Deletion of the Tetrahymena thermophila rDNA replication fork barrier region disrupts macronuclear rDNA excision and creates a fragile site in the micronuclear genome.

Abstract

During macronuclear development the Tetrahymena thermophila ribosomal RNA gene is excised from micronuclear chromosome 1 by site-specific cleavage at chromosome breakage sequence (Cbs) elements, rearranged into a 'palindromic' 21 kb minichromosome and extensively amplified. Gene amplification initiates from origins in the 5' non-transcribed spacer, and forks moving toward the center of the palindrome arrest at a developmentally regulated replication fork barrier (RFB). The RFB is inactive during vegetative cell divisions, suggesting a role in the formation or amplification of macronuclear rDNA. Using micronuclear (germline) transformation, we show that the RFB region facilitates Cbs-mediated excision. Deletion of the RFB inhibits chromosome breakage in a sub-population of developing macronuclei and promotes alternative processing by a Cbs-independent mechanism. Remarkably, the RFB region prevents spontaneous breakage of chromosome 1 in the diploid micronucleus. Strains heterozygous for DeltaRFB and wild-type rDNA lose the DeltaRFB allele and distal left arm of chromosome 1 during vegetative propagation. The wild-type chromosome is subsequently fragmented near the rDNA locus, and both homologs are progressively eroded, suggesting that broken micronuclear chromosomes are not 'healed' by telomerase. Deletion of this 363 bp segment effectively creates a fragile site in the micronuclear genome, providing the first evidence for a non-telomere cis-acting determinant that functions to maintain the structural integrity of a mitotic eukaryotic chromosome.

Full text

Page 1

Deletion of the Tetrahymena thermophila rDNA
replication fork barrier region disrupts
macronuclear rDNA excision and creates a
fragile site in the micronuclear genome
J. S. Yakisich and G. M. Kapler*
Department of Molecular and Cellular Medicine, Texas A&M University System Health Science Center,
College Station, TX 77843-1114, USA
Received November 15, 2005; Revised and Accepted January 9, 2006
ABSTRACT
During macronuclear development the Tetrahymena
thermophila ribosomal RNA gene is excised from
micronuclear chromosome 1 by site-specific cleav-
age at chromosome breakage sequence
elements, rearranged into a ‘palindromic’ 21 kb mini-
chromosomeandextensively
amplification initiates from origins in the 50non-
transcribed spacer, and forks moving toward the
center of the palindrome arrest at a developmentally
regulated replication fork barrier (RFB). The RFB is
inactive during vegetative cell divisions, suggesting
a role in the formation or amplification of macro-
nuclear rDNA. Using micronuclear (germline) trans-
formation, we show that the RFB region facilitates
Cbs-mediated excision. Deletion of the RFB inhi-
bits chromosome breakage in a sub-population of
developing macronuclei and promotes alternative
processing bya Cbs-independent
Remarkably, the RFB region prevents spontaneous
breakage of chromosome 1 in the diploid micronu-
cleus. Strains heterozygous for DRFB and wild-type
rDNA lose the DRFB allele and distal left arm of
chromosome 1 during vegetative propagation. The
wild-type chromosome is subsequently fragmented
near the rDNA locus, and both homologs are pro-
gressively eroded, suggesting that broken micronu-
clear chromosomes are not ‘healed’ by telomerase.
Deletion of this 363 bp segment effectively creates
a fragile site in the micronuclear genome, provid-
ing the first evidence for a non-telomere cis-acting
determinant that functions to maintain the structural
integrity of a mitotic eukaryotic chromosome.
(Cbs)
amplified.Gene
mechanism.
INTRODUCTION
The initiation of DNA replication is precisely regulated to
assure that chromosomes are duplicated once and only once
per cell division. Eukaryotic genomes contain hundreds to
thousands of initiation sites that are relatively evenly spaced
throughout chromosomes(1). Theconvergenceofneighboring
replication forks allows for the complete replication of chro-
mosomes. Elongating replication forks can stall when they
encounter DNA damage atrandom sites in the genome. Stalled
forks are recognized by the ATR (Ataxia-Telangectasia and
Rad3-related) kinase, which activates a checkpoint pathway
that prevents the fork from collapsing and initiates the DNA
repair response [reviewed in (2)]. Replication forks can also
arrest at specified sites in the genome. Transient pausing of
replication forks frequently occurs near coding regions and
may help coordinate replication and transcription. Similar
to sites of DNA damage, the paused replication machinery
resumes DNA synthesis once the impediment has been
removed. More pronounced replication fork barriers (RFBs)
irreversibly block the movement of the replication fork, and
require the activity of a converging fork to replicate sequences
downstream of the RFB [reviewed in (3)].
Natural RFBs occur in both prokaryotes and eukaryotes,
and have been shown to coordinate certain events with
DNA replication. For example, unidirectional RFBs allow
converging forks to enter, but not exit the replication terminus
of circular bacterial chromosomes (3,4). RFBs in the inter-
genic regions of tandemly arrayed ribosomal RNA genes
prevent head on collisions between the replication and tran-
scription machinery (5–7). The contributions of RFBs to
chromosome function are offset by the fact that they create
hot spots for programmed or spontaneous genome rearrange-
ment. For example, mating type switching in the fission yeast
Schizosaccharomyces pombe requires that the mat locus be
replicated from forks progressing in one direction (2,8). The
Saccharomyces cerevisiae ribosomal DNA RFB promotes the
*To whom correspondence should be addressed. Tel: +1 979 847 8690; Fax: +1 979 847 9481; Email: gkapler@tamu.edu
? The Author 2006. Published by Oxford University Press. All rights reserved.
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access
version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press
areattributedastheoriginalplaceofpublicationwiththecorrectcitationdetailsgiven;ifanarticleissubsequentlyreproducedordisseminatednotinitsentiretybut
only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org
620–634
doi:10.1093/nar/gkj466
Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 2

excision of monomeric rDNA circles from head-to-tail tandem
gene arrays, as well as spontaneous chromosome fragmen-
tation (2,9–11). In addition to generating circular episomes,
RFBs in S.cerevisiae rDNA arrays are susceptible to double-
strand breaks (DSBs) in several mutant backgrounds, and
specialized proteins help minimize the deleterious effects of
RFBs (2,9–11).
Similar to yeast and metazoa, non-coding regions in
Tetrahymena thermophila ribosomal RNA genes contain
sequences that impede replication fork movement. Replication
forks transiently pause at three conserved sequences in the
1.9 kb 50non-transcribed spacer (50NTS) during vegetative
cell divisions (Figure 1A; PSE1, PSE2 and PSE3), and at a
strong RFB during development (12,13). The role of fork
arrest determinants in Tetrahymena rDNA must differ from
those in yeast and metazoan rDNAs for two reasons. First,
instead of being arranged in large head-to-tail arrays, the
Tetrahymena rRNA genes reside in natural minichromo-
somes that contain just two gene copies in an inverted,
repeated head-to-head configuration (Figure 1A). Since rep-
lication and transcription proceed in the same direction, head
on collisions between the respective DNA and RNA poly-
merases cannot occur. Replication forks moving toward the
Tetrahymena rDNA telomere transiently arrest at conserved
pause site elements (PSEs), possibly coordinating replication
and transcription during vegetative cell divisions. Second, the
Tetrahymena RFB is developmentally regulated, and is only
active during the formation of a new macronucleus, when
palindromic rDNA minichromosomes are first generated
and amplified. rDNA processing and amplification initiate
before the onset of transcription of the new macronucleus,
and the RFB is silent during vegetative cell divisions. These
observations suggest a role for the RFB in the biogenesis
and/or amplification of extrachromosomal rDNA.
Tetrahymena thermophila, like all ciliated protozoa,
separates its germline and somatic functions into two genet-
ically related, but distinct compartments—the micronucleus
and macronucleus [reviewed in (14)]. The diploid micronu-
cleus is not transcribed throughout most of the life cycle and
serves as the source of genetic information that is transferred
during conjugation. In contrast, the polyploid macronucleus
is actively transcribed, but is not sexually transmitted. The
micronucleus contains five chromosomes that segregate by
conventional mitosis and meiosis, and produces haploid pro-
nuclei for genetic exchange. Following pronuclear exchange,
a new macronucleus forms through the differentiation of a
duplicated progeny micronucleus. The genome is subjected
to extensive rearrangement at this time, including fragmenta-
tion at ?300 specific sites, generating acentric chromosomes
that endo-replicate to ?45 copies.
The 35S ribosomal RNA gene, encoding the 17S, 5.8S
and 26S rRNAs, exists as a single integrated copy in micronu-
clear chromosome 1. During macronuclear development, this
10.3 kb segment is excised from the parental chromosome
by site-specific cleavage at conserved 15 bp chromosome
breakage sequence (Cbs) elements that flank both ends of
the macronuclear-destined rDNA segment (15,16). The
excised rDNA monomer is then rearranged into a 21 kb
inverted repeat, termed the rDNA palindrome, through homo-
logous recombination within a small inverted repeat at
the beginning of the 50NTS (17,18). Telomeres are added
de novo and the rDNA is amplified to ?9000 copies in a
single S phase (19,20). Once development is complete, cell
cycle control is re-established and the rDNA is replicated
once (on average) per cell division (19,20). rDNA monomers
of 11 kb are also generated during development, but typica-
lly do not persist during prolonged vegetative propagation.
Here we examine the role of the developmentally pro-
grammed RFB region in macronuclear rDNA biogenesis
and amplification by introducing an RFB deletion derivative
into the germline micronucleus of Tetrahymena and follow-
ing the fate of rDNA minichromosomes in progeny cells. We
describe a role for the RFB in the formation of macronuclear
rDNA minichromosomes and an unanticipated requirement
for these sequences in the germline micronucleus.
MATERIALS AND METHODS
rDNA vectors and germline transformation
The rDNA plasmid AN101 carries a wild-type copy of the
micronuclear C3 rDNA locus, and undergoes Cbs-mediated
excision and palindrome formation in the developing macro-
nucleus (21). The C3 rDNA origin confers a replication
advantage over endogenous B rDNA during vegetative cell
divisions (22). Plasmid pC3DRFB contains a C3 rDNA origin
in which a 363 bp fragment corresponding to the RFB region
was deleted (positions 131–494; C3DRFB). Plasmid pTTMN1
is a neomycin phosphotransferase co-transformation vector
that confers resistance to paromomycin (pmr) upon induction
of the upstream metallothionein promoter (MTT1) with
cadmium (23). For germline transformation of Tetrahymena,
5 mg of each plasmid was digested with restriction enzymes
to release the insert fragment for targeted homologous
recombination to the rDNA or MTT1 locus, respectively
(AN101:SalI, pC3DRFB:KpnI + SalI, pTTMN1:KpnI + SstI).
Vegetative cultures of the wild-type T.thermophila strains
were propagated at 30?C in 2% protease peptone sup-
plemented with 10 mM FeCl3(PPYS) and PSF (penicillin
250 mg/ml, streptomycin 250 mg/ml, amphotericin B
25 mg/ml) (24). Tetrahymena strains used in this study are
listed in Table 1. For conjugant germline transformation,
log-phase cultures of strains CU427 and CU428 were har-
vested and starved in Tris-buffer (10 mM Tris–HCl,
pH 7.4 + PSF) for 18 h at 30?C, at a density of 2.5 · 105
cells/ml. To induce conjugation, equal numbers of each
strain were mixed and incubated at 30?C without shaking.
The germline micronucleus was then co-transformed by
biolistic bombardment at4 h 50 min,using the DuPontBiolistic
PDS-1000/He particle delivery system (Bio-Rad). PPYS (final
concentration 1.8%) and cadmium chloride (1.2 mg/ml) were
added to the culture 20–22 h after bombardment (25,26). Paro-
momycin (pm, 60 mg/ml) was added 5–6 h later and cells were
plated in 96-well microtiter plates. Pmrprogeny were typically
observed within 3 days. To assure that transformants were
clonal, single cells were isolated from each transformant and
re-screened for micronuclear C3 rDNA by PCR (see below).
Standard genetic and A* crosses
Mating of heterozygous germline C3DRFB/B rDNA trans-
formant strains to one another or to wild-type tester strains
were performed as described above. Clonal transformant lines
Nucleic Acids Research, 2006, Vol. 34, No. 2 621

