Cyclooxygenase-2 induction and prostacyclin release by protease-activated receptors in endothelial cells require cooperation between mitogen-activated protein kinase and NF-kappaB pathways.

Abstract

The functional significance of protease-activated receptors (PARs) in endothelial cells is largely undefined, and the intracellular consequences of their activation are poorly understood. Here, we show that the serine protease thrombin, a PAR-1-selective peptide (TFLLRN), and SLIGKV (PAR-2-selective peptide) induce cyclooxygenase-2 (COX-2) protein and mRNA expression in human endothelial cells without modifying COX-1 expression. COX-2 induction was accompanied by sustained production of 6-keto-PGF1alpha, the stable hydrolysis product of prostacyclin, and this was inhibited by indomethacin and the COX-2-selective inhibitor NS398. PAR-1 and PAR-2 stimulation rapidly activated both ERK1/2 and p38MAPK, and pharmacological blockade of MEK with either PD98059 or U0126 or of p38MAPK by SB203580 or SB202190 strongly inhibited thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1alpha formation. Thrombin and peptide agonists of PAR-1 and PAR-2 increased luciferase activity in human umbilical vein endothelial cells infected with an NF-kappaB-dependent luciferase reporter adenovirus, and this, as well as PAR-induced 6-keto-PGF1alpha synthesis, was inhibited by co-infection with adenovirus encoding wild-type or mutated (Y42F) IkappaBalpha. Thrombin- and SLIGKV-induced COX-2 expression and 6-keto-PGF1alpha generation were markedly attenuated by the NF-kappaB inhibitor PG490 and partially inhibited by the proteasome pathway inhibitor MG-132. Activation of PAR-1 or PAR-2 promoted nuclear translocation and phosphorylation of p65-NF-kappaB, and thrombin-induced but not PAR-2-induced p65-NF-kappaB phosphorylation was reduced by inhibition of MEK or p38MAPK. Activation of PAR-4 by AYPGKF increased phosphorylation of ERK1/2 and p38MAPK without modifying NF-kappaB activation or COX-2 induction. Our data show that PAR-1 and PAR-2, but not PAR-4, are coupled with COX-2 expression and sustained endothelial production of vasculoprotective prostacyclin by mechanisms that depend on ERK1/2, p38MAPK, and IkappaBalpha-dependent NF-kappaB activation.

Full text

Page 1

Cyclooxygenase-2 Induction and Prostacyclin Release by
Protease-activated Receptors in Endothelial Cells Require
Cooperation between Mitogen-activated Protein Kinase
and NF-?B Pathways*
Receivedforpublication,August23,2005,andinrevisedform,February7,2006 Published,JBCPapersinPress,February8,2006,DOI10.1074/jbc.M509292200
Farisa Syeda‡, Jennifer Grosjean§, Rebecca A. Houliston‡, Rosemary J. Keogh‡, Tom D. Carter¶, Ewa Paleolog§,
and Caroline P. D. Wheeler-Jones‡1
Fromthe‡DepartmentofVeterinaryBasicSciences,RoyalVeterinaryCollege,RoyalCollegeStreet,LondonNW10TU,
UnitedKingdom,§KennedyInstituteofRheumatologyandDivisionofSurgery,Oncology,ReproductiveBiology,andAnaesthetics,
FacultyofMedicine,ImperialCollege,LondonW68LH,UnitedKingdom,and¶NationalInstituteforMedicalResearch,MillHill,
LondonNW71AA, United Kingdom
The functional significance of protease-activated receptors (PARs)
in endothelial cells is largely undefined, and the intracellular conse-
quencesoftheiractivationarepoorlyunderstood.Here,weshowthat
the serine protease thrombin, a PAR-1-selective peptide (TFLLRN),
and SLIGKV (PAR-2-selective peptide) induce cyclooxygenase-2
(COX-2) protein and mRNA expression in human endothelial cells
without modifying COX-1 expression. COX-2 induction was accom-
paniedbysustainedproductionof6-keto-PGF1?,thestablehydrolysis
product of prostacyclin, and this was inhibited by indomethacin and
the COX-2-selective inhibitor NS398. PAR-1 and PAR-2 stimulation
rapidly activated both ERK1/2 and p38MAPK, and pharmacological
blockade of MEK with either PD98059 or U0126 or of p38MAPKby
SB203580orSB202190stronglyinhibitedthrombin-andSLIGKV-in-
duced COX-2 expression and 6-keto-PGF1?formation. Thrombin
and peptide agonists of PAR-1 and PAR-2 increased luciferase
activity in human umbilical vein endothelial cells infected with an
NF-?B-dependent luciferase reporter adenovirus, and this, as well
asPAR-induced6-keto-PGF1?synthesis,wasinhibitedbyco-infec-
tion with adenovirus encoding wild-type or mutated (Y42F) I?B?.
Thrombin- and SLIGKV-induced COX-2 expression and 6-keto-
PGF1?generationweremarkedlyattenuatedbytheNF-?Binhibitor
PG490andpartiallyinhibitedbytheproteasomepathwayinhibitor
MG-132. Activation of PAR-1 or PAR-2 promoted nuclear translo-
cation and phosphorylation of p65-NF-?B, and thrombin-induced
but not PAR-2-induced p65-NF-?B phosphorylation was reduced
byinhibitionofMEKorp38MAPK.ActivationofPAR-4byAYPGKF
increased phosphorylation of ERK1/2 and p38MAPKwithout modi-
fying NF-?B activation or COX-2 induction. Our data show that
PAR-1andPAR-2,butnotPAR-4,arecoupledwithCOX-2expres-
sion and sustained endothelial production of vasculoprotective
prostacyclin by mechanisms that depend on ERK1/2, p38MAPK, and
I?B?-dependent NF-?B activation.
The principal mechanism through which serine proteases regulate
cell behavior is by activation of a unique family of G-protein-coupled
receptors, referred to as protease-activated receptors (PARs)2(1, 2).
These receptors are activated by the proteolytic activities of their
ligands, which unmask a cryptic N-terminal receptor sequence that
binds to and triggers receptor function while remaining tethered.
Molecular cloning has identified four subtypes of the PAR family that
exhibitdifferentialtissueexpressionaswellasselectivityinactivationby
serine proteases and by peptides that mimic the tethered ligand
sequences. PAR-1 is a ubiquitously expressed receptor and is activated
by the multifunctional serine protease, thrombin, and by the synthetic
PAR-1 peptide TFLLRN. PAR-4 is a second thrombin receptor that
bindsthrombinwithlowaffinityandcanbeactivatedbythepolypeptide
sequence AYPGKF (3, 4). Signaling through PAR-2, in contrast, is pref-
erentially stimulated by trypsin, tryptase, and membrane-type serine
protease-1 (5) and can be activated independently of proteolysis by the
selectivePAR-2peptideSLIGKV.Cellularresponsestothrombinandto
other proteases are therefore determined in part by the expression of
PARs as well as by the differential recruitment of signaling pathways
following ligand binding.
