Glyceraldehyde-3-phosphate dehydrogenase of Paracoccidioides brasiliensis is a cell surface protein involved in fungal adhesion to extracellular matrix proteins and interaction with cells.

Abstract

The pathogenic fungus Paracoccidioides brasiliensis causes paracoccidioidomycosis, a pulmonary mycosis acquired by inhalation of fungal airborne propagules, which may disseminate to several organs and tissues, leading to a severe form of the disease. Adhesion to and invasion of host cells are essential steps involved in the infection and dissemination of pathogens. Furthermore, pathogens use their surface molecules to bind to host extracellular matrix components to establish infection. Here, we report the characterization of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of P. brasiliensis as an adhesin, which can be related to fungus adhesion and invasion. The P. brasiliensis GAPDH was overexpressed in Escherichia coli, and polyclonal antibody against this protein was obtained. By immunoelectron microscopy and Western blot analysis, GAPDH was detected in the cytoplasm and the cell wall of the yeast phase of P. brasiliensis. The recombinant GAPDH was found to bind to fibronectin, laminin, and type I collagen in ligand far-Western blot assays. Of special note, the treatment of P. brasiliensis yeast cells with anti-GAPDH polyclonal antibody and the incubation of pneumocytes with the recombinant protein promoted inhibition of adherence and internalization of P. brasiliensis to those in vitro-cultured cells. These observations indicate that the cell wall-associated form of the GAPDH in P. brasiliensis could be involved in mediating binding of fungal cells to fibronectin, type I collagen, and laminin, thus contributing to the adhesion of the microorganism to host tissues and to the dissemination of infection.

Full text

Page 1

INFECTION AND IMMUNITY, Jan. 2006, p. 382–389
0019-9567/06/$08.00?0
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 74, No. 1
doi:10.1128/IAI.74.1.382–389.2006
Glyceraldehyde-3-Phosphate Dehydrogenase of Paracoccidioides
brasiliensis Is a Cell Surface Protein Involved in Fungal
Adhesion to Extracellular Matrix Proteins and
Interaction with Cells
Mo ˆnica Santiago Barbosa,1So ˆnia Nair Ba ´o,2Patrı ´cia Ferrari Andreotti,3Fabrı ´cia P. de Faria,1
Maria Sueli S. Felipe,2Luciano dos Santos Feitosa,4Maria Jose ´ Soares Mendes-Giannini,3
and Ce ´lia Maria de Almeida Soares1*
Laborato ´rio de Biologia Molecular, Instituto de Cie ˆncias Biolo ´gicas, Universidade Federal de Goia ´s, Goia ¯nia, Goia ´s,
Brazil1; Universidade de Brası ´lia, Distrito Federal, Brazil2; Universidade Estadual Ju ´lio de Mesquita Filho,
Araraquara, Sa ˜o Paulo, Brazil3; and Universidade Federal de Sa ˜o Paulo, Sa ˜o Paulo, Brazil4
Received 1 September 2005/Returned for modification 14 September 2005/Accepted 24 October 2005
The pathogenic fungus Paracoccidioides brasiliensis causes paracoccidioidomycosis, a pulmonary mycosis
acquired by inhalation of fungal airborne propagules, which may disseminate to several organs and tissues,
leading to a severe form of the disease. Adhesion to and invasion of host cells are essential steps involved in
the infection and dissemination of pathogens. Furthermore, pathogens use their surface molecules to bind to
host extracellular matrix components to establish infection. Here, we report the characterization of the
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of P. brasiliensis as an adhesin, which can be related to
fungus adhesion and invasion. The P. brasiliensis GAPDH was overexpressed in Escherichia coli, and polyclonal
antibody against this protein was obtained. By immunoelectron microscopy and Western blot analysis, GAPDH
was detected in the cytoplasm and the cell wall of the yeast phase of P. brasiliensis. The recombinant GAPDH
was found to bind to fibronectin, laminin, and type I collagen in ligand far-Western blot assays. Of special note,
the treatment of P. brasiliensis yeast cells with anti-GAPDH polyclonal antibody and the incubation of
pneumocytes with the recombinant protein promoted inhibition of adherence and internalization of P. brasil-
iensis to those in vitro-cultured cells. These observations indicate that the cell wall-associated form of the
GAPDH in P. brasiliensis could be involved in mediating binding of fungal cells to fibronectin, type I collagen,
and laminin, thus contributing to the adhesion of the microorganism to host tissues and to the dissemination
of infection.