Page 3

Figure 1. rDNA processing pathway.(A) Organization of the rDNA in the micro-and macronucleus. The gene encoding the 35Sprecursor RNA for 17S, 5.8S and
26SribosomalRNAs,existsasasingle‘integrated’copyinmicronuclearchromosome1.Macronuclear-destinedrDNAsequencesareexcisedfromthischromosome
in the newly developing macronucleus by cleavage at flanking Cbs elements. The released rDNA monomer is subsequently rearranged into a giant head-to-head
‘palindrome’withtwoinvertedcopiesofthe50NTSatthecenterandtelomeresateachterminus(hatchedverticallines).The1.9kb50NTS(bottompanel)contains
positioned nucleosomes that bracket the rRNA promoter and replication initiation sites, the later of which reside within the tandemly reiterated Domain 1 and
2 (D1, D2) regions. These nucleosome-free regions contain conserved cis-acting determinants that regulate replication initiation and fork progression, designated
PSEs (PSE1, 2 and 3; vertical black boxes) and type 1 elements (1A–1D; vertical grey boxes). The approximate position of the developmentally regulated RFB is
shown. (B) Polymorphisms for micronuclearrDNA alleleanalysis. Top and lower left panels: enlargementofthe micronuclear chromosome1 region designated as
‘X’inpanelA(topline),showingtheRFBregionanda42bpsequencethatispresentinwild-typeC3andC3DRFBalleles,butisabsentinthenaturallyoccurringB
rDNA allele. The positions of PCR primers that anneal to the respective rDNA species are shown (arrows), along with the predicted sizes of PCR products (table).
Primers 15F and 15R span the 30Cbs element and amplify the micronuclear rDNA species for all three alleles. Lower right panel: PCR analysis of micronuclear
rDNAinwild-typeC3(SB1934)andwild-typeB(CU427)rDNAstrains,andheterozygousmicronucleartransformantsharboringtheC3DRFBandBrDNAalleles
(TX607, TX610 and TX611).
622 Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 4

were also mated to functionally amicronucleate A* strains
(mating types III or V) (27). Progeny from the first round
of conjugation contain DNA from just the transformant par-
ental strain in their new micronucleus and are homozygous
at all loci. Since a new macronucleus is not generated at
this time, these cells can immediately pair with one another
(round 2 genomic exclusion). These progeny will generate a
new micronucleus and macronucleus, and consequently will
be sexually immature (i.e. unable to form mating pairs for
at least 70 fissions). Single pairs from Round 2 matings
were isolated between 23 and 25 h post-mating, transferred
to 100 ml fresh 2% PPYS and propagated for 3–5 days. Cells
were then screened for pm-sensitivity, sexual immaturity and
the presence of the C3DRFB allele in progeny micronucleus,
using C3-specific PCR primers. This protocol resulted in the
generation of new rDNA minichromosomes during macro-
nuclear development and also ensured that new progeny
strains were of clonal origin.
PCR amplification and Southern blotting
The complete macronuclear rDNA sequence (28,29) and
flanking micronuclear DNA sequence upstream of the
rDNA locus (30,31) were used to generate restriction maps
and design PCR primers for distinguishing the various rDNA
alleles (wild-type C3, C3DRFB and wild-type B). Additional
flanking sequences were obtained from the Tetrahymena
thermophila genome database (TIGR, http://www.tigr.org/).
PCR primer sets that were used to monitor the fate of different
arms of the five micronuclear chromosomes were kindly pro-
vided by Drs Eileen Hamilton and Eduardo Orias (32,33).
These primer sets encompass sequences that are joined in
the micronuclear genome, but are absent or separated in
the macronucleus by Cbs-mediated chromosome fragmenta-
tion. Genomic DNA isolation and Southern blotting were
performed as previously described (34). Probes A and B
(Figure 1) were generated by PCR using primers 7 + 8 and
5 + 6, respectively, and were radiolabeled with [a-32P]dATP,
using the MegaprimeTMDNA labeling system (Amersham
Life Sciences) according to manufacturer instructions, except
that specific primers were used in place of random primers.
For pulsed field gel electrophoresis (PFGE), undigested total
genomic was electrophoresed on a BioRad CHEFII apparatus
on 1% agarose gels in 0.5· TBE buffer (14?C) at 6 V/cm
for 20–24 h (initial pulse time ¼ 0.5 s, final pulse time ¼ 3 s).
Fluorescence microscopy
For apofluor staining, a 0.1 ml sample of the conjugating
cells was concurrently stained with 0.001% acridine orange
and 5 mg/ml Hoechst 33342 (Sigma). After mixing briefly,
the stained cells were fixed with 1% formaldehyde (final
concentration) and observed immediately with fluorescence
microscopy using filters for blue fluorescence as previously
described. This combination of dyes allows for the detection
of DNA and can be used to evaluate the acidification of
non-exchanged pronuclei and the old macronucleus (an
indicator of programmed nuclear death during development)
(35,36).
RESULTS
Isolation of micronuclear rDNA fork barrier
deletion mutants
Since the Tetrahymena rDNA RFB is only active in the
macronucleus during macronuclear development, we set out
to determine whether this region facilitates site-specific
rDNA excision, rearrangement (palindrome formation) or
amplification of rDNA minichromosomes. To assess the
role of the RFB, we introduced a C3 rDNA derivative that
was deleted for this region into the germline micronucleus of
mating B rDNA strains and examined the fate of the mutant
C3 allele in the newly formed macronucleus. All known
determinants for rDNA excision and palindrome formation
were present in the transforming rDNA fragment (Cbs ele-
ments and the M element inverted repeat) (16,17). The trans-
genic C3 rDNA derivative contained a 42 bp sequence
proximal to the Domain 2 replication origin that confer
a replication advantage over endogenous macronuclear B
rDNA during vegetative cell divisions (22). The C3 allele
also harbored a point mutation within the 17S rRNA coding
region that confers resistance to paromomycin. Homolog-
ous recombination should result the replacement of one
B rDNA allele in the diploid micronucleus of transformed
progeny.
It was not clear whether the C3DRFB allele would generate
a functional macronuclear chromosome. Consequently, we
co-transformed the C3DRFB construct with a second linear
DNA fragment encoding the neomycin phosphotransferase
gene under the control of an inducible metallothionein
(MTT1) promoter (neophosphotransferase inactivates pm).
Pm-resistant transformants were selected and subjected to
allele-specific PCR to identify co-transformants that were
heterozygous for the C3DRFB and wild-type B rDNA
alleles in the germline micronucleus (Figure 1B). Three co-
transformants were identified (TX607, TX610, TX611), and
single cells were isolated and expanded to assure that each
strain was of clonal origin. Heterozygous C3DRFB/B rDNA
strains were obtained from three independent transforma-
tions, and 18 clonal lines derived from strains TX607,
TX610 and TX611 were propagated vegetatively and sub-
jected to detailed molecular analysis. As a control, mating
B rDNA strains were transformed with a wild-type C3
rDNA fragment and a germline transformant (TX614)
was identified by RFLP analysis of the macronuclear DNA
and micronuclear PCR analysis (data not shown). Table 1
Table 1. Tetrahymena strains used in this study
StrainMic Macpm-phenotype
CU427
CU428
SB1934
SB210
SF137
A* III
A* V
TX607
TX610
TX611
TX614
B
B
C3
B
C3
–
–
B/C3DRFB
B/C3DRFB
B/C3DRFB
B/C3
B
B
B
B
C3
B
B
?
?
?
C3
S
S
S
S
S
S
S
R
R
R
R
S, sensitive; R, resistant; pm, paromomycin.
Nucleic Acids Research, 2006, Vol. 34, No. 2623