Endothelial cells respond to PAR-1 activation by thrombin with a
number of functional responses including secretion of von Willebrand
factor (6), up-regulation of IL-8 synthesis (7), and expression of adhe-
sion molecules (8). Thrombin also causes endothelial cell proliferation,
which is essential for wound healing and angiogenesis (9). However,
whereas this protease clearly promotes both proinflammatory and pro-
thrombotic events in the vascular wall, thrombin also increases endo-
thelial expression of complement inhibitory proteins (e.g. decay-accel-
eratingfactor)(3)andenhancesthereleaseofvasodilatormoleculesthat
have vasculoprotective properties (6, 11). In particular, we have shown
that thrombin exposure induces rapid and sustained phases of prosta-
cyclin (PGI2) synthesis by human endothelial cells (12). PGI2contrib-
utestotheacuteinflammatoryresponsebypromotingvasodilationand
increased vascular permeability, is a potent antiplatelet agent, and has
antiproliferative and antifibrotic effects mediated by paracrine actions
on vascular smooth muscle and fibroblasts, respectively (13, 14). The
potential effects of PAR-2 activation on endothelial prostanoid produc-
* This work was supported by the British Heart Foundation. The costs of publication of
this article were defrayed in part by the payment of page charges. This article must
therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
1To whom correspondence should be addressed: Dept. of Veterinary Basic Sciences,
Royal Veterinary College, Royal College St., London NW1 0TU, UK. Tel.: 44-0207-468-
5237; Fax: 44-0207-468-5204; E-mail: cwheeler@rvc.ac.uk.
2The abbreviations used are: PAR, protease-activated receptor; HUVEC, human umbili-
cal vein endothelial cell(s); COX-1/-2, cyclooxygenase-1/-2; I?B?, inhibitory protein
?B?; IKK, I?B-kinase; MEK, mitogen-activated protein kinase/extracellular signal-reg-
ulated kinase kinase; ERK, extracellular signal-regulated kinase; MAPK, mitogen-acti-
vated protein kinase; IL-1?, interleukin-1?; 6-keto-PGF1?, 6-keto-prostaglandin F1?;
PGI2, prostacyclin (prostaglandin I2); Ad, adenovirus; BSA, bovine serum albumin;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered
saline; ANOVA, analysis of variance.
THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 17, pp. 11792–11804, April 28, 2006
© 2006 by The American Society for Biochemistry and Molecular Biology, Inc.Printed in the U.S.A.
11792 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 2

tionhavereceivedlittleattention,butthereissomeevidencethatPAR-2
can mediate protective anti-inflammatory responses in vivo (15) as well
as contributing to inflammation (16). PAR-2 is strongly induced in
endothelial cells following cytokine challenge (17), and it has been sug-
gested that activation of this receptor is functionally significant only in
the context of inflammation. We have recently shown, however, that
human endothelial cells respond to PAR-2 activation with increased
prostanoid synthesis without the requirement for cytokine exposure
(12), suggesting that PAR-2 is also a physiologically relevant receptor.
UnderstandinghowsignalingthroughdistinctPARsregulatesendothe-
lial production of PGI2therefore has important implications for both
normal and pathophysiological control of the vasculature.
Prostaglandins are synthesized through the activities of two isoforms
of cyclooxygenase (COX), designated COX-1 and COX-2 (18). COX-1
isaconstitutiveenzymepresentinmosttissues.Incontrast,COX-2,the
product of a related gene, is strongly up-regulated by cytokines and
growth factors (19, 20) and is now recognized to be constitutively
expressed in several tissues (20). Regulation of COX-2 occurs at both
transcriptional and post-transcriptional levels, and mitogen-activated
proteinkinases(MAPKs)areknowntobeinvolvedinregulatingCOX-2
expressioninresponsetocytokines(21–23).ERK1/2andp38MAPKhave
been implicated in both acute and chronic responses to extracellular
stimuliinendothelialcellsandwehaveshownthatbothoftheseMAPK
families are capable of regulating acute thrombin-stimulated PGI2syn-
thesis through their direct and indirect effects on Group IV phospho-
lipase A2? activation (24). We have also previously shown that COX-2
expression in primary human endothelial cells is enhanced by exposure
to thrombin and the PAR-1-selective peptide TFLLRN and have pro-
videdevidencethatactivationofPAR-2bySLIGKVpromotesincreased
COX-2 expression with kinetics distinct from those evident in throm-
bin-stimulated cells (12). The signaling events that link PAR-1 and
PAR-2 with COX-2 expression and sustained prostanoid production
are not defined, but the ERK1/2 and p38MAPKfamilies may play impor-
tant roles.
The COX-2 gene contains numerous cis-acting promoter elements,
including NF-?B sites (25). NF-?B is a sequence-specific transcription
factor that regulates expression of numerous genes and can exert pro-
tective or detrimental effects, depending upon the cellular context
(26–28). In resting cells, NF-?B is complexed in the cytoplasm with
its inhibitory subunit I?B?. Agonist stimulation promotes serine
phosphorylation of I?B?, which triggers its proteasomal degradation
and subsequently activates NF-?B. NF-?B can also be activated by an
alternative mechanism that involves phosphorylation of I?B? on Tyr42
(27). In addition, optimal induction of NF-?B-dependent genes may
require agonist-mediated phosphorylation of NF-?B proteins within
their transactivation domain (29). There is some evidence that throm-
bin and a PAR-2-selective peptide can activate NF-?B in vascular cells
(30, 31), suggesting that the NF-?B pathway may be an important com-
ponent of PAR-mediated signaling. However, whereas COX-2 expres-
sion in several cell types is at least partly dependent on NF-?B activity,
the molecular details of its activation in response to ligand binding to
PARs are unknown, and hence its significance as a regulator of endo-
thelial PGI2synthesis remains to be determined.
We have investigated the molecular signaling mechanisms underly-
ing PAR-induced COX-2 expression and PGI2synthesis in human
endothelial cells. We show for the first time that activation of endothe-
lial PAR-1 and PAR-2, but not PAR-4, promotes COX-2 induction and
sustained formation of the vasculoprotective mediator PGI2through
mechanisms that require activation of ERK1/2 and p38MAPKas well as
I?B?-dependent NF-?B activation. We further show that phosphoryl-
ation of the p65 subunit of NF-?B is a component of both PAR-1- and
PAR-2-mediated endothelial activation. These findings have important
implicationsforunderstandingthevasculareffectsoftherapeuticinter-
ventions that target COX-2 and upstream activators of NF-?B.