Paracoccidioides brasiliensis is a dimorphic fungal pathogen,
the etiological agent of paracoccidioidomycosis (PCM), en-
demic in Latin America. The disease begins in the lungs and
then disseminates to other organs and systems (14). The patho-
gen apparently has its natural habitat in soil, and mainly rural
workers appear to become infected by inhalation of fungal
airborne microconidia, which reach the pulmonary alveolar
epithelium and transform into the parasitic yeast form. Over 10
million people in areas where the pathogen is endemic could
be infected with P. brasiliensis, 2% of which are presumed to
develop PCM (25).
The development of PCM depends on interactions between
fungal and host components. P. brasiliensis can parasitize var-
ious tissues. The ability of pathogens to bind to components of
the extracellular matrix (ECM) has been described as an im-
portant mechanism in the invasion of host tissues (18, 21). Just
as with many pathogenic microorganisms, adhesion of P. bra-
siliensis to the host surface is thought to be a crucial step in the
pathogenic process and a prerequisite for host colonization. P.
brasiliensis expresses proteins that interact in various ways with
the extracellular environment. For instance, the glycoprotein
gp43 has been described as a mediator molecule in the binding
of P. brasiliensis to laminin (37). A 30-kDa protein which is
highly expressed in P. brasiliensis isolated from animals, pre-
senting a high capacity to adhere to and invade Vero cells, has
properties of an adhesin (2). A protein of 32 kDa present in the
cell wall and characterized as a hypothetical molecule from P.
brasiliensis was recently described as able to interact with the
ECM components (17). Despite those few descriptions, the
regulation and mechanistic details of P. brasiliensis in vitro and
in vivo cellular adhesion and infection remain poorly under-
stood.
Glyceraldehyde-3-phosphate
constitutes a protein family which displays diverse activities in
different subcellular locations, in addition to its well-character-
ized role in glycolysis (35). Specific intracellular interactions
seem to be related to the new activities of GAPDH. Accord-
ingly, membrane-bound GAPDH of group A streptococci has
been reported to bind fibronectin, lysozyme, and the cytoskel-
etal proteins myosin and actin, indicating that it may function
in the colonization of those bacteria (30). Also, GAPDH of
Streptococcus oralis was described as a dominant receptor for
Porphyromonas gingivalis fimbriae, contributing to host coloni-
zation by the latter microorganism (24).
Cell wall-associated GAPDHs have been described for
dehydrogenase (GAPDH)
* Corresponding author. Mailing address: Laborato ´rio de Biologia
Molecular, Instituto de Cie ˆncias Biolo ´gicas, Universidade Federal de
Goia ´s, Goia ¯nia, Goia ´s, Brazil, 74001-970. Phone: 55-62-3521-1110.
Fax: 55-62-3521-1110. E-mail: celia@icb.ufg.br.
382

Page 2

fungi. With Candida albicans, it has been demonstrated that an
immunogenic and enzymatically active GAPDH is found at the
cell surface (16) and that clinical strains express this surface
antigen both in vitro and in infected tissues (15). In addition,
the cell wall-associated GAPDH of C. albicans is a fibronectin
and laminin binding protein (19). Proteomic and biochemical
analysis indicated that GAPDH is also a cell surface plasmin-
ogen binding protein of C. albicans, which could potentially
increase the fungus capacity for tissue invasion and necrosis
(8).
