bacteria.
CGAATTATAGTTCGCAATCAC
TACAGATTGTTAAGTAAGTTCG
ATGTCTAACAATTCATTCAAGC
GCTTAATATCAAGCGTTAGTG
R
CAATACCTCGTCGTTGCTACAATGCGTCGTCCCGTCAGCGGGATTTTGTTTCAATCTGTA
TTAGACATGTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAG
DR2DR1
L
attI1
DR2DR1L
R′
R′
L′
R′
L′
L′
L′′
R′′
L′′
L′′
R′′
R′′
R
GTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGTG
CAATACCTCGTCGTTGCTACAATGCGTCGTCCCGTCAGCGGGATTTTGTTTCAATCAC
C
GA
GTG
TACAGATTGT AATAA TTCG
Cassette
ATGTCTAACG TTATT-AAGC
attCaadA7bs
C
T
GA
T
T
T
C
G
TACAGATTGTTAAGTAA TTCG
ATGTCTAAATT-AAGC
G
G
T
T
C
GTTATGGAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGTG
CAATACCTCGTCGTTGCTACAATGCGTCGTCCCGTCAGCGGGATTTAATCAC
IntI1 strand exchanges
Replication
DR2DR1LR
(attI1)
DR2DR1LR
5′
3′
5′
3′
5′
3′
5′
3′
5′
3′
5′
3′
5′
3′
5′
3′
(attI1::cassette)
Figure 7 Model of the integron recombination molecular mechan-
ism using an ss attC substrate folded through pairing of the
imperfect palindromic sequences. Steps are identical to classical
site-specific recombination steps catalyzed by other Y-recombi-
nases, up to the HJ intermediate. Classical resolution through the
A axis reverses the recombination to the original substrates, while
resolution through the B axis, giving rise to covalently closed linear
molecules, is abortive. The non-abortive productive resolution
necessitates a replication step. Putative IntI1 binding domains and
crossover positions are indicated by boxes and vertical arrows,
respectively. The extent of the attI1-protected regions in methyla-
tion interference assays (Gravel et al, 1998a), corresponding to
repeats DR1 and DR2, is shown by horizontal lines with empty
arrowhead.
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
8

Page 9

Materials and methods
Bacterial strains, plasmids and media
Bacterial strains and plasmids are described in Tables I and II. E. coli
strains were grown in Luria-Bertani or, when specified, in Mueller-
Hinton (MH) broth at 371C, or 301C for the Intl experiments.
Antibiotics were used at the following concentrations: ampicillin
(Ap), 100mg/ml; chloramphenicol (Cm), 25mg/ml; erythromycin
(Em), 200mg/ml; kanamycin (Km), 25mg/ml; nalidixic acid (Nal),
30mg/ml. Thymidine (Thy) and diaminopimelic acid (DAP) were
supplemented when necessary to a final concentration of 0.3mM.
Isopropyl-b-D-thiogalactopyranoside (IPTG) was added at 0.5mM
final concentration. Chemicals were from Sigma.