EXPERIMENTAL PROCEDURES
Reagents—Human ?-thrombin, bovine serum albumin (BSA; frac-
tion V), and polyvinylidene difluoride membranes (Immobilon-PTM)
were all purchased from Sigma. The PAR-1-selective peptide TFLLRN
and the PAR-2 peptide SLIGKV were obtained from Bachem (St.
Helens, Merseyside, UK), and 2F-LIGRLO was from Peptides Interna-
tional Inc. (Louisville, KY). These peptides have been extensively char-
acterized with respect to their selectivity of action at PARs (e.g. see Ref.
32). Human recombinant IL-1? was from R&D Systems (Oxford, UK),
andthebicinchoninicacid(BCA)proteinassaywasfromPierce.PG490
(triptolide), PD98059, SB203580, SB202190, and U0126 were from
Calbiochem. Reagents for SDS-PAGE were purchased from Bio-Rad
(Hemel Hempstead, Hertfordshire, UK) and National Diagnostics
(Hessle, Hull, UK). [3H]6-keto-PGF1?was obtained from Amersham
Biosciences. The RNeasy Mini kit and the Superscript II reverse tran-
scriptase were from Qiagen Ltd. (Crawley, West Sussex, UK) and
Invitrogen, respectively. The DyNAmo SYBR Green quantitative PCR
kit was purchased from Finnzymes (Espoo, Finland). Other molecular
biology reagents were all obtained from Promega (Southampton, UK).
Culture media were purchased from Sigma or Invitrogen. All other
reagents were obtained from Sigma or BDH (Poole, Dorset, UK) at the
equivalent of AnalaR grade.
Antibodies—Polyclonal COX-1, COX-2, and phospho-p65-NF-?B
(Ser536)antibodieswerepurchasedfromSantaCruzBiotechnology,Inc.
(Santa Cruz, CA). Polyclonal antibodies against phospho-ERK1/2,
ERK1/2, p38MAPK, and p65-NF-?B were from New England Biolabs
(Beverly, MA). Anti-phospho-p38MAPKantibodies were from either
New England Biolabs or BIOSOURCE (Nivelles, Belgium). The I?B?
antibody was from Active Motif (Rixensart, Belgium). Fluorescein iso-
thiocyanate-conjugated goat anti-rabbit secondary antibodies were
obtained from Sigma. Horseradish peroxidase-conjugated goat anti-
rabbit and rabbit anti-goat immunoglobulins were from Pierce.
Cell Culture—Human umbilical vein endothelial cells (HUVEC)
were isolated and cultured as previously described (12, 24). Briefly, cells
were grown in medium M199 (Sigma) supplemented with 20% (v/v)
fetal calf serum, 4 mM glutamine, 100 units/ml penicillin, 100 units/ml
streptomycin, and 20 mM NaHCO3and cultured at 37 °C in a 5% CO2,
95% air atmosphere in 25-mm2tissue culture flasks (BD Biosciences)
precoatedwith1%(w/v)gelatin.Atconfluence,cellswerepassagedinto
75-mm2tissue culture flasks and cultured in the presence of 20 mg/ml
endothelial cell growth factor. Experiments were performed on conflu-
ent passage 2 cells grown in the appropriate gelatin-coated cell culture
dishes.
WesternBlotting—HUVECmonolayersin60-mm2dishes(?1?106
cells/dish) were serum- and endothelial cell growth factor-deprived for
16h.Quiescentcellswerethensubjectedtotreatmentsasdetailedinthe
legends to Figs. 1, 4, 5, 7, and 9. Whole cell lysates were prepared, and
immunoblotting analyses were performed as previously described (24).
Blots initially probed with antibodies against either COX-2, phospho-
ERK1/2, or phospho-p38MAPK(1:1000) were stripped by incubation in
62.5 mM Tris-HCl (pH 6.7), 2% (w/v) SDS, and 0.7% (v/v) ?-mercapto-
ethanol for 30 min at 50 °C. Following extensive washing, blots were
reprobedwithCOX-1,totalERK1/2,ortotalp38MAPK(1:1000)antibod-
ies. Immunoreactive proteins were visualized by enhanced chemilumi-
nescence. Where indicated, densitometric analyses of immunoblots
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17JOURNAL OF BIOLOGICAL CHEMISTRY 11793
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 3

were performed using a Bio-Rad scanning densitometer and Quantity
One analyzing software.
RNA Extraction and Real Time Reverse Transcription-PCR—Quies-
cent HUVECweretreatedasdescribedinthelegendstoFigs.2and5,and
RNA was extracted using a Qiagen RNeasy minikit according to the man-
ufacturer’s instructions. Total HUVEC RNA was reverse transcribed by
incubating1?gofRNAwith0.5?gofoligo(dT)15primerand200unitsof
M-Superscriptreversetranscriptasefor1hat37°C,15minat42°C,and3
min at 98°C. 10% of the resulting cDNA was amplified using the SYBR
Green quantitative PCR kit. Primers used for real time PCR were synthe-
sizedbyMWG-Biotech(MiltonKeynes,UK).The5?to3?sequencesused
were as follows: GCATCTTCTTTTGCGTCGCC (GAPDH-1 forward),
GTCATTGATGGCAACAATATCC (GAPDH-1 reverse), GCCCAG-
CACTTCACGCATCAG (COX-2 forward), and AGACCAGGCACCA-
GACCAAAGACC(COX-2reverse).ThePCRwasperformed(OpticonII)
usingthefollowingparameters:95°Cfor2min,30cyclesof93°Cfor1min,
and 60°C for 1 min and a final extension step at 60°C for 7 min. Each
analysiscontainedarangeofstandards(knownconcentrationsofthesame
targetsequence).DatawereanalyzedusingtheOpticonIImonitor2anal-
ysis software, and a standard curve was plotted that correlated cycle num-
ber with the amount of product formed after each cycle. COX-2 mRNA
levelswerenormalizedtoGAPDHforeachsample.