Page 5

summarizes the relevant micronuclear genotypes and macro-
nuclear phenotypes of wild-type and mutant strains used in
this study.
The RFB region is required for proper excision
of the rDNA
Since conjugating germline transformants go on to generate a
new progeny macronucleus, we examined the fate of macro-
nuclear rDNA minichromosomes in heterozygous progeny.
Total genomic DNA was isolated from C3DRFB/B and
wild-type C3/B heterozygotes, and homozygous wild-type
C3 or B rDNA strains, and digested with EcoRV to distinguish
between palindromic (P) and non-palindromic (NP) forms of
each macronuclear rDNA species (Figure 2A, schematic; WT:
wild-type C3 or B rDNA, DRFB: C3DRFB rDNA). Southern
blot analysis was performed with a PCR-generated probe
that was common to each predicted macronucleus rDNA
species (Figure 2A, probe B). Macronuclear B (CU428) and
C3 rDNA (TX614: wild-type C3 transformant) strains pro-
duced a strong 4.4 kb band corresponding to the central
fragment of palindromic rDNA minichromosomes (P), and
a weaker ?2.2 kb band corresponding to monomeric (non-
palindromic, NP) rDNA minichromosomes that are transiently
observed in newly formed progeny (Figure 2B, left panel,
lanes 1 and 5) (37).
EcoRV digestion of the C3DRFB allele should generate a
3.6 kb palindromic fragment and 1.8 kb monomeric fragment
Figure 2. Heterozygous C3DRFB/B strains undergo stochastic excision of the rDNA in the developing macronucleus. (A) Restriction map and fragment sizes for
products following digestion with EcoRV (downward arrowheads) or XbaI (upward arrowheads) for micronuclear rDNA locus (Mic), excised non-palindromic
macronuclearrDNA(NP)andpalindromic(P)rDNAminichromosomesderivedfromwild-typeBrDNA(WT)orC3DRFBdeletionalleles.HybridizationprobesA
and B: thick black lines in micronuclear rDNA diagram. (B) Stochastic appearance and structure of macronuclear C3 rDNA in clonal C3DRFB transformants.
Left panel: Southern blot analysis of EcoRV digested genomic DNA with probe B. Wild-type B rDNA strain; CU428, heterozygous C3DRFB/B germline
transformant strains; TX607(1), TX610(11) and TX611(1), and wild-type C3 rDNA transformant strain; TX614(1). The position of wild-type B and wild-type
C3rDNAmonomers(WTnon-pal)andpalindromes(WTpal),predictedC3DRFBspecies(DRFBpal,DRFBnon-pal),andunexpectedproducts(C3-longandX)are
indicated. The corresponding restriction fragments for expected products are symbol coded (see panel A). TX611(C1) and TX611(C3) are clonal progeny derived
from a cross between TX611(1) and amicronucleate strains A* III and A* V, respectively, and have generated a new macronucleus by round II genomic exclusion
(see text). Note the presence of the C3DRFB rDNA palindrome in TX611(C1) and absence of this species in its parent, TX611(1). Right panel: Southern blot
analysis of genomic DNA with probe B from mating progeny harvested 24 h after mixing strains of oppositemating type. Crosses: TX611(C1) or TX611(C3) were
matedwithtesterstrains,CU427(wildBrDNAinmicronucleus)orSB1934(wild-typeC3rDNAinmicronucleus).Controlmating:CU427 · SB1934.Xindicates
rDNA species that were not predicted by conventional processing at the Cbs element upstream of the rDNA 50NTS. (C) The C3-long rDNA species is fragmented
at a novel site upstream of the 50Cbs element. Southernblot of XbaI digested genomic DNA hybridized with probe B (left) or probe A (right).Numbers correspond
to clonal lines established from each heterozygous C3DRFB/B rDNA germline transformant.
624 Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 6

if the mutant allele was correctly excised in the developing
macronucleus (Figure 2A). Both species were detected in
just one of the three C3DRFB transformant strains, for
which no macronuclear B rDNA was observed [Figure 2B,
left panel, lane 2: TX607(1)]. This result is consistent with
the rapid loss of macronuclear B rDNA during vegetative
propagation of C3/B rDNA heterozygotes (22), and suggests
that properly processed C3DRFB minichromosomes are
fully competent for vegetative DNA replication. In contrast,
C3DRFB strain TX610 contained just wild-type B rDNA
in its macronucleus, while TX611 contained B rDNA and
a novel ?5.5 kb species, hereafter designated ‘C3-long’
(Figure 2B, left panel, lanes 3 and 4; see below for more
detailed analysis). The macronuclear composition of TX610
(B rDNA only) is indicative of failed excision of the C3DRFB
allele, while the unexpected ?5.5 kb EcoRV fragment in
TX611 is consistent with alternative DNA processing. The
collective results show that the RFB region promotes rDNA
excision, but functions stochastically in the developing
macronucleus.
To examine the fate of macronuclear rDNA during
vegetative cell divisions, clonal lines were propagated for
?70 fissions. DNA samples were digested with XbaI to
monitor the fate of macronuclear C3 and B rDNA minichro-
mosomes (Figure 2A micronuclear rDNA schematic), and
to further examine the structure of unexpected rDNA species.
Consistent with the results from earlier fissions, only C3DRFB
palindromes were detected in TX607 (696 bp). No palin-
dromic C3 rDNA minichromosomes were observed in
TX610 at 70 fissions (Figure 2C). Instead, only B rDNA
palindromes (1440 bp) were observed, along with a fragment
common to both rDNA alleles (B/C3; 432 bp). No variation
was detected between clonal TX607 and TX610 lines. In con-
trast, while all five TX611 clones retained the C3-long rDNA
species, three clones contained palindromic B rDNA as well.
Thus, the vegetative C3 rDNA replication advantage (22) is
somewhat compromised in C3-long minichromosomes.
The novel XbaI fragment detected with probe B in TX611
was smaller than the B rDNA palindrome rather than larger
(Figure 2C), while the relative size of EcoRV C3 and B rDNA
products was reversed (Figure 2B). This observation sug-
gested that the new rDNA species contained sequences
upstream of the first XbaI site adjacent to the rDNA 50
NTS (Figure 2A, micronuclear rDNA schematic, ?905 bp).
Southern blot hybridization with the micronuclear-limited
rDNA probe A confirmed this prediction (Figure 2A, micro-
nuclear rDNA schematic; Figure 2C, right panel). We con-
clude that this new rDNA species was produced by aberrant
rDNA processing, and propose that the RFB facilitates the
proper excision of the rDNA from its parental chromosome.
PFGE was used to examine the size and organization of
the novel rDNA species in TX611. Southern blot analysis of
undigested DNA revealed that the C3-long minichromosome
is ?2 kb larger than the 21 kb wild-type palindrome
(Figure 3A). To determine if this molecule is palindromic
(Figure 3B, schematic), genomic DNA was digested with
NcoI or MluI. The rDNA contains a single site for each
enzyme, and there are no sites in the 30 kb interval upstream
of the rDNA locus (E. Orias, personal communication).
Hybridization with a 50NTS probe detected a 7.3 kb NcoI
fragment and 6.4 kb MluI fragment in TX611 DNA samples
(Figure 3C, lanes 5 and 6), consistent with the expectations
for palindromic C3DRFB minichromosomes (Figure 3C, see
table for expected fragment lengths). The size of the C3DRFB
fragments relative to wild-type controls indicated that mutant
rDNA contains an additional 1.6 kb segment.
Taking into account the size of the DRFB deletion (0.37 kb),
the upstream rearrangement site would be ?1.2 kb upstream
of the normal Cbs fragmentation site if the additional
C3-long sequences had rearranged into a palindrome
(Figure 3B, giant palindrome/palindromic center). The size
of the ?5.5 kb band detected in EcoRV digested genomic
DNA (Figure 2B) is also consistent with a palindromic organ-
ization. This band contains the ?2 kb palindromic center
(micronuclear sequences) and is flanked by ?1.8 kb (2172–
363 bp) (see also Figure 3). Alternatively, the breakpoint
would be ?2.0 kb upstream of the normal excision site if
the additional segment was not rearranged (Figure 3B, giant
palindrome/non-palindromic center). XbaI digestion was used
to distinguish between these possibilities. A single 1.3 kb
species was detected with probe A (Figure 2C). The additional
1.7 kb product that would be detected with probe B for a
non-palindromic center was not observed. Thus, the additional
sequences at the center of C3-long have a palindromic
configuration.
Examination of the DNA sequence around the predicted
C3-long fragmentation site revealed two segments of partial
homology with the Cbs consensus: 50-WAAACCAACCT-
CWTW (where W stands for A or T) (Table 2) (33). The distal
homology at position ?1488 (50-GAAGAGATTTGTTTA,
reverse complement 50-TAAACAAATCTCTTC) contains
three positions that deviate from the consensus (underlined
bases), two of which render the Cbs non-functional when
placed in competition with an adjacent wild-type element
(38).The proximal Cbs homology at position ?1075 (forward:
50-TATGAGTTGTTTTT,reverse complement: 50-AAAAAC-
AAACTCATA) includes two mismatches with the consensus,
one of which is known to ablate function. Wild-type palin-
dromes are formed by intramolecular recombination involv-
ing inverted, repeated 42 bp segments (M elements) that are
separated by a 29 bp non-palindromic spacer (18). Therefore,
we used the M-fold algorithm to look for inverted repeats.
Several short repeats were found, 10–12 bp in length, in the
proposed region for C3-long palindrome formation (spann-
ing nucleotide positions ?1167 to ?1030) (Table 2). The
tight clustering of three inverted repeats raises the possibility
that these sequences act concertedly to promote homologous
recombination. We propose that the RFB deletion deriva-
tive is fragmented in the vicinity of the clustered inverted
repeats, and that these sequences direct the rearrangement
of monomeric rDNA into a giant palindrome analogous
to endogenous rDNA. Alternatively, chromosome 1 may be
broken at one or more sites further upstream and eroded to
expose sequences that promote palindrome formation.
Alternative chromosome fragmentation in rDNA
replication fork barrier deletion mutants
The stochastic rDNA excision defect associated with the RFB
deletion allele precluded us from assessing whether this
segment plays a direct role in rDNA gene amplification.
For example, population analysis of mass matings involving
Nucleic Acids Research, 2006, Vol. 34, No. 2625