Polymerase chain reaction procedures
Polymerase chain reaction (PCR) for plasmid assembly used the Pfu
DNA polymerase (Promega). Other PCR reactions used the PCR
Reddy mix (Abgene, UK). Both were used according to the
Table I Bacterial strains used in this study
E. coli strainsDescription/relevant characteristicsReference
DH5a
P1
P1977
ED9
b2163
UB5201
UB5201-I1
UB5201-Pi
MG1655
MG1657
MG1657-PIl
supE44 DlacU169 (F80lacZ0DM15) DargF hsdR17 recA1 endA1 gyrA96 thi-1 relA1
DH5a DthyA::(erm-pir116) [ErmR]
P1 pSU711DoriT::aac(3)-IV [GmRKmRErmR]
F-DlacU169 araD139 rpsL relA flbB DmalE444 srl::Tn10 recA1 [TcR]
MG1655::DdapA::(erm-pir)RP4-2-Tc::Mu [KmR]
F-pro met recA56 gyrA [NalR]
UB5201 pTRC99A::intI1 pSU38-attI1
UB5201DthyA::(erm-pir116) [NalRErmR]
E. coli K12
MG1655 DlattB::aadA DlacZ recA [SpecR]
MG1657 pTSA29-CXI-AK pSU38D-attP
Laboratory collection
Demarre et al (2005)
Demarre et al (2005)
E Dassa (unpublished)
Demarre et al (2005)
Martinez and de la Cruz (1990)
This study
This study
Laboratory collection
F Boccard (unpublished)
This study
Table II Plasmids used and constructed in this study
PlasmidsDescription
pTRC99A::intI1
pSU38D
pSU38-attI1
pSU38-attCaadA7
pSU38D-attP
pTSA29-CXI-AK
pSU711DoriT::aac(3)-IV oriVR388(IncW) [Km Gm]R(Demarre et al, 2005)
pG-lattPoriColE1; lattP lacZ::lattB; [Ap]R(Valens et al, 2004)
pMalC-2X::intI11023bp SmaI/BamHI intI1 PCR fragment (Fmal2 and Eibam2) amplified from pTRC99A::intI1 in pMalC-2X (New
England Biolab) digested by XmnI/BamHI
pSW23TpSW23T::oriTRP4; oriVR6K[Cm]R(Demarre et al, 2005)
pSW23TISS
1772bp inverse PCR fragment (Isal/sac-1 and Isal/sac-2) amplified from pSW23T, digested by BamHI and religated
pVCR-BpSW23T::VCR2/1B (Biskri et al, 2005)
pVCR-T207bp SalI/SacI VCR2/1fragment from pVCR-B in pSW23Tissdigested by SalI/SacI
pAttI1-B155bp EcoRI/BamHI attI1 fragment from pSU38-attI1 in pSW23T digested by EcoRI/BamHI
pAttI1-T155bp EcoRI/BamHI attI1 fragment from pSU38-attI1 in pSW23Tissdigested by EcoRI/BamHI
pVCR-BIKSL
1723bp inverse PCR fragment (Ikpn/sal-1 and Ikpn/sal-2) amplified from pVCR-B, digested by SmaI and religated
pVCR-TIKSC
1723bp inverse PCR fragment (Ikpn/sac-1 and Ikpn/sac-2) amplified from pVCR-T, digested by SmaI and religated
pVCR-BINV
260bp KpnI/SalI oriTRP4fragment from pVCR-B in pVCR-BIKSLdigested by KpnI/SalI
pVCR-TINV
260bp KpnI/SacI oriTRP4fragment from pVCR-T in pVCR-TIKSCdigested by KpnI/SacI
pAttC-B76bp MfeI/BamHI attCaadA7fragment (annealing between attC-GD3 and attC-GD4) in pSW23TISSdigested
by EcoRI/BamHI
pAttC-T76bp MfeI/BamHI attCaadA7fragment (annealing between attC-GD3 and attC-GD4) in pSW23T digested
by EcoRI/BamHI
pAttC-B-Mut170bp EcoRI/BamHI attCaadA7-Mut1fragment (annealing between attC-Mut1 UP and DW) in pSW23T digested
by EcoRI/BamHI
pAttC-B-Mut270bp EcoRI/BamHI attCaadA7-Mut2fragment (annealing between attC-Mut2 UP and DW) in pSW23T digested
by EcoRI/BamHI
pAttC-B-Mut370bp EcoRI/BamHI attCaadA7-Mut3fragment (annealing between attC-Mut1 DW and attC-Mut3) in pSW23T digested
by EcoRI/BamHI
pAttC-B-Mut470bp EcoRI/BamHI attCaadA7-Mut4fragment (annealing between attC-Mut4 UP and DW) in pSW23T digested
by EcoRI/BamHI
plattB-1 34bp EcoRI/BamHI lattB fragment (annealing between attB-1 and attB-2) in pSW23T digested by EcoRI/BamHI
plattB-234bp EcoRI/BamHI lattB fragment (annealing between attB-1 and attB-2) in pSW23TISSdigested by EcoRI/BamHI
pSW27pSW23T::oriTR388; oriTorientation ?; oriVR6K[Cm]R(Demarre et al, 2005)
pSW27ISS