Analysis of NF-?B Activation Using Luciferase Adenovirus Infection—
AllviruseswereE1/E3(earlytranscribedregions)-deficientandbelongedto
theAdv5serotype.Viruseswerepropagatedin293humanembryonickid-
ney cells (American Type Culture Collection, Manassas, VA) and purified
by cesium chloride ultracentrifugation. Titers of viral stocks were deter-
minedbyplaqueassayon293cells.Replication-deficientcontroladenoviral
vector without insert (Ad0) was provided by Drs A. Byrnes and M. Wood
(OxfordUniversity).AdenovirusencodingporcineI?B?withacytomega-
lovirus promoter and a nuclear localization sequence (AdI?B?) was pro-
videdbyDr.R.deMartin(UniversityofVienna).Theadenovirusexpress-
ingmutatedhumanI?B?(tyrosine42tophenylalanine;AdI?B?Y42F)was
from Prof. J. F. Engelhardt (University of Iowa). Efficient infection of cells
(?95%) was confirmed using virus encoding bacterial ?-galactosidase at a
multiplicity of infection (MOI) of 100:1 followed by the addition of the
fluorimetric substrate, fluorescein-di-?-galactopyranoside (Sigma) (data
notshown).MeasurementofNF-?Btransactivationisbasedontheuseof
an adenovirus reporter vector, which contains a luciferase gene under the
controlofNF-?B(AdNF-?B-Luc).Thisadenovirusreporterwasprovided
by Dr. P. B. McCray, Jr. (University of Iowa) and is a modification of the
pNF-?B-Luc reporter vector (BD Biosciences/Clontech). pNF-?B-Luc
contains the firefly luciferase gene from Photinus pyralis and four tandem
copies of the NF-?B consensus sequence fused to a TATA-like promoter
from the herpes simplex virus thymidine kinase promoter. The vector
backbonealsocontainsanf1originforsingle-strandedDNAproduction,a
pUCoriginofreplication,andanampicillinresistancegeneforpropagation
and selection in Escherichia coli. Therefore, NF-?B-directed promoter
activityisestimatedasbeingproportionaltothefireflyluciferaseactivity.
For adenoviral infection, HUVEC were seeded at 80% confluence
(9,600cells)in30-mm2wellsandinfectedinserum-freemedium(RPMI
1640) with Ad0 or AdNF-?B-Luc (MOI of 100:1) with or without co-
infectionwithAdI?B?orAdI?B?Y42F(MOI100:1).After1hofinfec-
tion, medium containing free adenoviruses was replaced with complete
culture medium for 24–36 h to allow expression of the gene(s) of inter-
est. Cells were then stimulated for the time periods detailed in the leg-
end to Fig. 8, subsequently washed with sterile phosphate-buffered
saline (PBS), and lysed in 100 ?l of lysis buffer (0.65% Nonidet P-40, 10
mM Tris (pH 8.0), 1 mM EDTA, 150 mM NaCl) on ice for 5 min. 50 ?l of
lysatewereaddedtothewellsofaluminometercuvettestripcontaining
120 ?l of luciferase assay buffer (25 mM Tris-phosphate (pH 7.8), 8 mM
MgCl2, 1 mM EDTA, 1% (v/v) Triton X-100, 1% (v/v) glycerol, 1 mM
dithiothreitol, 0.5 mM ATP). Luciferase activity was measured using a
LabSystems luminometer by dispensing 30 ?l of luciferin (Bright-
GloTMluciferaseassaysystem;Promega)/assaypoint.Luciferaseactivity
was normalized in each experiment to the amount of protein.
Immunofluorescence—HUVEC were plated on 13-mm glass cover-
slips in 4-well plates (Nunc-Nalgene) and grown for 24–48 h until 80%
confluent. Following the required treatments, cells were fixed in 4%
paraformaldehyde, washed with 0.5% BSA-PBS containing 0.5% BSA
(PBS-BSA), and permeabilized in PBS-BSA supplemented with 0.1%
Triton. Coverslips were then incubated for 1 h with anti-p65NF-?B
antibodies (10 ?g/ml) in PBS-BSA at room temperature. After incuba-
tion, coverslips were washed twice in PBS-BSA and incubated with flu-
oresceinisothiocyanate-conjugatedsecondarygoatanti-rabbitantibod-
ies (1:100) for 45 min. Cells were then washed (twice), and slides were
mounted with either Fluorsave (Dako, Cambridgeshire, UK) or with
propidium iodide-containing mounting medium (Vectashield, Burl-
ingame, CA). Immunofluorescence was monitored by confocal micros-
copy using a Zeiss LSM 510 inverted microscope.
Measurement of PGI2Release—Confluent cultures of HUVEC in
24-well tissue culture trays were treated as described in the legends.
Supernatants were assayed for 6-keto-PGF1?(the stable hydrolysis
product of PGI2) by radioimmunoassay as previously described (12).
Statistical Analysis—Student’s t test or ANOVA, as appropriate,
wereusedtocomparemeansofgroupsofdata.p?0.05wasconsidered
statistically significant.
RESULTS
PAR Agonists Differentially Induce COX-2 Expression and PGI2Syn-
thesis in HUVEC—Peptide agonists for PARs have been extensively
characterized for PAR selectivity (e.g. see Ref. 32) and are currently in
wide use to interrogate the functional significance of PARs in a number
ofsystems.Wehaverecentlyshownthatthrombinenhancesexpression
of COX-2 protein and mRNA in HUVEC and that this is accompanied
by prolonged PGI2synthesis (12). We also provided evidence that the
humanPAR-2-selectiveagonistpeptideSLIGKVincreasedCOX-2pro-
tein in HUVEC and enhanced COX-2 mRNA and PGI2release after 2
and 6 h, respectively (12). To gain further insight into the regulation of
COX-2expressionandPGI2synthesisinresponsetoactivationofPARs,
we initially extended these findings by comparing, within the same
HUVECcultures,thetimecoursesofexpressionofCOX-2(mRNAand
protein)aswellasexaminingthedetailedtimecoursesofPGI2synthesis
for all three stimulants in comparison with IL-1?. Both thrombin and
SLIGKV enhanced COX-2 expression in HUVEC in a concentration-
and time-dependent manner (Fig. 1). Thrombin (1 units/ml) induced a
significant increase in COX-2 protein expression after 2 h, and this was
maintained and further increased after 4- and 8-h exposure. Similar
induction kinetics were evident in cells challenged with the PAR-1-
selective peptide TFFLRN (data not shown). In contrast, SLIGKV (100
?M)(Fig.1A)orthemetabolicallystablePAR-2peptide2F-LIGRLO(10
?M) (data not shown) maximally induced COX-2 expression after 2 h,
and this was sustained but not further enhanced with prolonged expo-
sure to peptide. In keeping with our previous findings (12), the expres-
sion of COX-1 was not significantly modified by either thrombin or
SLIGKV (Fig. 1, A and B). We next examined whether PAR-stimulated
COX-2 protein expression is accompanied by changes in COX-2
mRNA expression using real time reverse transcription-PCR analysis.
Both thrombin and SLIGKV caused a 3–4-fold increase in COX-2
mRNAexpressionafter1–2h(Fig.2).However,inSLIGKV-stimulated
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11794 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 4

HUVEC, mRNA levels declined rapidly after 1 h, whereas expression
peaked at 2 h after thrombin exposure and was still evident after 4 h.