We have previously identified by immunoproteomic se-
quencing and microsequencing of peptides two isoforms of 36
kDa, with pIs of 6.8 and 7.0, of the P. brasiliensis GAPDH (3,
13). We have also characterized the cDNA and genomic clones
encoding the homologue of GAPDH. We have previously pro-
vided insights into the structure, function, and potential regu-
lation of GAPDH, a single-copy gene of P. brasiliensis which is
conserved across species. We have also demonstrated that the
expression of GAPDH and its transcript are more abundant in
the parasitic yeast phase of P. brasiliensis (3). According to
these data, this protein seems to play a role in the fungus
parasitic yeast phase and thus should be better characterized.
In the present study, we report the heterologous overexpres-
sion of P. brasiliensis recombinant GAPDH and its purifica-
tion. In addition, we demonstrate for the first time the pres-
ence of this protein in the glycolytic pathway in the cell wall of
P. brasiliensis. We have also demonstrated that cell wall-asso-
ciated GAPDH is able to bind to extracellular matrix compo-
nents. The protein seems to mediate the processes of adher-
ence and internalization of P. brasiliensis to in vitro-cultured
cells, as suggested by the abilities of the anti-GAPDH poly-
clonal antibody and the recombinant protein to interfere with
both processes. These data suggest that GAPDH may play a
role in mediating the attachment and internalization of the
fungus to host tissues, potentially playing a role in the estab-
lishment of disease.
MATERIALS AND METHODS
P. brasiliensis isolate and growth conditions. The P. brasiliensis Pb01 isolate
(ATCC MYA-826) has been previously investigated by our laboratory and was
cultivated in semisolid Fava-Neto’s medium (12) at 36°C for the yeast form and
at 22°C for the mycelium phase.
Cloning cDNA containing the complete coding region of GAPDH into expres-
sion vector. The cloned cDNA containing the complete coding region of
GAPDH (GenBank accession number AY061958) (3) was amplified by PCR
using oligonucleotide sense (5? CACCATGGTCGTCAAGGTTGG 3?) and an-
tisense (5? GCTGCGAATTCCTATTTGCCAGC 3?) primers. The sequence
CACC (underlined) was incorporated at the 5? end of the sense primer. The
amplification parameters were as follows: an initial denaturation step at 94°C for
2 min, followed by 30 cycles of denaturation at 94°C for 15 s, annealing at 55°C
for 30 s, and extension at 68°C for 1 min and 30 s. A final elongation step was
performed at 68°C for 1 min. The resulting 1,000-bp product was subcloned into
the TOPO pET100 expression vector (Invitrogen, Life Technologies) to yield the
TOPO-pET100-GAPDH construct. The recombinant plasmid was used to trans-
form Escherichia coli XL1-Blue competent cells by the heat shock method (34).
Ampicillin-resistant transformants were cultured, and plasmid DNA was ana-
lyzed by PCR.
Heterologous expression of P. brasiliensis GAPDH and recombinant protein
purification. Bacteria transformed with the TOPO-pET-100-GAPDH construct
were grown in LB medium supplemented with ampicillin (100 ?g/ml) at 37°C
until the optical density at 600 nm reached 0.6. Synthesis of the recombinant
protein was then initiated by adding IPTG (isopropyl-?-D-thiogalactopyranoside)
to a final concentration of 0.8 mM to the growing culture. After 2 h, the bacterial
cells were harvested by centrifugation at 3,000 ? g and lysis was achieved by
incubation of the cells with guanidinium lysis buffer (6 M guanidine hydrochlo-
ride, 20 mM NaPO4, pH 7.8, 500 mM NaCl) and sonication. The recombinant
protein containing the His tag at its N-terminal end was purified on Ni-nitrilo-
triacetic acid resin (Invitrogen) under hybrid conditions, as follows. The cell
lysate was passed through a Ni-nitrilotriacetic acid column equilibrated with
denaturing binding buffer (8 M urea, 20 mM NaPO4, pH 7.8, 500 mM NaCl). The
column was washed sequentially with denaturing binding buffer, denaturing wash
buffer (8 M urea, 20 mM NaPO4, pH 6.0, 500 mM NaCl), and finally native wash
buffer (50 mM NaPO4, 0.5 M NaCl, 20 mM imidazole). The bound proteins were
eluted with native elution buffer (40 mM NaPO4, 0.4 M NaCl, 600 mM imida-
zole) to refold the protein, by following the manufacturer’s instructions. The
purity and size of the protein were evaluated by running the purified molecule
through 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-
PAGE), followed by Coomassie blue staining.