1844bp inverse PCR fragment (Isal/sac-3 and Isal/sac-4) amplified from pSW27, digested by KpnI and religated
p388VCR-B203bp SalI/SacI VCR2/1fragment from pVCR-B in pSW27ISSdigested by SalI/SacI
p388VCR-T184bp EcoRI/SacI VCR2/1fragment from pVCR-B in pSW27 digested by EcoRI/SacI
pD388VCR-B1678bp inverse PCR fragment (Imfe/sac-1 and Imfe/sac-2) amplified from p388VCR-B, digested by KpnI and religated
pSW26 pSW23T::oriTR388; oriTorientation +; oriVR6K[Cm]R(Demarre et al, 2005)
p388VCR-TINV
184bp EcoRI/SacI VCR2/1fragment from p388VCR-T in pSW26 digested by EcoRI/SacI
p388VCR-BINV
373bp MfeI/SacI oriTR388fragment from p388VCR-B in pD388VCR-B digested by MfeI/SacI
oriColE1[Ap]R(Rowe-Magnus et al, 2001)
orip15A[Km]R(Biskri et al, 2005)
pSU38D::attI1 (Biskri et al, 2005)
76bp PstI/BamHI attCaadA7fragment (annealing between attC-GD1 and attC-GD2) in pSU38D digested by PstII/BamHI
420bp SalI lattP fragment from pG-attP in pSU38D digested by SalI
oriPSC101
; intl (Valens et al, 2004)
ts
Single strand recombination in integron
M Bouvier et al
&2005 European Molecular Biology Organization The EMBO Journal 9

Page 10

manufacturer’s instructions. PCR primers listed in Table III were
obtained from Proligo (France).
In vitro binding assay
In vitro binding assays used an MBP-IntI1 fusion protein, which
retains full IntI1 functionality in vitro and in vivo (Gravel et al,
1998a,b).
Purification of MBP-IntI1 integrase. IntI1 was amplified by PCR
with primers Fmal2 and Eibam2 (Table III), digested with SmaI and
BamHI and cloned into pMalC-2X (New England Biolabs, USA) that
had been digested with XmnI and BamHI. MBP-IntI1 fusion protein
was purified according to the manufacturer’s instructions after
expression in strain ED9 (Table I). Concentration and purity of
the purified MBP-IntI1 protein preparation were determined on an
SDS–PAGE gel.
Double strand substrate. Double strand DNA fragments containing
attI1 (68bp), attCaadA7(76bp) and VCR2/1(149bp) were generated
by PCR with primers attI-TB1 and attI-TB2, aadA7-TB1 and aadA7-
TB2 and VCR-TB1 and VCR-TB2 (Table III), respectively, using
pSU38-attI1, pSU38-attCaadA7 and pVCR-BIKSL (Table II) as tem-
plates. One primer in each pair used (attI-TB1, aadA7-TB2 and VCR-
TB1) was previously labeled at its 50terminus with radioactive
phosphate transferred from [g-32P]ATP (Amersham) by T4 poly-
nucleotide kinase. PCR products were purified with the QIAquick
PCR purification Kit (Qiagen).
Single strand substrate. Oligonucleotides corresponding to the attI1
ts (attI1top) and bs (attI1bot), attCaadA7 ts (aadA7top) and bs
(aadA7bot) and VCR2/1ts (VCRtop) and VCR2/1bs (VCRbot) (Table
III) were obtained from Proligo (France) and MWG Biotech AG
(Germany), 50labeled with radioactive phosphate and purified as
stated above.
Electrophoretic mobility shift assay. Purified labeled DNA fragments
(20000c.p.m., 0.5pmol) were incubated with MBP-IntI1 for 15min
at 301C in a 20ml final volume containing 50mM Tris (pH 7.5),
100mM NaCl, 1mM CHAPS, 0.2mM EDTA, 5% glycerol, 1mM
dithiothreitol, 1.5mg of poly(dI-dC) DNA and 0.7mg of bovine
serum albumin. Following this incubation, the binding reaction
mixtures were electrophoresed at room temperature in 6% native
polyacrylamide gels (50mM Tris, 400mM glycine, 1.73mM EDTA)
(Derre et al, 1999).
In vivo recombination assay
Recombination with non-replicative single strand substrate. The
in vivo recombination assay was based on that of Biskri et al (2005).