Together,theseresultsshowthatactivationofeitherPAR-1orPAR-2in
HUVEC promotes increased COX-2 expression but that the time
courses of induction differ between agonists.
We have previously shown that exposure of HUVEC to thrombin
triggers a biphasic PGI2synthesis characterized by an initial rapid
releaseoccurringwithin30minofexposurefollowedbyasustainedand
prolonged synthesis lasting for several hours (12). Here, we have con-
firmed this effect and characterized the PGI2response to PAR-2 stim-
ulation.AsdepictedinFig.3,a30-minexposuretothrombin(1unit/ml)
markedlyenhanced(upto18-fold)formationofthestablePGI2hydrol-
ysis product, 6-keto-PGF1?, whereas little effect of either SLIGKV or
IL-1? was evident at this time point. Increasing the exposure time to
thrombin further increased release, which reached a sustained peak
between4and8h.SimilarresultswereobtainedwiththePAR-1peptide
TFFLRN (data not shown). In contrast, no significant 6-keto-PGF1?
generation was evident in SLIGKV-stimulated cells until 2–4 h after
exposure. Thus, the time of onset of PGI2synthesis as well as the mag-
nitude of the response differs between PAR agonists. To confirm the
involvement of COX-2 activity in these responses, we used the COX-2-
selective inhibitor NS398. As shown in Fig. 3 (inset), 6-keto-PGF1?for-
mationinunstimulatedHUVECandincellssubjecttoprolongedexpo-
sure to thrombin was inhibited by ?80% following pretreatment with
NS398 (1 ?M), but virtually abolished by exposure to the COX-1/2
inhibitor indomethacin. These results confirm the importance of
COX-2 activity in prolonged PGI2release in response to thrombin and
suggestthatacomponentofthrombin-inducedsynthesisdependsupon
COX-1 activity (12, 24, 52).
Involvement of MAPK Signaling Cascades in PAR-induced COX-2
ExpressionandPGI2Synthesis—WeandothershaveshownthatMAPK
signalingpathwaysareimportantregulatorsofacuteprostanoidsynthe-
sis by endothelium (24). However, the molecular mechanisms involved
in regulating prolonged endothelial prostanoid release, particularly in
response to PAR activation, remain to be determined. To define the
importance of ERK1/2 and p38MAPKas regulators of PAR-induced
COX-2 expression and prostanoid release, we initially examined the
effects of PAR agonists on the phosphorylation status of ERK1/2 and
p38MAPK.Thrombin(Fig.4A)andthePAR-1-selectivepeptideTFLLRN
(notshown)causedarapidandrobustactivationofERK1/2thatwasstill
evidentafter2hbutwassignificantlyreduced(p?0.05)comparedwith
that evident after 10 min. In contrast, stimulation with the PAR-2 pep-
FIGURE 1. Thrombin and the PAR-2-selective peptide SLIGKV induce COX-2 protein expression in HUVEC. Confluent, quiescent HUVEC were exposed to vehicle alone (C) or
thrombin (T; 1 unit/ml) for the indicated time periods (A) or to SLIGKV (SL; 50–200 ?M) for 2 h (B). Whole cell lysates were prepared and analyzed by SDS-PAGE and immunoblotting
withCOX-1andCOX-2antibodies.Immunoblotsareeachrepresentativeoffiveseparateexperimentsperformedoncellsisolatedfromfiveumbilicalcords.Datafromdensitometric
analyses are presented as mean ? S.D. (n ? 5 individual experiments). *, p ? 0.05 versus unstimulated control cells.
FIGURE 2. Effects of thrombin and SLIGKV on COX-2 mRNA expression in HUVEC.
Confluent, quiescent HUVEC were challenged with vehicle alone (Cont; control), throm-
bin (1 unit/ml), SLIGKV (100 ?M), or IL-1? (100 units/ml) for 1, 2, or 4 h. Total RNA was
extracted,andCOX-2andGAPDHmRNAswerequantifiedbyreal-timePCRasdescribed
under “Experimental Procedures.” Results, normalized to GAPDH expression, are given
as mean ? S.D. (n ? 3 individual experiments). *, p ? 0.01; #, p ? 0.001 versus unstimu-
lated control cells (ANOVA).
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17 JOURNAL OF BIOLOGICAL CHEMISTRY 11795
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 5

tide produced a rapid increase in ERK1/2 activation that did not signif-
icantly decline even after 4 h of exposure. SLIGKV also activated
p38MAPKwith similar levels of activation evident at both early and late
time points (Fig. 4B). The PAR-4-selective peptide AYPGKF promoted
activation of ERK1/2 and p38MAPKin HUVEC that was evident after 10
minofstimulation(Fig.4C),whichcontrastswithourpreviousdemon-
stration that ERK1/2 activation by thrombin or PAR-1 peptide occurs
morerapidly(1–5minofexposure)(33).However,incontrasttoPAR-1
or PAR-2 stimulation, MAPK activation in PAR-4 peptide-stimulated
cells was not associated with enhanced COX-2 expression (Fig. 4C) or
6-ketoPGF1?formation(notshown).ToexploretheroleofERK1/2and
p38MAPKactivation in PAR-induced COX-2 expression, we next deter-
mined the effects of pharmacological blockade of MEK1/2 or p38MAPK
onCOX-2proteinandmRNAlevelsinHUVECchallengedwiththrom-
bin and PAR-1- and PAR-2-selective peptides. We have shown previ-
ously that these pharmacological inhibitors block agonist-induced
MAPK activation in HUVEC in a concentration-dependent manner
(24). As shown in Fig. 5, the MEK inhibitors PD98059 (1–10 ?M) and
U0126 (0.3–3 ?M) and the p38MAPKinhibitor SB203580 (1–10 ?M)
dose-dependently reduced thrombin-induced, TFLLRN-induced (not
shown), and SLIGKV-induced COX-2 protein expression. A combina-
tionofPD98059andSB203580causedagreaterreductioninexpression
thaneitherinhibitoralone(Fig.5A).U0126andSB203580atmaximally
effective concentrations also reduced basal COX-2 mRNA and abol-
ished COX-2 mRNA induction in both thrombin- and SLIGKV-stimu-
lated endothelial cells (Fig. 5C). Blocking COX-2 activity with NS398,
however, did not affect COX-2 protein expression in thrombin-,
TFFLRN-, or SLIGKV-stimulated HUVEC (Fig. 7A). These data show
that, in contrast to COX-2 induction by IL-1?, which is minimally
affected by blockade of the MEK-ERK pathway,3COX-2 expression in
HUVECchallengedwithPARagonistsisstronglydependentuponboth
ERK1/2andp38MAPKactivation.TheyalsoshowthatCOX-2induction
bythesestimuliisindependentofCOX-2activity.TodefinetheMAPK
dependence of COX-2-derived PGI2synthesis, we examined the effects
of U0126 and SB202190 on thrombin-, SLIGKV-, and 2F-LIGRLO (not
shown)-induced 6-keto-PGF1?formation (Fig. 5D). Preexposure to
either inhibitor or to the NF-?B inhibitor PG490 markedly inhibited
3R. A. Houliston and C. P. D. Wheeler-Jones, manuscript in preparation.