Antibody production. The purified recombinant GAPDH was used to generate
specific rabbit polyclonal serum. Rabbit preimmune serum was obtained and
stored at ?20°C. The purified protein (300 ?g) was injected into rabbit with
Freund’s adjuvant three times at 2-week intervals. The obtained serum, contain-
ing monospecific anti-GAPDH polyclonal antibodies, was sampled and stored at
?20°C.
Preparation of P. brasiliensis cell extracts. Yeast and mycelium protein crude
extracts were obtained by disruption of frozen cells in the presence of protease
inhibitors N?-p-tosyl-L-lysine chloromethyl ketone (TLCK) (50 ?g/ml), 4-chlo-
romercuribenzoic acid (1 mM), leupeptin (20 mM), phenylmethylsulfonyl fluo-
ride (20 mM), and iodoacetamide (5 mM) in homogenization buffer (20 mM
Tris-HCl, pH 8.8, 2 mM CaCl2). The mixture was centrifuged at 12,000 ? g at
4°C for 10 min, and the supernatant was used for further analysis of proteins by
one-dimensional gel electrophoresis.
Obtaining cell extracts. Cell extracts were prepared from yeast cells, as de-
scribed elsewhere (2, 5). In brief, yeast cells of P. brasiliensis were grown for 7
days in solid medium as described above. Cells (300 mg) were resuspended in 1.0
ml of 10 mM phosphate-buffered saline (PBS), pH 7.2, and vortexed for 30 s. The
cells were centrifuged for 1 min at 560 ? g, and the supernatant was collected
and used for further analysis.
Electrophoretic analysis. Electrophoresis of native proteins and SDS-PAGE
were performed according to O’Farrell (29) and Laemmli (23), respectively. The
proteins were precipitated by addition of 10% (wt/vol) trichloroacetic acid, and
the pellets were washed in 10% (vol/vol) cold acetone. The samples were resus-
pended in lysis buffer containing 9.5 M urea, 2% (vol/vol) Nonidet P-40, 5%
(vol/vol) ?-mercaptoethanol, and ampholines at pH ranges of 5.0 to 8.0 and 3.5
to 10.0 (ratio 4:1). The proteins were Coomassie blue or silver stained.
Western blot analysis. The protein extracts were resolved by one- or two-
dimensional gel electrophoresis. The proteins were electrophoretically trans-
ferred to a nylon membrane and checked by Ponceau S to determine equal
loading. GAPDH was detected with the polyclonal antibody raised to the re-
combinant protein. After reaction with alkaline phosphatase anti-rabbit immu-
noglobulin G (IgG), the reaction was developed with 5-bromo-4-chloro-3-in-
dolylphosphate–nitroblue tetrazolium (BCIP-NBT). Negative controls were
obtained with rabbit preimmune serum.
Transmission electron microscopy of P. brasiliensis yeast cells and immuno-
cytochemistry of the GAPDH protein. Yeast cells of P. brasiliensis were fixed
overnight at 4°C in solution containing 2% (vol/vol) glutaraldehyde, 2% (wt/vol)
paraformaldehyde, and 3% (wt/vol) sucrose in 0.1 M sodium cacodylate buffer at
pH 7.2. After fixation, the yeast cells were rinsed in the same buffer and postfixed
for 1 h in solution containing 1% (wt/vol) osmium tetroxide, 0.8% (wt/vol)
potassium ferricyanide, and 5 mM CaCl2in sodium cacodylate buffer, pH 7.2.
The material was dehydrated in a series of ascending acetones (30 to 100%)
(vol/vol) and embedded in Spurr resin (Electron Microscopy Sciences, Washing-
ton, Pa.). Ultrathin sections were stained with uranyl acetate, 3% (wt/vol), and
lead citrate (33). The material was observed with a Jeol 1011 transmission
electron microscope (Jeol, Tokyo, Japan).