Table III Oligonucleotides
Oligonucleotides Sequences
EMSA experiments
aadA7-TB1
aadA7-TB2
aadA7bot
aadA7top
attI1-TB1
attI1-TB2
attI1bot
attI1top
VCR-TB1
VCR-TB2
VCRbot
GATCCTGCCTAACAATTCATTCA
TGCAGCAATTGCCTAACGCTTG
TGCAGCAATTGCCTAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTAGGCAGGATC
GATCCTGCCTAACAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTAGGCAATTGCTGCA
GCGGGATCCGCACTAACTTTG
GGAATTCAGCAGCAACGATG
GCGGGATCCGCACTAACTTTGTTTTAGGGCGACTGCCCTGCTGCGTAACATCGTTGCTGCTGAATTCCGG
CCGGAATTCAGCAGCAACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGTGCGGATCCCGC
GCGGGATCCGTTATAACGCC
CCGGAATTCGTTATAACAAACGC
GCGGGATCCGTTATAACGCCCGCCTAAGGGGCTGACAACGCACTACCACTAAACTCAAACACAACAACAGCAACCAC
CGCGGCTCAATGGGACTGGAAACGCCACGCGTTGACAGTCCCTCTTGAGGCGTTTGTTATAACGAATTGG
CCGGAATTCGTTATAACAAACGCCTCAAGAGGGACTGTCAACGCGTGGCGTTTCCAGTCCCATTGAGCCGCGGTGGT
TGCTGTTGTTGTGTTTGAGTTTAGTGGTAGTGCGTTGTCAGCCCCTTAGGCGGGCGTTATAACGGATCGC
VCRtop
Plasmid constructions
Fmal2
Eibam2
Isal/sac1
Isal/sac2
Ikpn/sal-1
Ikpn/sal-2
Ikpn/sac-1
Ikpn/sac-2
Isal/sac-3
Isal/sac-4
Imfe/sac-1
Imfe/sac-2
attB-1
attB-2
attC-GD1
attC-GD2
attC-GD3
attC-GD4
attC-Mut1 UP
attC-Mut1 DW
attC-Mut2 UP
attC-Mut2 DW
attC-Mut3
attC-Mut4 UP
attC-Mut4 DW
MRV
SW23begin
SW23end
CCGGAATTCTAATAGGAGACCCGGGATGAAAACCGCCACTGCGCC
CGCGGATCCTTACCTCTCACTAGTGAGGGGC
CGCGGATCCCATATGCTCGAGGAGCTCGCCGGCCAGCCTCGCAGAGCAGGATTCCCG
CGCGGATCCGCTAGCGAATTCGTCGACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCG
TCCCCCGGGCATATGCTCGAGGGTACCGGTATCGATAAGCTTGATATCGAATTCAGATCTG
TCCCCCGGGGCTAGCGAATTCGTCGACCAATTCGCCCTATAGTGAGTCGTATTACGCGCGC
TCCCCCGGGCATATGCTCGAGGGTACCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGAT
TCCCCCGGGGCTAGCGAATTCGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGC
CGGGGTACCCATATGCTCGAGGAGCTCCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAG
CGGGGTACCGCTAGCGAATTCGTCGACCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCG
CGGGGTACCCATATGCTCGAGCAATTGCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGAT
CGGGGTACCGCTAGCGAATTCGAGCTCCGCCGAATAAATACCTGTGACGGAAGATCACTTC
AATTCAGCCTGCTTTTTTATACTAACTTGG
GATCCCAAGTTAGTATAAAAAAGCAGGCTG
GATCCTGCCTAACAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTAGGCAATTGCTGCA
GCAATTGCCTAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTAGGCAG
GATCCTGCCTAACAATTCATTCAAGCCGACGCCGCTTCGCGGCGCGGCTTAATTCAAGCGTTAGGC
AATTGCCTAACGCTTGAATTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAATGAATTGTTAGGCAG
CTAGAATTCGGTTATAACAATTCATTCAAGCCGACCATAGTTCGCGGCGC
CGCGGATCCGGTTATAACGCTTGAATTAAGCCGCGCCGCGAACTATGGTC
CTAGAATTCGGTTATAACAATTCATTCAAGCCGACCATAGTTCCTATGGCGGC
CGCGGATCCGGTTATAACGCTTGAATTAAGCCGCCATAGGAACTATGGTCGGC
CTAGAATTCGGTTATAACAATTCATTCAACGGGACCATAGTTCGCGGCGC
CTAGAATTCGGTTATAACAATTCATTCAACGGGACCATAGTTCCTATGGCCCG
CGCGGATCCGGTTATAACGCTTGAATTAACGGGCCATAGGAACTATGGTCCCG
AGCGGATAACAATTTCACACAGGA
CCGTCACAGGTATTTATTCGGCG
CCTCACTAAAGGGAACAAAAGCTG
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
10

Page 11

It used conjugation to deliver one of the recombination substrates into
a recipient cell expressing the IntI1 integrase and carrying a second
recombination substrate on a pSU38 plasmid (Bartolome et al,
1991) derivative. The recombination sites provided by conjugation
were carried on suicide vectors from the R6K-based pSW family