FIGURE3.Delayed6-keto-PGF1?formationinPAR-2agonistpeptide-stimulatedHUVEC.ConfluentHUVECmonolayersin24-welltissueculturetrayswereexposedtothrombin
(1 unit/ml), SLIGKV (100 ?M), or vehicle control for times ranging between 30 min and 8 h. Supernatants were collected and assayed for 6-keto-PGF1?, the stable hydrolysis product
of PGI2, using radioimmunoassay. The protein contents of whole cell lysates were quantified, and 6-keto PGF1?formation is expressed as pg/?g protein. Data are presented as
mean ? S.D. (n ? 3 separate experiments each with triplicate observations per treatment). **, p ? 0.001 versus unstimulated control cells (ANOVA). The inset shows the effects of a
30-min pretreatment with either indomethacin (In; 1 ?M) or NS-398 (NS; 1 ?M) on 6-keto-PGF1?formation basally and after 4 h of stimulation with thrombin (T; 1 unit/ml) in the
continued presence of inhibitor (mean ? S.E.; n ? 3).
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11796 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 6

6-keto-PGF1?generation in response to thrombin or the PAR-2-acti-
vating peptides.
Role of NF-?B in PAR-mediated Signaling—COX-2 expression in
endothelialcellsexposedtoanumberofproinflammatoryormitogenic
stimuli is known to depend in part upon the activation of NF-?B (34–
36). To begin to define the involvement of NF-?B-dependent signaling
events in regulating prostanoid production in response to PAR activa-
tion,weinitiallyassessednucleartranslocationofp65-NF-?Bbyconfo-
calmicroscopy.AsshowninFig.6,a2-hexposuretoeitherthrombinor
IL-1?, but not the PAR-4 peptide (data not shown), caused a marked
translocation of the p65 subunit of NF-?B from the cytoplasm to the
nucleus.Notably,thePAR-2peptide2F-LIGRLOat10?Malsostrongly
inducedthenucleartranslocationofp65-NF-?B.Wenextexaminedthe
consequencesofsuppressionofNF-?BactivityonPAR-inducedCOX-2
expression. Pretreatment with the NF-?B inhibitor PG490 (25 ng/ml)
abrogated thrombin-stimulated, TFFLRN-stimulated (not shown), and
SLIGKV-stimulated COX-2 protein expression by 70–80% (Fig. 7B)
without modifying basal COX-2 protein or basal COX-2 mRNA levels
FIGURE 4. Thrombin and SLIGKV promote acti-
vation of ERK1/2 and p38MAPK. Quiescent
HUVEC monolayers were incubated with throm-
bin (1 unit/ml) or SLIGKV (100 ?M) for the times
indicated. Whole cell lysates were analyzed by
SDS-PAGE andimmunoblotting
phospecific ERK1/2 (p-ERK1/2) (A) and p38MAPK
(p-p38) (B) antibodies. Equal protein loading was
confirmed by reprobing stripped blots with anti-
bodies against total (Tot) ERK1/2 and p38MAPK.
Densitometricanalyses
p-p38MAPKimmunoblots from three separate
experiments are given as mean ? S.D. *, p ? 0.05
versus unstimulated control cells. C, HUVEC were
exposed to the PAR-4-selective peptide AYPGKF
(50 ?M) for the times indicated, and the resulting
blots were probed for phosphorylated p38MAPK,
phosphorylatedERK1/2,orCOX-2.Dataarefroma
singleexperimentrepresentativeoftwowithsim-
ilar results.
with phos-
ofp-ERK1/2and
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17JOURNAL OF BIOLOGICAL CHEMISTRY 11797
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 7

(Fig. 5C). PG490 treatment also reduced PAR-stimulated COX-2
mRNA expression by between 50 and 80% (Fig. 5C) without affecting
expression of the COX-1 isoenzyme (not shown). The proteasome
inhibitor MG-132 also partially inhibited PAR-2-selective peptide-in-
duced as well as thrombin-induced COX-2 expression (Fig. 7C). In
theseexperiments,6-keto-PGF1?generationwasalsopartlyreducedby
MG-132 treatment (28 ? 5 and 32 ? 6% inhibition of thrombin- and
SLIGKV-induced release, respectively; mean ? S.E., n ? 2–4 experi-
ments). Further parallel studies showed that sustained 6-keto-PGF1?
formation in response to thrombin, SLIGKV, or 2F-LIGRLO (not
shown) was also inhibited by blockade of NF-?B with PG490 (Fig. 5D).
Together, these results suggest that NF-?B-dependent signaling events
are important for regulating COX-2 expression and PGI2synthesis
mediated by PAR-1 and PAR-2 activation.
TofurtherinvestigatethefunctionalsignificanceofNF-?Bactivation
inresponsetoPARstimulation,weexaminedtheeffectofthrombinand
PAR-selective peptides on the transcriptional activation of NF-?B in
HUVEC infected with an adenoviral reporter containing four NF-?B
consensus sequences upstream of luciferase (37). As shown in Fig. 8A,
NF-?B-directedpromoteractivitywasincreasedbyexposuretothrom-
bin(1unit/ml)inabiphasicmannerwithsignificantactivationobserved
at both early (30 min) and late (4–6 h) exposure times. In cells infected
with a control adenovirus, no luciferase activity was observed (data not
shown). Thrombin therefore induces a biphasic activation of NF-?B in
HUVEC.Thrombin-inducedNF-?Bactivationwasalsoconcentration-
dependent (Fig. 8B), with activation detected at 0.01 units/ml and max-
imum at 1 unit/ml. We have previously shown that thrombin-driven
COX-2 expression and PGI2synthesis show similar concentration
dependences in thrombin-stimulated HUVEC (12). We next examined
the effects of PAR-1-, PAR-2-, and PAR-4-selective peptides on lucifer-
ase activity in infected endothelial cells (Fig. 8C). The PAR-1 peptide
TFLLRNstronglyincreasedluciferaseactivity,withapeakevidentat6h
FIGURE 5. MAPK inhibitors attenuate thrombin-
andSLIGKV-inducedCOX-2expressionandPGI2
synthesis. A and B, quiescent HUVEC in 60-mm2
dishes were preexposed (30 min) to the indicated
concentrations of either PD98059 (PD), SB203580
(SB), U0126 (U0), or a combination of PD98059 and
SB203580andthenexposedtothrombin(1unit/ml)
orSLIGKV(100?M)for6or4h,respectively.Proteins
in whole cell lysates were separated by SDS-PAGE
and analyzed by immunoblotting with COX-2 anti-
body. Blots are each representative of results from
three similar independent experiments. C and D,
cells were pretreated (30 min) with SB202190 (10
?M),U0126(1?M),orPG490(PG;25ng/ml)andsub-
sequentlyexposedtovehiclealone(C),thrombin(T;
1unit/ml),SLIGKV(100?M),orIL-1?(100unit/ml)in
the continued absence or presence of inhibitor.