For ultrastructural immunocytochemistry studies, yeast cells were fixed in a
mixture containing 4% (wt/vol) paraformaldehyde, 0.5% (vol/vol) glutaralde-
hyde, and 0.2% (wt/vol) picric acid in 0.1 M sodium cacodylate buffer at pH 7.2
for 24 h at 4°C. The cells were rinsed several times using the same buffer, and free
aldehyde groups were quenched with 50 mM ammonium chloride for 1 h,
followed by block staining in solution containing 2% (wt/vol) uranyl acetate in
15% (vol/vol) acetone for 2 h at 4°C (4). The material was dehydrated in a series
of ascending concentrations of acetone (30 to 100%) (vol/vol) and embedded in
LR Gold resin (Electron Microscopy Sciences, Washington, Pa.).
The ultrathin sections were collected on nickel grids, preincubated in 10 mM
PBS containing 1.5% (wt/vol) bovine serum albumin (BSA) and 0.05% (vol/vol)
Tween 20, (PBS-BSA-T), and subsequently incubated for 1 h with the polyclonal
VOL. 74, 2006 GAPDH IS AN ADHESIN OF P. BRASILIENSIS 383

Page 3

antibody against the recombinant GAPDH (diluted 1:100). After being washed
with PBS-BSA-T, the grids were incubated for 1 h with the labeled secondary
antibody (rabbit IgG, Au conjugated, 10 nm; diluted 1:20). Subsequently, the
grids were washed with the buffer described above, followed by a wash with
distilled water; stained with uranyl acetate, 3% (wt/vol), and lead citrate (33);
and observed with a Jeol 1011 transmission electron microscope (Jeol, Tokyo,
Japan). Controls were incubated with rabbit preimmune serum at 1:100, followed
by incubation with the labeled secondary antibody.
The gold particles were quantified in five independent preparations of yeast
cells. The particles were counted in total cell distribution, as well as in the cell
wall and cytoplasm. Results were expressed as the number of gold particles,
represented as the means of the counts performed three times with standard
deviations included.
Affinity ligand assays. Far-Western assays were carried out as previously
described (20). Recombinant GAPDH was submitted to SDS-PAGE and blotted
onto nitrocellulose membranes. Blotted protein was assayed for laminin, fi-
bronectin, and type I collagen binding as follows. After being blocked overnight
with 1.5% (wt/vol) BSA in 10 mM PBS, the membranes were incubated with
laminin (30 ?g/ml), fibronectin (30 ?g/ml), or type I collagen (20 ?g/ml) diluted
in PBS-BSA-T for 90 min and then washed three times (for 10 min each time) in
10 mM PBS containing 0.05% (vol/vol) Tween 20 (PBS-T). The membranes were
incubated for 1 h with rabbit antibodies antilaminin, antifibronectin, or anti-type
I collagen in PBS-BSA-T (diluted 1:100). The blots were washed with PBS-T and
incubated with peroxidase-labeled goat anti-rabbit immunoglobulin (diluted
1:1,000). The blots were washed with PBS-T, and the reactive bands were de-
veloped with hydrogen peroxide and diaminobenzidine (Sigma-Aldrich Co.) as
the chromogenic reagent. As controls, the blots were incubated only with anti-
laminin, antifibronectin, and anti-type I collagen antibodies, in the absence of the
ECM proteins (laminin, fibronectin, and type I collagen). The positive control
was obtained by incubating the recombinant GAPDH with the anti-GAPDH
polyclonal antibody (diluted 1:500), and the reaction was developed as described
above. Additional controls were obtained with BSA fractionated by SDS-PAGE,
blotted onto nitrocellulose membranes, and incubated with the ECM proteins
and the respective antibodies, as described above.