(Demarre et al, 2005). Plasmids are described in Table II. IntI1
integrase was expressed under the control of LacI from pTRC99A-
HintI1 (p112 in Rowe-Magnus et al, 2002). Plasmids carrying
different recombination sites are listed in Table II. Briefly, the RP4
(IncPa) conjugation system used the donor strain, b2163 [dapA?,
pirþ] (Demarre et al, 2005) and the recipient, UB5201-I1, which
does not carry a pir gene copy. b2163 carries an RP4 integrated into
its chromosome, requires DAP to grow in rich medium and can
sustain pSWreplication through the expression of a chromosomally
integrated pir gene. UB520-I1 is a UB5201 derivative, which
contains pTRC99AHintI1 [AmpR] and the pSU38 plasmid derivative
[KmR] carrying the targeted recombination site (Table I). As pSW
replication absolutely requires the P protein, the number of
recipients expressing the pSW marker directly reflects the frequency
of cointegrate formation between the conjugated pSW plasmid
and the target replicon in the recipient cell. Conjugations were
performed as previously described (Biskri et al, 2005). The
integration activity using this assay was calculated as the ratio of
transconjugants expressing the pSW marker CmRto the total
number of recipient AmpR, KmRclones. attC?attI cointegrate
formation was checked by PCR with appropriate primers (MRVand
SW23begin or MRV and SW23end; Table III) on eight randomly
chosen clones per experiment. Backgrounds were established using
recipient strains containing an empty pTRC99A in place of the
pTRC99AHintI1, and were found to be o8?10?7.
Similar experiments were performed using the IncW R388 conjuga-
tion system. In this case, the donor strain was P1977, a [thyA?pirþ]
P1 derivative containing the plasmid pSU711DoriTHaac(3)-IV.
This plasmid is deleted for its oriT but expresses all R388 transfer
functions and has been shown to support the efficient transfer of the
oriTR388carrying pSW derivatives, pSW26 and pSW27 (Demarre
et al, 2005). This strain requires Thy for growth in MH medium and
sustain pSWreplication through the expression of a chromosomally
integrated pir gene. The recipient strains were identical to those
used in the RP4-based assay, and the integration activity was
determined using the same calculation.
Recombination control: recombination with a replicative
double-stranded substrate
The three plasmids, pTRC99AHintI1, pSU38-attI1 and pSWHattC,
harboring the different attC site derivatives were transformed into
UB5201-Pi, a UB5201 derivative rendered [pirþ], by thyA allelic
replacement, with allele DthyAH(erm-pir116) as described (De-
marre et al, 2005). This [pirþ] strain allows pSWHattC replication.
After overnight growth in the presence of appropriate antibiotics
and 0.5mM IPTG to allow intI1 expression, cells were harvested
and total plasmid DNA extracted. This was then introduced by
transformation into DH5a, a [pir?] strain, and transformants were
selected for CmR(the pSWHattC marker) or KmR(the pSU38-attI1
marker). As pSWHattC cannot replicate in DH5a, CmRclones
should correspond to cointegration of the plasmid with pSU38-attI1
through intI1-mediated recombination between the attI1 and attC
sites. Recombination activity is calculated as the ratio of CmRto
KmRtransformants.