COX-2mRNAexpressionwasquantifiedbyrealtime
PCR as described under “Experimental Procedures,”
and 6-keto-PGF1?formation was quantified by
radioimmunoassay. Data are expressed as mean ?
S.D.(n?3separateexperiments).C,*,p?0.01;#,p?
0.0001 versus unstimulated control cells; **, p ?
0.0001versusagonist-stimulatedcells.D,*,p?0.01
versus agonist-stimulated cells; #, p ? 0.0001 versus
unstimulatedcontrolcells;**,p?0.0001versusago-
nist-stimulatedorcontrolcells.
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11798 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 8

after exposure. SLIGKV, the PAR-2 peptide, also enhanced NF-?B
activity, which was smaller in magnitude than that evoked by thrombin
butwassustainedoveralongertimeperiod(Fig.8C).Consistentwithits
lack of effect on COX-2 expression and PGI2formation (Fig. 4C), the
PAR-4peptidedidnotmodifyluciferaseactivity(Fig.8C).Todefinethe
potential involvement of I?B? in mediating PAR-induced NF-?B acti-
vation, luciferase activity induced by thrombin was further analyzed
following co-infection with either a native I?B?-expressing adenovirus
(AdI?B?) or with an adenovirus overexpressing I?B? in which tyrosine
residue42wasmutatedtophenylalanine(AdI?B?Y42F).Asdepictedin
Fig. 8A, biphasic NF-?B activation by thrombin was inhibited by co-
expression of native I?B?, as was the late phase of activation at 6 h (Fig.
8D). Overexpression of the mutated I?B? also resulted in inhibition of
thrombin-inducedNF-?Bactivation(Fig.8D).Inkeepingwiththelatter
finding, and with the partial inhibition of SLIGKV- and thrombin-in-
duced COX-2 expression by MG-132 (Fig. 7C), we found that expres-
sionofI?B?proteinwasonlymarginallyreducedinHUVECexposedto
either thrombin or the PAR-2 peptide SLIGKV (Fig. 9C). Co-infection
of HUVEC with AdNF-?B-Luc and with either of the I?B? viruses
significantly inhibited 6-keto-PGF1?generation (Fig. 8D). Collectively,
these results suggest that PAR-1- and PAR-2-stimulated NF-?B activa-
tion occurs in an I?B?-dependent manner and that such pathways are
required for PAR-induced COX-2-derived PGI2synthesis.
Growing evidence suggests that posttranslational modification of
p65-NF-?B is also required for efficient transactivation of NF-?B-de-
pendentgenes(29,38,39).Wenextexaminedwhetherphosphorylation
of p65-NF-?B on serine 536 is triggered by activation of PARs on endo-
thelial cells. Incubation with thrombin or the PAR-2 peptide SLIGKV
caused a rapid and sustained increase in p65 phosphorylation without
modifying total p65-NF-?B expression (Fig. 9A). To determine the
relationship between PAR-induced ERK/p38MAPKactivation and
p65 phosphorylation, HUVEC were preexposed to the NF-?B inhib-
itor PG490, and the phosphorylation state of ERK1/2, p38MAPK, and
FIGURE 6. Nuclear translocation of NF-?B in HUVEC following stimulation with
thrombin, PAR-2-selective peptides, and IL-1?. HUVEC were treated with vehicle
(Control), thrombin, the PAR-2-selective peptide 2F-LIGRLO, or IL-1? at the indicated
concentrations for 2 h. Cells were then fixed, permeabilized, and stained with anti-
p65NF-?B antibody followed by incubation with fluorescein isothiocyanate (FITC)-con-
jugated goat anti-rabbit secondary antibody. Nuclei were counterstained with pro-
pidium iodide (PI), and immunofluorescence was monitored by confocal microscopy
(see “Experimental Procedures”). Results in each panel are representative of four sepa-
rate experiments.
FIGURE 7. PAR-induced COX-2 expression is
inhibitedbypharmacologicalblockadeofNF-?B.
A, quiescent HUVEC were preexposed for 30 min to
either the NF-?B inhibitor PG490 (25 ng/ml) or the
COX-2-selective inhibitor NS398 (1 ?M) for 30 min.
Cells were then challenged with vehicle alone (C),
thrombin (T; 1 unit/ml), the PAR-1-selective peptide
TFLLRN (TF; 100 ?M), SLIGKV (SL; 100 ?M), or IL-1?
(100units/ml)inthecontinuedabsenceorpresence
ofinhibitorfor4h.Wholecelllysateswereprepared,
and COX-1/2 protein levels were determined by
immunoblotting. The immunoblots shown are rep-
resentative of five separate experiments. B, densito-
metric analysis of immunoblotting data from five
individual experiments. Results are presented as
mean?S.D.(n?5).C,HUVECwereincubatedfor30
min with vehicle or the proteosome inhibitor
MG-132 (1 ?M) and then stimulated with either
thrombin(1unit/ml)orSLIGKV(100?M)for4h.Data
are from a representative experiment with four
experimentsshowingsimilarresults.*,p?0.05ver-
sus expression in unstimulated control cells. #, p ?
0.05versusagonist-stimulatedexpression.
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17JOURNAL OF BIOLOGICAL CHEMISTRY 11799
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 9

p65-NF-?B was assessed using phosphospecific antibodies. As shown
in Fig. 9D, blockade of NF-?B activity did not affect thrombin- or
SLIGKV-induced activation of either ERK1/2 or p38MAPK. Similarly,
inhibition of MEK with U0126 or of p38MAPKwith SB202190 did not
modify PAR-2-induced phosphorylation of NF-?B on serine 536 but
partially reduced thrombin-stimulated p65-NF-?B phosphorylation
(Fig. 9E). These results suggest that phosphorylation of p65-NF-?B on
serine 536 in HUVEC exposed to PAR-2 activators, but not thrombin,
occurs independently of MEK-ERK- or p38MAPK-mediated signaling.