Binding assays of the recombinant GAPDH to pneumocytes. Type II pneu-
mocyte line A549 was obtained from the American Type Culture Collection
(Manassas, VA). The cells were seeded overnight in Dulbecco’s modified Eagle’s
medium (DMEM) and supplemented with 10% (vol/vol) heat-inactivated fetal
calf serum. The cells were washed three times with 10 mM PBS, and DMEM not
containing fetal calf serum was added. Monolayers of cells were incubated with
50 ?g/ml of recombinant GAPDH at 37°C for 5 h and washed with 10 mM PBS
to remove unbound protein. Next, double-distilled water was added and the cells
were incubated for 4 h at room temperature to obtain total lysis. The lysates were
centrifuged at 1,400 ? g for 5 min, and the supernatant was submitted to
SDS-PAGE. Proteins in the gel were transferred to membranes and incubated
overnight with blocking buffer (PBS-BSA-T). The secondary antibody was alka-
line phosphatase coupled with anti-rabbit IgG (Sigma-Aldrich Co.). The reac-
tions were developed with BCIP-NBT. Negative controls were obtained by an-
alyzing the supernatant of lysed pneumocytes not preincubated with the
recombinant protein GAPDH, as well as by coating the cell culture flask with 50
?g/ml of GAPDH.
Interaction of P. brasiliensis with in vitro-cultured pneumocytes: inhibition of
adherence and infection by GAPDH and by the antibody anti-GAPDH. A549
pneumocytes were incubated for 1 h at 37°C with the recombinant GAPDH
protein (25 ?g/ml), diluted in 10 mM PBS. After this incubation period, the cells
were washed three times in DMEM and 108yeast forms of P. brasiliensis were
added to the epithelial cells. Incubation was performed for 2 and 5 h at 37°C to
allow the processes of adhesion and infection, respectively, as described previ-
ously (2, 22, 27). Additionally, 108yeast cells of P. brasiliensis were incubated for
1 h at 37°C with the polyclonal antibody anti-GAPDH (diluted 1:100). After that,
the cells were washed three times in 10 mM PBS and allowed to interact with the
A549 pneumocytes. Control experiments were performed with A549 cells not
preincubated with the recombinant GAPDH protein, P. brasiliensis yeast cells
not preincubated with the anti-GAPDH antibody, and pneumocytes preincu-
bated with BSA (25 ?g/ml). The percentages of infected cells were determined
by randomly counting a minimum of 300 cells on each triplicate coverslip. The
adhesion and infection indices were calculated as described previously (11, 27).
Results are presented as the means of counts performed three times with stan-
dard deviations included. The adhesion index was obtained by multiplying the
mean number of attached yeast cells per pneumocyte by the percentage of
infected cells. The infection index (adherence plus internalization) was deter-
mined by the number of total fungi interacting with the epithelial cells 5 h after
addition of the yeast cells, as previously described (22, 27). All experiments were
performed in triplicate.
Statistical analysis. The means and standard deviations of at least three
distinct experiments were determined. Statistical analysis was performed by using
analysis of variance (F test followed by Duncan test). P values of 0.05 or less were
considered statistically significant.
RESULTS
Expression and purification of recombinant GAPDH and
production of polyclonal antibody. The cDNA encoding the P.
brasiliensis GAPDH was subcloned into the expression vector
TOPO pET100 to obtain the recombinant fusion protein. Af-
ter induction with IPTG, a 39-kDa recombinant protein was
detected in bacterial lysates (Fig. 1A, lane 3). The protein was
not present in crude extracts from control cells (Fig. 1A, lane
1) or in extracts from noninduced E. coli cells carrying the
expression vector (Fig. 1A, lane 2). The six-histidine residues
fused to the N terminus of the recombinant protein were used
to purify the protein from bacterial lysates by nickel-chelate
affinity. The recombinant protein was eluted and fractions of
equal volume (1 ml) were collected and analyzed by SDS-
PAGE. Fractions showed a single band of 39 kDa (Fig. 1A,
lane 4).
The purified recombinant protein was used to generate rab-
bit polyclonal antibody. Protein extracts of yeast and mycelium
and also the purified recombinant protein were subjected to
SDS-PAGE analysis and stained with Coomassie blue (Fig.