Conjugation control. Conjugation was performed using the counter-
selectable donor strains b2163 or P1977, respectively DAP and Thy
auxotrophs, carrying the different pSWHattC derivatives, and the
[pirþ] recipient strain UB520-Pi, carrying pTRC99AHintI1 and
pSU38-attI1. Control conjugations were performed in the same
conditions as the suicide conjugative transfer assay. Frequencies
were measured as the fraction of CmRto AmpRKmRclones in the
recipient population.
Phage k attP?attB recombination assay
The same suicide conjugative transfer assays were applied to the
well-known reaction of phage l integration (attP?attB recombina-
tion).
Two pSW plasmids carrying the attB site in both orientations,
plattB-1 and plattB-2, to permit suicide transfer of either strand,
were constructed. The attP site was cloned in pSU38D, leading to
pSU38-lattP, and the expression of intl was controlled by
temperature shift from plasmid pTSA29-CX1-AK. Recombination
was measured after 2h of conjugation using MG1657-PIl, an
MG1657 derivative carrying pTSA29-CX1-AK and pSU38-lattP as a
recipient. Recombination activity is established as the ratio of the
CmRtransconjugants to the AmpR, KmRrecipients.
We determined that under these conditions, the frequency of
conjugation of both plattB-1 and plattB-2 plasmids to a [pirþ]
recipient strain was about 2–5?10?2. Recombination controls with
ds substrates were established in a [pir?] host as for the integron
reaction, but the induction of the intl expression was limited to
90min, as we found that it was sufficient to obtain 100%
recombination.
Supplementary data
Supplementary data are available at The EMBO Journal Online.
Acknowledgements
We thank Dr T Msadek for helpful advices in the EMSA experi-
ments. We thank Dr F Boccard and E Dassa for kindly providing
strains MG1657 and ED9. We thank Drs M Chandler, F-X Barre,
F Cornet and D Rowe-Magnus for helpful comments on the manu-
script. GD and MB are doctoral fellows from the MENESR. This
work was supported by the Institut Pasteur, the CNRS (URA 2171
and GDR 2157 on transposable elements) and the Programme de
‘Microbiologie fondamentale et applique ´e, maladies infectieuses,
environnement et bioterrorisme’ from the MENESR.
References
Azaro MA, Landy A (2002) Chapter 7-l integrase and the l Int
family. In Mobile DNA II, Craig NL, Craigie R, Gellert M,
Lambowitz AM (eds) pp 118–148. Washington, DC: ASM Press
Bartolome B, Jubete Y, Martinez E, de la Cruz F (1991) Construction
and properties of a family of pACYC184-derived cloning
vectors compatible with pBR322 and its derivatives. Gene 102:
75–78
Biskri L, Bouvier M, Guerout AM, Boisnard S, Mazel D (2005)
Comparative study of class 1 integron and Vibrio cholerae super-
integron integrase activities. J Bacteriol 187: 1740–1750
Collis CM, Grammaticopoulos G, Briton J, Stokes HW, Hall RM
(1993) Site-specific insertion of gene cassettes into integrons. Mol
Microbiol 9: 41–52
Collis CM, Hall RM (1992) Gene cassettes from the insert region of
integrons are excised as covalently closed circles. Mol Microbiol 6:
2875–2885
Collis CM, Kim MJ, Stokes HW, Hall RM (1998) Binding of the
purified integron DNA integrase Intl1 to integron- and cassette-
associated recombination sites. Mol Microbiol 29: 477–490
Collis CM, Recchia GD, Kim MJ, Stokes HW, Hall RM (2001)
Efficiency of recombination reactions catalyzed by class 1 inte-
gron integrase IntI1. J Bacteriol 183: 2535–2542
Demarre G, Guerout AM, Matsumoto-Mashimo C, Rowe-Magnus
DA, Marlie `re P, Mazel D (2005) A new family of mobilizable
suicide plasmidsbasedon
plasmid (IncW) or RP4 plasmid (IncPa) conjugative machineries
and their cognate E. coli host strains. Res Microbiol 156:
245–255