Page 7

germline DRFB transformant strains would not be informative
if two sub-populations were present, one that failed to excise
the DRFB rDNA allele and another that excised the rDNA
at normal or alternative site(s). Additional genetic crosses
allowed us to verify the role of the RFB region in rDNA
excision and gain further insight into alternative process-
ing pathways. We were particularly interested in determining
whether normal C3DRFB palindromes could be produced
from the C3-long mutant, and whether the aberrant rDNA
excision site detected in TX611 was preferentially utilized
in subsequent generations.
To this end, we first mated TX611 with A* strains (mating
type III or V) to generate new progeny that could be mated
to one another and to various tester strains. A* strains lack a
functional micronucleus and induce an alternative develop-
mental program, termed genomic exclusion, in which the
parental macronucleus is retained and the progeny micro-
nucleus becomes homozygous at all loci (27). Since no new
macronucleus is created, exconjugants are sexually mature
(round 1 genomic exclusion) and can re-mate with other
cells in the culture. For reasons that are unclear, none of
the clonal lines established after the first round of mating
contained the genotype predicted for the products of round
Figure 3. The macronuclear rDNA species, C3-long, is a giant head-to-head inverted repeat with a palindromic central region. (A) Pulse field gel analysis of
undigested total genomic DNA from wild-type (CU428) and ‘C3-long’ DRFB [TX611(1)] strains hybridized with probe B. (B) Restriction maps for three possible
‘C3-long’ macronuclear rDNA configurations: giant inverted repeat with a palindromic center (top), giant inverted repeat with a non-palindromic center (middle)
and giant monomer (bottom). Black lines: macronuclear-destined 50NTS sequences in wild-type minichromosomes; open lines: upstream sequences that are not
associated with wild-type macronuclear rDNA. The enlarged central region in the rDNA palindrome maps exhibit the position of XbaI sites (vertical arrows)
and predicted restriction fragments that would be detected with probes A or B for molecules with palindromic or non-palindromic central cores. The black oval
corresponds to the axis of symmetry for the species with a palindromic center. Note that probe B spans the XbaI site in the normal 50NTS. (C) Southern blot
hybridization of uncut (U), MluI (M) or NcoI (N) digested DNA with probe B. Note: The apparent slower migration of uncut wild-type control DNA is a gel
electrophoresis artifact (‘smiling’). The table shows the expected fragment sizes for monomeric (non-pal) and palindromic C3-long species. (D) Southern blot
hybridizationofXbaI-digestedDNAwithprobesAandB(seepanelBmapforpredictedproductsizesformoleculeswithpalindromicornon-palindromiccenters).
Table 2. DNA sequences proximal to the C3-long 50rDNA processing site
CBS Consensus
–1488 (rev comp)
–1075 (forward)
(W= A or T)
5’-WAAACCAACCTCWTW
5’-TAAACAAATCTCTTC
5’-AAAAACAAACTCATA
INVERTED REPEATS (–1167 TO –1030)
CTCAGATTTCATTTTTCAAGGTGAATATATGAGGCATA
TTCAAGTATTTGATATGAAAAAAAGTAAAAAGTCTAAG
TCTCGCTAACAGCAAATATGAGTTTGTTTTTGCTTTGA
TTTTAATAAATACAAAATAACAAA
626 Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 8

1 genomic exclusion. One possible explanation is that a
significant fraction of TX611 cells had lost one or more essen-
tial genes from their micronucleus during the vegetative cell
divisions required to achieve sexual maturity (minimum of
70 fissions).
To overcome this problem, conjugating TX611 · A* cells
were allowed to go through two rounds of mating, the later
of which essentially functions as a selfing cross. Paired cells
were isolated at 24 h (in all likelihood round 2 mating pairs)
and several clonal lines were established. The sexual imma-
turity of these strains indicated that they had generated a
new macronucleus. Southern blot analysis revealed that the
C3-long rDNA species was regenerated in the two examined
strains, [TX611(C1) and TX611(C3) (Figure 2B, left panel,
lanes 6 and 7)]. Furthermore, C3DRFB palindromes were
detected in the TX611(C1) macronucleus. The reappearance
of C3-long rDNA in both strains indicates that the alternative
processing site is preferentially utilized. The formation of
C3DRFB palindromes in TX611(C1) demonstrates that the
TX611 germline deletion allele can undergo normal excision
and palindrome formation. It also implies that rDNA excision
occurs after cells have replicated micronuclear chromosome 1
to at least a 4C content (two C3DRFB and two B rDNA alleles)
(39,40).
TX611(C1) and TX611(C3) were grown to sexual maturity
and mated with tester strains CU427 (wild-type B rDNA) and
SB1934 (wild-type C3 rDNA). DNA was harvested from
mass matings late in macronuclear development to assess
macronuclear rDNA composition prior to the selection for
rDNA fitness during vegetative cell divisions. Since the pair
efficiency was 70–80%, most of the rDNA detected by South-
ern blotting was derived from progeny cells. The C3DRFB
long rDNA species was abundantly represented in all four
matings (Figure 2B, right panel, lanes 1–4). Two of the
four matings also generated palindromic DRFB molecules
(lanes 1 and 2), as well as fainter bands (designated X) that
appear to result from fragmentation at new sites. Palin-
dromic C3DRFB molecules were noticeably absent in the
other two mating cell populations. Instead, the larger of
the two new rDNA species was much more abundant
(Figure 2B, right panel, lanes 3 and 4). We conclude that
the C3DRFB allele is fragmented at a limited number of
new sites, and that these events take place during macronu-
clear development.
The C3DRFB allele destabilizes chromosome 1 in the
germline micronucleus
Our initial PCR screen of clonal transformant lines identi-
fied strains that were heterozygous for the C3DRFB and B
rDNA alleles in the germline micronucleus (Figure 1B).
Unexpectedly, micronuclear genotyping at ?10 passages
(?70 fissions) revealed that the C3DRFB allele was lost
from the micronucleus in a substantial fraction of these clones
[Figure 4, early passages (C3 rDNA: primers 2 + 36); TX610
7/13 clones; TX611 6/12 clones; see Figure 1B for primer
positions]. This observation suggested that the original clonal
population became heterogeneous over time, consisting of
cells that had either lost or retained the C3 rDNA allele in
the germline micronucleus. Continued cultivation for 10 more
passages (>150 fissions) revealed the loss of the C3DRFB
allele in additional clonal lines (Figure 4, late passages,
TX607 1/6 additional clones; TX610: 5/6 additional clones).
While not quantitative, PCR analysis indicated that the
product derived from the B rDNA allele was diminished
and more variable in intensity at the later passages
(Figure 4, B rDNA: primers 2+ 23). In contrast to C3DRFB
clones,the wild-typeC3rDNA transformant showed no appar-
ent loss of C3 or B rDNA alleles in the germline micronucleus
(Figure 4, TX614).
To explore the possibility that the micronuclear B rDNA
allele was being deleted in heterozygous B/C3DRFB mutants,
15 subclones of TX607(3) were established and screened for
micronuclear C3DRFB and B rDNA. All of these lines had
lost the germline C3DRFB rDNA copy, while the subclone 15
was missing the B rDNA allele as well [Figure 5A, C3DRFB
(primers 2 + 36) and B rDNA (primers 2 + 23)]. PCR analysis
with primers that span the Cbs element at the 30end of the
rDNA (Figure 1A, primers 15F + 15R) revealed that the
entire rDNA locus was absent from the micronucleus of
line 15 (Figure 5A). Additional primer sets derived from
the left and right arms of each micronuclear chromosome
(1–5L, 1–5R) yielded products in wild-type and mutants
strains, with the exception of primer set 1L, which spans a
Cbs fragmentation site distal to the rDNA locus on chromo-
some 1L (32,33). A robust product was obtained with wild-
type DNA, but no signal was detected for TX607(3) subclone
15 (Figure 5B). These results are inconsistent with a local
breakage and re-joining event. Instead, they suggest that
chromosome 1 was fragmented such that the entire 1L arm
distal to the rDNA was lost in this subclone.
The chromosome 1L and 1R arms are unstable during
vegetative propagation of the C3DRFB mutant strain
TX607(3) subclone 15
The loss of B and C3 rDNA alleles from micronuclear chro-
mosome 1 allowed us to assess whether these chromosome
1 derivatives were stable or subjected to further erosion or
rearrangement during vegetative cell divisions. To examine
these possibilities, TX607(3) subclone 15 was continually
propagated and DNA was isolated at defined intervals:
early (E, ?70 fissions), late 1 (L1, ?150 fissions) and late
2 (L2, ?250 fissions). PCR analysis with primer sets that span
different Cbs elements in the micronuclear chromosome 1L
arm (Figure 5C, schematic), revealed the progressive loss
of 1L DNA within the entire cell population. For example,
primer sets 1L7 and 1L14 (distal and proximal to the rDNA,
respectively) failed to generate PCR products at both the
early and late 1 time points (Figure 5C, lower left panel).
The next marker, 1L-5, was present at the early time point
and absent in the late 1 population. Only centromere-proximal
Cbs markers were stably detected (primer sets 1L6, 1L13
and 1R).
These data suggest that the left arm is progressively eroded.
While the relative order of the retained markers is known,
their physical distances from 1L-5 have not been established.
Additional PCR analysis with distal chromosome 1R markers
(1R4, 1R5 and 1R14) failed to generate products at early
and late passages, indicating that instability was not restricted
to the 1L (rDNA-containing) chromosome arm. The early
loss of several 1R markers in this line is consistent with
Nucleic Acids Research, 2006, Vol. 34, No. 2627