1B). The same samples were blotted to nitrocellulose mem-
branes and reacted to the polyclonal antibody (Fig. 1C). As
demonstrated, a single band of 36 kDa was detected in extracts
of both yeast and mycelium (Fig. 1C, lanes 1 and 2). Recom-
binant GAPDH presents a molecular mass (39 kDa) higher
than that of the native protein, due to the additional six-
histidine residues fused to its N terminus (Fig. 1C, lane 3). No
cross-reactivity to the rabbit preimmune serum was evidenced
with the samples (Fig. 1D, lanes 1 to 3).
Detection of GAPDH protein in P. brasiliensis cell extracts.
The cell extracts of yeast cells were analyzed by two-dimen-
sional gel electrophoresis (Fig. 2A). The characterized iso-
forms of GAPDH, with pIs of 6.8 and 7.0, are shown in this
cellular fraction. The polyclonal antibody was used for immu-
nodetection of the native GAPDH. This antibody recognized
both isoforms of the native protein in the cell extracts, which
correspond to the most superficial components of the cell wall
(Fig. 2B).
Detection of the GAPDH protein by immunoelectron mi-
croscopy of P. brasiliensis yeast cells. In order to continue to
define the cellular localization of the GAPDH protein in P.
brasiliensis, we performed immunocytochemistry experiments
using ultrathin sections of LR Gold-embedded yeast cells of P.
brasiliensis. Electron microscopy of conventionally embedded
cells revealed the ultrastructure of the P. brasiliensis yeast form
(Fig. 3A). An electron-dense cell wall and the plasma mem-
brane appear as defined structures. The contour of the nucleus
is relatively smooth and appears with condensed chromatin
that is homogeneously distributed. The cytoplasm appears oc-
cupied by mitochondria and well-developed vacuoles. The im-
munocytochemistry assays revealed gold particles detected in
the cytoplasm and extending through the cell wall, indicating
the double localization of GAPDH in P. brasiliensis (Fig. 3B and
384BARBOSA ET AL.INFECT. IMMUN.

Page 4

C). Control samples obtained by incubation of the yeast cells
with the rabbit preimmune serum were free of label (Fig. 3D).
The gold-labeled particles were counted in five immunocy-
tochemistry assays, as shown in Fig. 4. The amount of gold
particles was significantly larger in the cell wall (P ? 0.05) than
in the cytoplasmic compartment (Fig. 4).
Binding of recombinant GAPDH to extracellular matrix
proteins. The ability of the recombinant GAPDH of P. brasil-
iensis to bind laminin, fibronectin, and type I collagen was
determined by far-Western blotting assays, as shown in Fig.
5A. The recombinant protein presents the ability to bind to
laminin (Fig. 5A, lane 1), fibronectin (lane 2), and type I
collagen (lane 3). The positive control was developed with the
anti-GAPDH polyclonal antibody (Fig. 5A, lane 4). Negative
controls were obtained by incubating recombinant GAPDH in
the absence of the ECM proteins (Fig. 5B, lanes 1 to 3), as well
by incubating the recombinant molecule with just the second-
ary antibody (Fig. 5B, lane 4). The specificity of the binding of
GAPDH to the ECM proteins was also demonstrated by the
binding assay of the ECM components to BSA (Fig. 5C, lanes
1 to 3). No reactivity between BSA and the ECM proteins was
demonstrated. In addition, the polyclonal antibody to GAPDH
did not present cross-reactivity to BSA (Fig. 5C, lane 4).
The adhesin characteristic of GAPDH was also evaluated by
interaction of the recombinant protein with pneumocytes (Fig.
5D). The purified protein behaved as an adhesin, binding to
the pneumocytes (Fig. 5D, lane 1). Negative controls were
developed with the pneumocytes not incubated with the re-
combinant GAPDH (Fig. 5D, lane 2), as well as with the
recombinant protein added to the cell culture flask, in the
absence of the cell monolayer (Fig. 5D, lane 3).