Derre I, Rapoport G, Msadek T (1999) CtsR, a novel regulator of
stress and heat shock response, controls clp and molecular
chaperone gene expression in gram-positive bacteria. Mol
Microbiol 31: 117–131
Francia MV, Zabala JC, de la Cruz F, Garcia-Lobo JM (1999) The
IntI1 integron integrase preferentially binds single-stranded DNA
of the attC site. J Bacteriol 181: 6844–6849
Gravel A, Fournier B, Roy PH (1998a) DNA complexes obtained
with the integron integrase IntI1 at the attI1 site. Nucleic Acids Res
26: 4347–4355
the broadhost rangeR388
Single strand recombination in integron
M Bouvier et al
&2005 European Molecular Biology OrganizationThe EMBO Journal 11

Page 12

Gravel A, Messier N, Roy PH (1998b) Point mutations in the
integron integrase IntI1 that affect recombination and/or sub-
strate recognition. J Bacteriol 180: 5437–5442
Hall RM, Brookes DE, Stokes HW (1991) Site-specific insertion of
genes into integrons: role of the 59-base element and determina-
tion of the recombination cross-over point. Mol Microbiol 5:
1941–1959
Hall RM, Collis CM (1998) Antibiotic resistance in gram-negative
bacteria: the role of gene cassettes and integrons. Drug Resist
Update 1: 109–119
Hansson K, Skold O, Sundstrom L (1997) Non-palindromic attl sites
of integrons are capable of site-specific recombination with one
another and with secondary targets. Mol Microbiol 26: 441–453
Johansson C, Kamali-Moghaddam M, Sundstrom L (2004) Integron
integrase binds to bulged hairpin DNA. Nucleic Acids Res 32:
4033–4043
Lanka E, Barth PT (1981) Plasmid RP4 specifies a deoxyribonucleic
acid primase involved in its conjugal transfer and maintenance.
J Bacteriol 148: 769–781
Martinez E, de la Cruz F (1990) Genetic elements involved in Tn21
site-specific integration, a novel mechanism for the dissemination
of antibiotic resistance genes. EMBO J 9: 1275–1281
Pansegrau W, Lanka E (1996) Mechanisms of initiation and termi-
nation reactions in conjugative DNA processing. Independence of
tight substrate binding and catalytic activity of relaxase (TraI) of
IncPalpha plasmid RP4. J Biol Chem 271: 13068–13076
Pansegrau W, Schroder W, Lanka E (1993) Relaxase (TraI) of IncP
alpha plasmid RP4 catalyzes a site-specific cleaving–joining
reaction of single-stranded DNA. Proc Natl Acad Sci USA 90:
2925–2929
Rowe-Magnus DA, Guerout A-M, Ploncard P, Dychinco B, Davies J,
Mazel D (2001) The evolutionary history of chromosomal super-
integrons provides an ancestry for multi-resistant integrons. Proc
Natl Acad Sci USA 98: 652–657
Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P, Mazel D
(2003) Comparative analysis of superintegrons: engineering
extensive genetic diversity in the vibrionaceae. Genome Res 13:
428–442
Rowe-Magnus DA, Guerout AM, Mazel D (2002) Bacterial resistance
evolution by recruitment of super-integron gene cassettes. Mol
Microbiol 43: 1657–1669
Stokes HW, O’Gorman DB, Recchia GD, Parsekhian M, Hall RM
(1997) Structure and function of 59-base element recombination
sites associated with mobile gene cassettes. Mol Microbiol 26:
731–745
Val ME, Bouvier M, Campos J, Sherratt D, Cornet F, Mazel D, Barre
FX (2005) The single-stranded genome of phage CTX is the form
used for integration into the genome of Vibrio cholerae. Mol Cell
19: 559–566
Valens M, Penaud S, Rossignol M, Cornet F, Boccard F (2004)
Macrodomain organization of the Escherichia coli chromosome.
EMBO J 23: 4330–4341
Walter AE, Turner DH, Kim J, Lyttle MH, Muller P, Mathews DH,
Zuker M (1994) Coaxial stacking of helixes enhances binding of
oligoribonucleotides and improves predictions of RNA folding.
Proc Natl Acad Sci USA 91: 9218–9222
Single strand recombination in integron
M Bouvier et al
The EMBO Journal
&2005 European Molecular Biology Organization
12