Page 9

stochastic fragmentation at a centromere-proximal site prior to
subcloning.
C3DRFB strains exhibit an abnormal transition from
conjugal development to the first vegetative cell division
The C3DRFB allele induces stochastic, progressive deter-
ioration of micronuclear chromosome 1 during vegetative
cell divisions, but has no obvious effect on macronuclear
rDNA copy number or rRNA expression. To further explore
the effect of this mutation on micronuclear chromosome fit-
ness, we propagated heterozygous mutant strains vegetatively
and then examined their ability to generate viable progeny
by microscopic examination of developmental landmarks.
Mating proficiency and macronuclear biogenesis were exam-
ined in crosses involving heterozygous mutants [TX607(1),
TX610(11) and TX611(1)]. Whereas these parental strains
tested positive for micronuclear C3DRFB and B rDNA alleles
immediately prior to use, we anticipated that they contained
sub-populations that had lost one or both micronuclear rDNA
alleles.
The kinetics of pair formation and separation in matings
involving C3DRFB/B mutants and tester strains, SB210 or
CU428, were comparable with the wild C3 rDNA transfor-
mant [TX614(1)] and with matings between two wild-type
tester strains (CU427 · SB1934) (Figure 6A and data not
shown). Cytological examination of wild-type [TX614(1)]
or mutant-containing mating pairs with apofluor revealed
the expected progression through developmental landmarks
(Figure 6C; wild-type schematic T ¼ 3–24 h), including the
generation of mating partners with four pronuclei (Figure 6B,
micrograph 1), acidification and degradation of the old
Figure 4. Loss of the micronuclear C3DRFB rDNA allele during vegetative propagation. Heterozygous germline transformants (C3DRFB/B or wild-type C3/B)
were continually propagated following the establishment of clonal lines (transformant clones 1–13). Expanded clones were serially passaged by transferring
?1000 cells into fresh media (1:100 dilution). DNA was isolated at ?70 (early) and ?150 (late) fissions and subjected to PCR amplification with primers that
selectively amplify micronuclear C3 rDNA (wild-type C3 or C3DRFB alleles, primers 2 + 36), or wild-type C3 and B rDNA (primers 2 + 23). Control PCR
templates—B: wild-type B rDNA strain (CU428), C: wild-type C3 rDNA strain (SB1934). The micronuclear genotype of clonal TX611 lines could not be
unambiguously established due to the potential presence of macronuclear rDNA minichromosomes derived from aberrant rDNA excision (Figures 2 and 3,
C3-long).
628Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 10

parental macronucleus (Figure 6C, step 2), pair separation
(Figure 6B, micrograph 2) and formation of the typical excon-
jugants, which contain two new macronuclei (macronuclear
anlagen) and two micronuclei (Figure 6B, micrograph 5)
[reviewed in (14)]. Since these events are controlled by the
parental macronucleus, we expected that the C3DRFB muta-
tion would not disrupt these processes. Occasionally, mating
cells with an elevated number of pronuclei were observed in
the mutant [Figure 6B, compare micrographs 1 (4 pronuclei)
and 6 (8 or 9 pronuclei)].
Althoughconjugalevents
micro- and macronuclei were largely unaffected, the ability
of exconjugants to propagate was significantly compromised
in C3DRFB mutants. This was evident when exconjugants
associatedwithparental
Figure 5. Progressive loss of the chromosome 1L arm and loss of the distal 1R region. (A) Germline PCR analysis of newly established clonal lines derived from
TX607(3)at ?150 fissions (see Figures 1A and 1B forPCR primer positions). The germline C3DRFB allele was absentin all the 15 lines and the B rDNA homolog
was also missing in the subclone 15. PCR primers 15F and 15R span the Cbs element at the 30end of the micronuclear rDNA locus in intact micronuclear
chromosomes. B: wild-type B rDNA strain, CU428; C: wild-type C3 rDNA strain, SB1934. (B) PCR analysis of micronuclear-limited DNA fragments from the
left and right arms of the five micronuclear chromosomes. While most of the analyzed Cbs junctions have not been precisely positioned on their respective
micronuclear chromosome, the primer sets used to examine chromosomes 4 and 5 map close to micronuclear telomeres (E. Hamilton and E. Orias, personal
communication).W:wild-typeBrDNAstrainCU428,M:TX607(3)subclone15.Lane1(L):100bpDNAladder.(C)Lossof1Land1Rmarkersduringprolonged
propagationofTX607(3)subclone15.Toppanel:mapdepictingtherelativeorderofchromosome1 Cbsjunctionsthatweresubjectedto PCRanalysisin wild-type
(CU428) and mutant (TX607(3) subclone 15) strains (CEN: centromere, Tel: telomere). TX607(3) subclone 15 (derived from TX607(3) late passage) was serially
propagated and subjected to PCR analysis at early (E: ?70 fissions) and late [late 1 (L1): ?150, late 2 (L2): ?250] fissions (bottom panels).
Nucleic Acids Research, 2006, Vol. 34, No. 2 629