Inhibition of P. brasiliensis infection of pneumocytes, caused
by recombinant GAPDH and by the polyclonal antibody anti-
GAPDH. The infection index was determined by interactions
FIG. 1. Expression and purification of recombinant GAPDH and generation of rabbit polyclonal antibody. (A) SDS-PAGE analysis of P.
brasiliensis recombinant GAPDH. E. coli cells harboring the TOPO-pET-100 GAPDH plasmid were grown at 37°C to an A600of 0.6 and harvested
before (lane 2) and after (lane 3) a 2-h incubation with 0.8 mM IPTG. The cells were lysed by extensive sonication. Lane 1, control E. coli cells;
lane 4, affinity-isolated GAPDH. SDS–12% PAGE was carried out, and the proteins were stained by Coomassie blue R-250. (B) Electrophoretic
analysis of P. brasiliensis proteins and recombinant GAPDH. The protein extracts were fractionated by one-dimensional gel electrophoresis and
stained by Coomassie blue. Lane 1, protein extracts from yeast cells (30 ?g); lane 2, protein extracts from mycelium (30 ?g); lane 3, recombinant
GAPDH (2.0 ?g). (C and D) Western blot analysis of native and recombinant GAPDH. The same samples as for panel B were run in parallel,
blotted onto a nitrocellulose membrane, and detected by using (C) rabbit polyclonal anti-recombinant GAPDH antibody or (D) rabbit preimmune
serum. After reactions with the anti-rabbit IgG alkaline phosphatase-coupled antibody (diluted 1:1,000), the reactions were developed with
BCIP-NBT. Molecular size markers are indicated.
FIG. 2. Two-dimensional gel electrophoresis of P. brasiliensis cell extracts. Cell extracts from yeast cells of P. brasiliensis were obtained, and 50
?g of total proteins was loaded on two-dimensional gels. (A) SDS-PAGE gel stained with silver. (B) Reactivity of the GAPDH isoforms analyzed
by Western blotting with the polyclonal antibody produced to the recombinant protein. Arrows point to the two characterized isoforms of GAPDH.
Numbers to the left of both figures refer to the molecular mass of the characterized GAPDH. At the top are indicated the isoelectric points of
both protein isoforms.
VOL. 74, 2006 GAPDH IS AN ADHESIN OF P. BRASILIENSIS385

Page 5

between P. brasiliensis yeast cells and A549 pneumocytes, as
shown in Fig. 6. P. brasiliensis yeast cells were treated with the
antibody anti-GAPDH prior to interaction with the pneumo-
cytes, or pneumocytes were treated with recombinant GAPDH
prior to the interaction with P. brasiliensis. The controls (non-
treated cells) were used to calculate the percentages of both
adhesion and infection inhibitions. When P. brasiliensis yeast
cells were incubated with the anti-GAPDH polyclonal anti-
body, a decrease of 63% in the adhesion index (P ? 0.05) was
observed to occur. Similarly, when the pneumocytes were
treated with recombinant GAPDH the adhesion index was
reduced by 68% (P ? 0.05) compared to the values of non-
treated cells (Fig. 6A). Additionally, the infection index was
decreased by 80% (P ? 0.0001) when P. brasiliensis yeast cells
were treated with the anti-GAPDH polyclonal antibody and by
97% (P ? 0.0001) when pneumocytes were treated with the
recombinant protein (Fig. 6B). Controls were performed by
incubating the pneumocytes with BSA prior to the addition of
yeast cells (Fig. 6A and B).
DISCUSSION
We have previously identified glycolytic enzymes as host-
interacting molecules of P. brasiliensis (3, 7, 13, 32). P. brasil-
iensis GAPDH, triose phosphate isomerase, and fructose 1,6-
FIG. 3. Immunoelectron microscopy detection of GAPDH in P. brasiliensis yeast cells. (A) Transmission electron microscopy of P. brasiliensis
yeast cells, showing the nucleus (n), intracytoplasmic vacuoles (v), and mitochondria (m). The plasma membrane (arrow) and cell wall (w) are also
shown. (B and C) Gold particles (arrowheads) are observed at the fungus cell wall (w) and in the cytoplasm (double arrowheads). (D) Negative
control exposed to the rabbit preimmune serum. Bars, 1 ?m (A), 0.5 ?m (B and D), and 0.2 ?m (C).
386 BARBOSA ET AL.INFECT. IMMUN.