Page 11

were refed and allowed to complete macronuclear develop-
ment, at which time they were solely dependent on gene exp-
ression from the new progeny macronucleus. When wild-type
mating cultures were examined 8 h after re-feeding (32 h
post-mating), the vast majority of cells contained two
macronuclei and one micronucleus, and had a large cytoplas-
mic diameter expected for exconjugant progeny (Figure 6B,
micrograph 3, fourth diagram in Figure 6C). Actively dividing
and non-dividing cells with a single large macronucleus and
large cytoplasm were also observed (Figure 6B, micrographs 2
and 4); the latter of which could be new progeny or parental
cells that failed to mate. Approximately 10% of the cells from
wild-type matings had not yet reabsorbed one of the progeny
micronuclei (Figure 6B, micrograph 5). These cells were
classified as abnormal due to their temporal developmental
delay or arrest [Figure 6D, WT · TX614(1) graph]. The fre-
quency of abnormal cells in wild-type · C3DRFB/B mutant
mating was significantly elevated at the exconjugant stage
(Figure 6D, 40–65%). Aberrant cells consisted primarily of
arrested exconjugants (2 macronuclei and 1 micronucleus)
with an extremely small cytoplasm (Figure 6B, micrographs
7–10). These small cells eventually disappeared from the
culture, indicating that the DRFB parental strains are less
fertile.
Vegetative culturesderived
TX607(1) and CU427 contained a small, but significant per-
centage of viable cells that had an elevated number of nuclear
structures that stained with apofluor or DAPI. These cultures
appeared normal at early cell divisions, but progressively
worsened over time. Whereas extra nuclei were not observed
in primary C3DRFB/B transformants, this cytological pheno-
type occurred at a high frequency in subsequent generations
(Figure 6E). These results suggest that essential genes are
not transmitted to progeny. Thus, in a sub-population of
cells, the deletion of the RFB region initiates a cascade
of events that destabilize the wild-type and mutant homologs
of chromosome 1 and render the micronucleus insufficient
to support normal development in the next generation.
fromcrosses involving
Figure 6. Abnormal transition from conjugal development to the first vegetative cell division in heterozygous C3DRFB/B progeny. (A) Normal kinetics for
pair formation and separation in C3DRFB mutant progeny. Microscopic analysis of pair formation and separation in wild-type crosses [SB210 · TX614(1)],
crosses between wild-type and mutant strains [SB210 · TX607(1), SB210 · TX610(11), SB210 · TX611(1)] and cross between two mutant strains
[TX607(1) · TX610(11)]. (B) Cytological examination of crosses between wild-type strain SB210 and wild-type C3 rDNA transformant, TX614(1) (WT · WT),
or SB210 and C3DRFB transformant, TX607(1) (WT · Mutant) with the DNA staining dye apofluor. The vast majority of cells displayed normal progression
throughdevelopment(datanotshown),withasmallpercentageofmutantmatingpartnerscontainingextramicronuclei/pronucleipriortogeneticexchange(compare
micrographs 1 and 6). Panels 2–5 (WT · WT) and 7 ·10 (WT · Mutant) depict representative cells in exconjugant mating populations (24 h mating followed by
7–9 h re-feeding). (C) Cartoon depicting the progression of mating cells during development (0–24 h) and the fate of exconjugants after re-feeding at 24 h
for (WT · WT), and (WT · mutant) or (mutant · mutant) crosses. See text for details. (D) Quantification of the number of ‘abnormal cells’ for different mating
7–9 h after re-feeding (see text for details). (E) Progeny of crosses between TX611(1) and A* mating type III obtained by single pair isolation after 23–25 h and
subsequentpropagation for5–10passages. Note the appearanceof extranucleiin the mutant(micrographs 2–4)comparedwithwild-type(micrograph1).Staining:
apofluor (micrographs 1–3), DAPI (micrograph 4).
630 Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 12

Prolonged vegetative propagation of DRFB parental strains
(TX610 and TX611) resulted in even more severe defects
in development and progeny formation. While virtually all
of the TX610 · TX611 mating pairs examined in Figure 6
produced exconjugants, only 10–20% of the mating pairs
generated exconjugants in a subsequent mating with older
parental strains (data not shown). Instead, cells typically
arrested randomly at earlier developmental stages. The redu-
ced viability of exconjugants derived from ‘young’ RFB
deletions strains and diminished fertility of ‘older’ RFB dele-
tion strains (i.e. fewer exconjugants) is consistent with the
progressive deterioration of the micronuclear genome during
vegetative cell divisions.
DISCUSSION
The rDNA minichromosome of Tetrahymena thermophila is
generated de novo by developmentally programmed excision
ofthe singleintegrated rDNA gene copy. Origins inthe 50NTS
repeatedly fire to amplify macronuclear rDNA minichromo-
somes, and forks moving toward the center of the rDNA
palindrome arrest at a strong replication fork barrier. Once
development is complete, replication initiates once per cell
cycle and forks no longer arrest at the RFB. Our analysis
of germline transformants deleted for the RFB revealed that
this segment not only acts in cis to promote programmed
excision of the rDNA in the developing macronucleus, but
is also needed to prevent spontaneous chromosome breakage
in the mitotic germline micronucleus. Our ability to uncover
and study the fragmentation and progressive degeneration
of micronuclear chromosome 1 was possible because the
diploid micronucleus of ciliated protozoa is not transcribed
during vegetative cell divisions, and consequently is not
required for cell viability. The loss of both chromosome 1L
arms, for example, would be lethal in conventional eukar-
yotes that contain a single transcriptionally-active diploid
nucleus.
rDNA excision in the developing for macronucleus
The sites for programmed cleavage of chromosomes in
the developing Tetrahymena macronucleus share a common
15 bp motif in intervening micronuclear DNA, the Cbs (15).
Cbs elements are remarkably conserved and sequence varia-
tion is poorly tolerated (15,32,41). Functional studies of clus-
tered Cbs’ immediately upstream of the rDNA revealed that
these elements dictate the position of site-specific chromo-
some breakage and telomere addition and that these processes
are mechanistically coupled (16). Our analysis of an rDNA
segment encompassing the developmentally regulated RFB
indicates that this region promotes excision at the proximal
Cbs elements upstream of the rRNA gene. Correct excision is
observed in a sub-population of cells, while other cells fail to
produce C3 rDNA minichromosomes altogether or utilize an
alternative processing pathway. Molecules that are properly
excised subsequently rearrange into palindromic minichromo-
somes that replace endogenous B rDNA during vegetative
propagation.
To our surprise cells that failed to properly excise the
mutant rDNA allele could still generate macronuclear
rDNA minichromosomes. The novel rDNA species that
were observed bypassed the proximal Cbs elements entirely
and were ‘processed’ at a limited number of positions, includ-
ing a preferred site ?1.1 kb upstream of the rDNA. Cbs-like
sequences were present near the new ‘fragmentation sites’;
however, they contain mismatches that have been shown to
ablate Cbs function when placed in competition with wild-
type Cbs elements (38). Since these alternative processing
sites would be in competition with two fully functional Cbs
elements at the 50end of the rDNA, we predict that excision
occurs by a Cbs-independent mechanism.
The 50end of excised rDNA in the most prominent new
macronuclear rDNA species, C3-long, is proximal to three
short inverted repeats. These rDNA molecules had rearranged
into a palindrome, similar towild-type minichromosomes. The
proximal inverted repeat sequences that were detected in the
rearrangement region are not homologous to the M sequence
repeat at the center of wild-type rDNA. Previous studies
revealed that primary sequence is not important for palin-
drome formation; only a minimal repeat length of 20 bp is
required (18). We propose that the three 10–12 bp clustered
repeats near the C3-long breakpoint are sufficient to promote
homology-induced recombination (17). Finally, in contrast
to wild-type C3 minichromosomes (22) or properly processed
C3DRFB palindromes, C3-long palindromes failed to out-
replicate endogenous B rDNA. The added segment might
contain sequences that repress origin activation or could
diminish replication efficiency by increasing the distance
between origins on opposite sides of the palindrome. In
support of the later model, a previous study revealed that
mutations that ablate origin function on monomeric circular
episomes are fully functional in palindromic minichro-
mosomes (42). In summary, these studies identify a new
genetic determinant for chromosome breakage and uncover
alternative sites and possibly mechanisms for chromosome
fragmentation and rearrangement.
Deletion of the RFB region induces micronuclear
chromosome instability
The most unexpected finding of this work is the discovery
that the rDNA RFB promotes chromosome stability in the
micronucleus. The Tetrahymena rDNA RFB region is the
first example of a cis-acting DNA segment that actively pro-
tects a chromosome from spontaneous fragmentation. How
this short sequence serves as a safeguard is unknown. One
possible mechanism is that the RFB maintains the proper
chromatin organization in the micronucleus. Micro- and
macronuclear chromatin exhibit many distinguishing fea-
tures, including the size of the nucleosome repeat length
(200 versus 170 bp) (43), post-translational modification of
histone subunits [reviewed in (44)] and biochemical makeup
of the linker histone (45–47). Since the macronucleus is
derived from a micronucleus, the entire genome must be
remodeled during macronuclear development. While the
RFB region isdispensable formacronuclearrDNA replication,
it may be required to utilize the rDNA origin in the micronu-
cleus. Deletion of the RFB could alter origin utilization,
replication timing and/or the direction of replication fork
movement. We propose that the RFB region acts as a replica-
tion fork barrier in both the micronucleus and developing
macronucleus, and represents the ‘ground state’ for chromatin
Nucleic Acids Research, 2006, Vol. 34, No. 2 631

Page 13

that is remodeled later in development. Previous studies
showed that the RFB is active prior to onset of rRNA tran-
scription during development, while transient fork arrest at
other sites (Figure 1A, PSE1–3) does not occur until the
chromatin is competent for transcription (13).
The RFB deletion creates a hot spot for chromosome
breakage, analogous to fragile sites in mammalian genomes.
In the Tetrahymena case, removal of <400 bp renders chro-
mosome 1 sensitive to breakage. By comparison, 0.6–5.5 kb
CGG/CCG repeat expansions pre-dispose the human FRAXA
locus to spontaneous breakage [reviewed in (48)]. Similarly,
10–70 kb expansions of a 33 bp microsatellite sequence
promote breakage at another rare fragile site, FRA16B. In
contrast to rare fragile sites, common fragile sites in the
human genome are devoid of highly repetitive DNA sequence,
analogous to the Tetrahymena rDNA locus.
A recent S.pombe study demonstrated that fork arrest at a
non-repetitive RFB induces genome instability, including
homologous recombination and global chromosome rear-
rangement (2). Remarkably, removal of the Tetrahymena
rDNA RFB appears to have the same effect. In both instances,
activation of the DNA repair response is observed without
the apparent involvement of the S phase checkpoint pathway
(2) (J. S. Yakisich and G. M. Kapler, unpublished data). In the
Tetrahymena case, fragmentation of micronuclear chromo-
some 1 initiates a cascade of events that not only affect
the mutant DRFB chromosome (cis-acting effects), but also
compromise the wild-type homolog as well (trans-acting
effects). Two different mechanisms can account for most
of the observed micronuclear genome instability. In both
pathways the deleted RFB region triggers the formation of
a DSB in the mutant (DRFB) chromosome [Figure 7, (a)].
In the first model, breakage of the mutant chromosome
activates a homologous recombination (HR) repair pathway
(Figure 7, HR). A second model proposes that the exposed
DSB triggers breakage/fusion/bridge (B/F/B) cycles (Figure 7,
B/F/B pathway).
Fragmentation of wild-type chromosome 1 must be medi-
ated in trans, since this rDNA allele contains an intact RFB
region.Consequently,the wild-typeandDRFBhomologs must
interact during mitotic cell cycles. In the HR pathway, a pro-
cess that requires pairing between homologs, the wild-type
allele attempts to repair the fragmented mutant chromosome
[Figure 7, (b)]. This futile effort generates a DSB in the wild-
type chromosome [Figure 7 (c)] [reviewed in (49)]. Initial
loss of the micronuclear C3DRFB locus and subsequent
loss of the B rDNA allele (Figure 4) are consistent with the
notion that the fragmented mutant chromosome promotes the
loss of the wild-type homolog. In the next step, broken chro-
mosomes are progressively eroded, possibly due to the inabil-
ity of telomerase to add telomeres de novo onto exposed
chromosome ends [Figure 7, (d)]. Accordingly, chromosome
1 markers proximal to the rDNA-proximal are lost from the
population prior to centromere-proximal markers, a predic-
tion supported by our analysis of numerous clonal lines
(Figure 5C). The quantitative loss of a given DNA segment
within the cell population indicates that fragmentation and
subsequent erosion are common events.
In the second pathway broken C3DRFB sister chromatids
fuse, generating a dicentric chromosome that initiates B/F/B
Figure 7. ModelsforthelossoftherDNAgene,progressivelossofthe1Lchromosomearmandsubsequentlossof1RDNAsequencesinheterozygousC3DRFB/B
rDNA strains.Eachmicronucleuscontainsonecopy ofwild-type(WT)andmutant(C3 DRFB)rDNA in the respectivechromosome1 homologs. Thejaggedarrow
in the mutant chromosome indicates a fragile site that induces a DSB (a). In one model (left), the attempted repair the DSB in the mutant chromosome by homolo-
gous recombination (HR) involves alignment of both homologs (b). Failure to repair the damaged chromosome induces DSB in the WT chromosome (c). The lack
of telomere addition leads to progressive loss of 1L sequences on both homologs (d). The alternative model involves of B/F/B cycles on the fragmented
C3DRFB chromosome. The DNA complexity generated by B/F/B cycles can be the same as that generated by homologous recombination for the C3DRFB allele.
Loss of 1R DNA sequences (e) (see text for details).
632 Nucleic Acids Research, 2006, Vol. 34, No. 2

Page 14

cycles (Figure 7, B/F/B pathway), similar to those observed
following the loss of a single telomere (50). Repeated cycles
could lead to the loss of ordered markers on the C3DRFB
chromosome; however, random breakage at each cell divis-
ion would generate enormous heterogeneity within large
cell populations. Furthermore, since fusion events are not
driven by sequence homology, the wild-type homolog
should not be selectively destabilized. Instead of deletions
and translocations involving multiple chromosomes, we
observed the fragmentation of the wild-type 1L arm, followed
by the loss of markers between this breakpoint and the
centromere. Finally, since the RFB mutation did not induce
the massive global micronuclear genome instability like
that associated with the absence of the origin binding
protein, TIF1 (34) (T. L. Morrison, P. Sandoval, J. S. Yakisich
and G. M. Kapler, unpublished data), the molecular data
strongly support a homology-driven mechanism for the loss
of the wild-type homolog and progressive erosion of exposed
chromosome end.
Neither HR nor B/F/B cycles alone or in combination can
account for the loss of the 1R arm [Figure 7, (e)]. While,
circularization of macronuclear rDNA has been reported in
aparticulartelomeraseRNAmutant(51),wehave no evidence
for circularization of chromosome 1. Instead, the loss of 1R
sequences suggests that the two chromosome 1 arms interact
at some point. Recombination between repetitive sequences
or non-homologous joining of a broken 1L arm with the 1R
telomere could be involved.
Whatever the mechanism for chromosome degeneration, it
is clear that the broken 1L chromosome is not stabilized. This
deficiency may reflect intrinsic properties of Tetrahymena
telomerase. Telomerase has been shown to elongate pre-
existing macro- and micronuclear telomeric tracts in vivo
(52,53). While de novo telomere addition is a hallmark of
macronuclear development, it is temporally and mechanisti-
cally coupled to Cbs-mediated cleavage in the developing
macronucleus (54). The efficiency of ‘chromosome healing’
in the mitotic micronucleus must be low at best, since chro-
mosome 1 sequences were continually lost from entire mutant
cell populations.
In conclusion, the Tetrahymena rDNA RFB region pro-
motes programmed site-specific DNA fragmentation of the
rDNA locus in the developing macronucleus and safeguards
its micronuclear chromosomal counterpart from spontaneous
breakage during vegetative cell divisions. The compartmen-
talization of gene expression and transmission functions into
separate nuclei places different demands on the respective
chromosomes. The long-term propagation of the species is
dependent on the transmission of a full complement of gene-
tic information during conjugation. Thus, the unexpected
role of the RFB in the micronucleus must be a strong driving
force for the acquisition and retention of these DNA
sequences.
ACKNOWLEDGEMENTS
The authors thank Audrey Nicholson for the construction of
the C3DRFB plasmid. They acknowledge the members of the
Kapler laboratory for discussions, and thank Linda Guarino
and Dorothy Shippen for advice and comments on the manu-
script. This work was supported by NIH grant GM53572 to
GMK. Funding to pay the Open Access publication charges
for this article was provided by NIH grant GM53572.
Conflict of interest statement. None declared.
REFERENCES
1. Edenberg,H.J. and Huberman,J.A. (1975) Eukaryotic chromosome
replication. Annu. Rev. Genet., 9, 245–284.
2. Lambert,S., Watson,A., Sheedy,D.M., Martin,B. and Carr,A.M. (2005)
Gross chromosomal rearrangements and elevated recombination at an
inducible site-specific replication fork barrier. Cell, 121, 689–702.
3. Hyrien,O. (2000) Mechanisms and consequences of replication fork
arrest. Biochimie, 82, 5–17.
4. Bussiere,D.E. and Bastia,D. (1999) Termination of DNA replication of
bacterial and plasmid chromosomes. Mol. Microbiol., 31, 1611–1618.
5. Olavarrieta,L., Hernandez,P., Krimer,D.B. and Schvartzman,J.B. (2002)
DNA knotting caused by head-on collision of transcription and
replication. J. Mol. Biol., 322, 1–6.
6. Sanchez-Gorostiaga,A., Lopez-Estrano,C., Krimer,D.B.,
Schvartzman,J.B. and Hernandez,P. (2004) Transcription termination
factor reb1p causes two replication fork barriers at its cognate sites in
fission yeast ribosomal DNA in vivo. Mol. Cell Biol., 24, 398–406.
7. Shimizu,N., Hashizume,T., Shingaki,K. and Kawamoto,J.K. (2003)
Amplification of plasmids containing a mammalian replication
initiation region is mediated by controllable conflict between
replication and transcription. Cancer Res., 63, 5281–5290.
8. Dalgaard,J.Z. and Klar,A.J. (2000) swi1 and swi3 perform imprinting,
pausing, and termination of DNA replication in S. pombe. Cell,
102, 745–751.
9. Ivessa,A.S., Zhou,J.Q. and Zakian,V.A. (2000) The Saccharomyces
Pif1p DNA helicase and the highly related Rrm3p have opposite
effects on replication fork progression in ribosomal DNA. Cell, 100,
479–489.
10. Weitao,T.,Budd,M.andCampbell,J.L.(2003)EvidencethatyeastSGS1,
DNA2, SRS2, and FOB1 interact to maintain rDNA stability.
Mutat. Res-Fund. Mol. Mech. Mut., 532, 157–172.
11. Weitao,T., Budd,M., Hoopes,L.L.M. and Campbell,J.L. (2003) DNA2
helicase/nuclease causes replicative fork stalling and double-strand
breaks in the ribosomal DNA of Saccharomyces cerevisiae. J. Biol.
Chem., 278, 22513–22522.
12. MacAlpine,D.M., Zhang,Z. and Kapler,G.M. (1997) Type I elements
mediate replication fork pausing at conserved upstream sites in the
Tetrahymena thermophila ribosomal DNA minichromosome.
Mol. Cell Biol., 17, 4517–4525.
13. Zhang,Z., MacAlpine,D.M. and Kapler,G.M. (1997) Developmental
regulation of DNA replication: Replication fork barriers and
programmed gene amplification in Tetrahymena thermophila.
Mol. Cell Biol., 17, 6147–6156.
14. Karrer,K.M. (2000) Tetrahymena genetics: two nuclei are better than
one. Methods Cell Biol., Vol. 62, 127–186.
15. Yao,M.C., Zheng,K.Q. and Yao,C.H. (1987) A conserved
nucleotide-sequence at the sites of developmentally regulated
chromosomal breakage in Tetrahymena. Cell, 48, 779–788.
16. Yao,M.C., Yao,C.H. and Monks,B. (1990) The controlling sequence
for site-specific chromosome breakage in Tetrahymena. Cell, 63,
763–772.
17. Butler,D.K., Yasuda,L.E. and Yao,M.C. (1995) An intramolecular
recombination mechanism for the formation of the ribosomal-RNA
gene palindrome of Tetrahymena thermophila. Mol. Cell
Biol., 15, 7117–7126.
18. Yasuda,L.F. and Yao,M.C. (1991) Short inverted repeats at a free
end signal large palindromic DNA formation in Tetrahymena.
Cell, 67, 505–516.
19. King,B.O. and Yao,M.C. (1982) Tandemly repeated hexanucleotide at
Tetrahymena rDNA free end is generated from a single copy during
development. Cell, 31, 177–182.
20. Yao,M.C., Blackburn,E. and Gall,J.G. (1978) Amplification of the
ribosomal-RNA genes in Tetrahymena. Cold Spring Harb. Symp. Quant.
Biol., 43, 1293–1296.
21. Saha,S., Nicholson,A. and Kapler,G.M. (2001) Cloning and biochemical
analysis of the Tetrahymena origin binding protein TIF1—Competitive
Nucleic Acids Research, 2006, Vol. 34, No. 2633

Page 15

DNA binding in vitro and in vivo to critical rDNA replication
determinants. J. Biol. Chem., 276, 45417–45426.
22. Larson,D.D., Blackburn,E.H., Yaeger,P.C. and Orias,E. (1986) Control
of rDNA replication in Tetrahymena involves a cis-acting upstream
repeat of a promoter element. Cell, 47, 229–240.
23. Shang,Y.H., Song,X.Y., Bowen,J., Corstanje,R., Gao,Y., Gaertig,J. and
Gorovsky,M.A. (2002) A robust inducible-repressible promoter greatly
facilitates gene knockouts, conditional expression, and overexpression
of homologous and heterologous genes in Tetrahymena thermophila.
Proc. Natl Acad. Sci. USA, 99, 3734–3739.
24. Orias,E. and Bruns,P.J. (1976) Induction and isolation of mutants in
Tetrahymena. Methods Cell Biol., 13, 247–282.
25. Bruns,P.J. and Cassidy-Hanley,D. (2000) Biolistic transformation of
macro- and micronuclei. Methods in Cell Biology, 62, 501–512.
26. Cassidy-Hanley,D., Bowen,J., Lee,J.H., Cole,E., VerPlank,L.A.,
Gaertig,J., Gorovsky,M.A. and Bruns,P.J. (1997) Germline and
somatic transformation of mating Tetrahymena thermophila by
particle bombardment. Genetics, 146, 135–147.
27. Allen,S.L. (1967) Genomic exclusion—a rapid means for inducing
homozygous diploid lines in Tetrahymena pyriformis syngen I.
Science, 155, 575–577.
28. Engberg,J.,Din,N.,Saiga,H.andHigashinakagawa,T.(1984)Nucleotide
sequence of the 50-terminal coding region for pre-rRNA and mature 17S
rRNA in Tetrahymena thermophila rDNA. Nucleic Acids Res., 12,
959–972. PubMed accession no. X00305.
29. Engberg,J.(1985)Theribosomal-RNAgenesofTetrahymena—structure
and function. Eur. J. Cell Biol., 36, 133–151.
30. Yao,M.C., Zhu,S.G. and Yao,C.H. (1985) Gene amplification in
Tetrahymenathermophila—formationofextrachromosomalpalindromic
genes coding for ribosomal RNA. Mol. Cell Biol., 5, 1260–1267.
31. Yao,M.C., Zhu,S.G. and Yao,C.H. (1985) Gene amplification in
Tetrahymena thermophila: formation of extrachromosomal palindromic
genes coding for rRNA. Mol. Cell. Biol., 5, 1260–1267. PubMed
accession no. M11155.
32. Cassidy-Hanley,D., Bisharyan,Y., Fridman,V., Gerber,J., Lin,C.,
Orias,E., Orias,J.D., Ryder,H., Vong,L. and Hamilton,E.P. (2005)
Genome-wide characterization of Tetrahymena thermophila
chromosome breakage sites. II. Physical and genetic mapping.
Genetics, 170, 1623–1631.
33. Hamilton,E.P., Bruns,P.J., Lin,C., Merriam,V., Orias,E., Vong,L. and
Cassidy-Hanley,D. (2005) Genome-wide characterization of
Tetrahymena thermophila chromosome breakage sites. I. Cloning and
identification of functional sites. Genetics, 170, 1611–1621.
34. Morrison,T.L., Yakisich,J.S., Cassidy-Hanley,D. and Kapler,G.M.
(2005) TIF1 represses rDNA replication initiation, but promotes
normal S phase progression and chromosome transmission in
Tetrahymena. Mol. Biol. Cell, 16, 2624–2635.
35. Mpoke,S.S. and Wolfe,J. (1997) Differential staining of apoptotic
nuclei in living cells: Application to macronuclear elimination in
Tetrahymena. J. Histochem. Cytochem., 45, 675–683.
36. Yakisich,J.S. and Kapler,G.M. (2004) The effect of phosphoinositide
3-kinase inhibitors on programmed nuclear degradation in Tetrahymena
and fate of surviving nuclei. Cell Death Differ., 11, 1146–1149.
37. Pan,W.C. and Blackburn,E.H. (1981) Single extrachromosomal
ribosomal-RNA gene copies are synthesized during amplification
of the rDNA in Tetrahymena. Cell, 23, 459–466.
38. Fan,Q.C. and Yao,M.C. (2000) A long stringent sequence signal for
programmed chromosome breakage in Tetrahymena thermophila.
Nucleic Acids Res., 28, 895–900.
39. Brunk,C.F. and Conover,R.K. (1985) Elimination of micronuclear
specific DNA sequences early in anlagen development.
Mol. Cell Biol., 5, 93–98.
40. Yokoyama,R.W. and Yao,M.C. (1982) Elimination of DNA
sequences during macronuclear differentiation in Tetrahymena
thermophila, as detected by in situ hybridization. Chromosoma,
85, 11–22.
41. Coyne,R.S. and Yao,M.C. (1996) Evolutionary conservation of
sequences directing chromosome breakage and rDNA palindrome
formation in tetrahymenine ciliates. Genetics, 144, 1479–1487.
42. Reischmann,K.P., Zhang,Z. and Kapler,G.M. (1999) Long range
cooperative interactions regulate the initiation of replication in the
Tetrahymena thermophila rDNA minichromosome. Nucleic Acids Res.,
27, 3079–3089.
43. Gorovsky,M.A.,Glover,C.,Johmann,C.A.,Keevert,J.B.,Mathis,D.J.and
Samuelson,M. (1977) Histones and chromatin structure in Tetrahymena
macronuclei and micronuclei. Cold Spring Harb. Symp. Quant.
Biol., 42, 493–503.
44. Jenuewin,T. and Allis,C.D. (2001) Translating the histone code.
Science, 293, 1074–1080.
45. Wu,M., Allis,C.D., Sweet,M.T., Cook,R.G., Thatcher,T.H. and
Gorovsky,M.A. (1994) Four distinct and unusual linker proteins in a
mitotically dividing nucleus are derived from a 71-kilodalton
polyprotein, lack p34(Cdc2) sites, and contain protein kinase a sites.
Mol. Cell Biol., 14, 10–20.
46. Stargell,L.A., Bowen,J., Dadd,C.A., Dedon,P.C., Davis,M., Cook,R.G.,
Allis,C.D.andGorovsky,M.A.(1993)Temporalandspatialassociationof
histone-H2a variant Hv1 with transcriptionally competent chromatin
duringnucleardevelopmentinTetrahymenathermophila.GenesDev.,7,
2641–2651.
47. Yu,L.L. and Gorovsky,M.A. (1997) Constitutive expression, not a
particular primary sequence, is the important feature of the H3
replacement variant hv2 in Tetrahymena thermophila. Mol. Cell Biol.,
17, 6303–6310.
48. Sutherland,G.R., Baker,E. and Richards,R.I. (1998) Fragile sites still
breaking. Trends Genet., 14, 501–506.
49. Dudas,A. and Chovanec,M. (2004) DNA double-strand break repair by
homologous recombination. Mutat Res., 566, 131–167.
50. Sabatier,L., Ricoul,M., Pottier,G. and Murnane,J.P. (2005) The loss of a
single telomere can result in instability of multiple chromosomes in a
human tumor cell line. Mol. Cancer Res., 3, 139–150.
51. Romero,D.P. and Blackburn,E.H. (1995) Circular rDNA replicons
persist in Tetrahymena thermophila transformants synthesizing
GGGGTC telomeric repeats. J. Eukaryot. Microbiol., 42, 32–43.
52. Yu,G.L. and Blackburn,E.H. (1991) Developmentally programmed
healing of chromosomes by telomerase in Tetrahymena. Cell, 67,
823–832.
53. Kirk,K.E., Harmon,B.P., Reichardt,I.K., Sedat,J.W. and Blackburn,E.H.
(1997) Block in anaphase chromosome separation caused by a
telomerase template mutation. Science, 275, 1478–1481.
54. Fan,Q.C. and Yao,M.C. (1996) New telomere formation coupled with
site-specific chromosome breakage in Tetrahymena thermophila.
Mol. Cell Biol., 16, 1267–1274.
634Nucleic Acids Research, 2006, Vol. 34, No. 2