DISCUSSION
In the present study, we have demonstrated that in human endothe-
lial cells, thrombin- and PAR-2 agonist peptide-driven COX-2 expres-
sion and sustained PGI2synthesis require the activation of ERK1/2 and
p38MAPKsignalingpathwaysaswellasNF-?Bactivity.Wefurthershow
that PAR-mediated NF-?B activation is accompanied by p65 phospho-
rylation and is dependent upon I?B?. This is the first report to demon-
strate a functional link between PARs and COX-2-derived endothelial
PGI2production involving MAPKs and NF-?B pathways.
Thrombin is known to exert its cellular effects through activation of
PAR-1. However, there is some evidence of transactivation of PAR-2
through cleaved PAR-1 (40). In the present study, we observed that
thrombin and PAR-2-selective peptides induced COX-2 expression.
Although it is possible that the up-regulatory effects of thrombin on
COX-2 and on MAPK activation may be partially mediated through
PAR-2 transactivation, the PAR-2-selective peptides employed in the
present study do not activate PAR-1, thus indicating that PAR-2-pep-
tide-induced effects occur predominantly through PAR-2 activation. In
addition, COX-2 up-regulation, as well as MAPK activation and PGI2
synthesis, was marked by differences in kinetics and magnitude in
FIGURE 8. Thrombin and SLIGKV stimulate transcriptional activity of NF-?B. A, HUVEC were infected with an NF-?B luciferase adenovirus and co-infected with adenovirus
overexpressing native I?B? (AdI?B?) or with empty adenovirus (Ad0) both at MOI 100:1. Cells were subsequently treated with thrombin (1 unit/ml) for the times indicated, and
luciferase activity was quantified as described under “Experimental Procedures.” Data are mean ? S.D. (n ? 4) from a single experiment representative of three with similar results.
B,HUVECinfectedwithNF-?Bluciferaseadenoviruswereexposedtothrombinfor4hattheindicatedconcentrations.Resultsaregivenasmean?S.E.(n?3experiments).C,HUVEC
infected with NF-?B luciferase adenovirus (MOI 100:1) were stimulated with PAR-agonist peptides (100 ?M; PAR-1, TFLLRN; PAR-2, SLIGKV; PAR-4, AYPGKF) for the indicated time
periods. Data are mean ? S.E. from four individual experiments. Data in D are from thrombin-stimulated HUVEC co-infected with the NF-?B luciferase adenovirus and either the
adenovirusoverexpressingI?B?(AdI?B?)oravirusencodingamutatedI?B?(AdI?B?Y42F).Datashowninopencolumns(leftyaxis)areexpressedaspercentageofluciferaseactivity
observedinthrombin-stimulated,Ad0-infectedcellsand6-keto-PGF1?formation(closedsymbols;rightyaxis)wasquantifiedinparallelbyradioimmunoassay.Resultsaremeans?
S.E.fromsevenindividualexperiments.*,p?0.05;***,p?0.001versusunstimulatedcontrolcellsbyone-wayANOVA.#,p?0.05;###,p?0.001versusAd0-infectedcellsbyone-way
ANOVA.
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11800 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 10

HUVEC exposed to thrombin versus PAR-2-selective peptides.
Whereas these differences may well be explained by a difference in
potencyofPAR-1versusPAR-2agonistsattheirreceptors,thepossibil-
itythatthesedifferencescouldhavefunctionalsignificanceissuggested
by the fact that the PAR-2-selective peptide, unlike thrombin or the
PAR-1-selective peptide, does not promote acute prostanoid synthesis.
ThismayreflectaninabilityofPAR-2agoniststoactivateacutecalcium-
dependent pathways in HUVEC that are required for rapid prostanoid
production (24). Although the ability of thrombin to promote prostan-
oid release in several tissues is well documented, the potential roles of
proteases and their receptors in regulating sustained endothelial cell
PGI2synthesis have received little attention, and few reports document
theabilityofthrombintopromoteprolongedprostanoidproductionvia
COX-2 induction in these cells (12, 39). However, our results are con-
sistent with those of a recent study showing that activated protein C, as
well as thrombin, can induce COX-2 expression in HUVEC through
activation of PAR-1-mediated signaling (42).
Endothelial PGI2production in response to thrombin or PAR-2 pep-
tides occurred with different time courses and to different extents. As
previously reported (12) PGI2release in thrombin-stimulated cells was
characterized by an initial rapid increase (principally COX-1-derived)
and a later prolonged and sustained phase lasting several hours. The
extent of inhibition of thrombin-driven PGI2release by COX-2 block-
ade with NS-398 versus that with indomethacin (COX-1/2 inhibitor)
confirms the COX-2 dependence of chronic PAR-induced prostanoid
synthesisaswellasthecontributionfromCOX-1tooverallsynthesis.In
marked contrast, our present studies with the PAR-2-selective peptide
have shown that SLIGKV does not trigger an acute release of PGI2
synthesis but that release was only detectable 2–4 h after peptide expo-
sure and was sustained thereafter. These differential effects of PAR-1
versus PAR-2 activation were concomitant with increased COX-2 pro-
tein levels at the same time points and were not accompanied by
changes in COX-1 expression.
Our present data report an up-regulation of COX-2 and COX-2-
derived PGI2synthesis in HUVEC in response to PAR-1 and PAR-2
activation. The observation that PARs are capable of stimulating COX-
2-drivenPGI2releaseemphasizesthepathophysiologicalsignificanceof
PAR-1 and PAR-2 activation by circulating proteases and suggests
that they contribute to the early inflammatory response by tran-
siently increasing COX-2 expression and PGI2synthesis. Although
the endogenous ligand(s) responsible for driving COX-2 induction
in HUVEC through PAR-2 activation remain to be defined, our pre-
liminary data indicate that ligands previously identified as PAR-2-
FIGURE 9. Thrombin and SLIGKV promote early
phosphorylation of p65-NF-?B in HUVEC. Cells
were stimulated with vehicle alone (C), thrombin
(T; 1 unit/ml), SLIGKV (SL; 100 ?M), or IL-1? (100
units/ml) for the times indicated. Proteins in cell
lysates were then separated by SDS-PAGE and
analyzed by immunoblotting with phosphospe-
cificp65-NF-?Bortotalp65-NF-?Bantibodies(A,B
(left), C, and E) or with an antibody raised against
totalI?B?(C,right).D,HUVECwerepreexposedto
PG490 (25 ng/ml) and then challenged with vehi-
cle alone (C), thrombin (T; 1 units/ml), or SLIGKV
(100 ?M) for 10 or 30 min in the presence or
absence of PG490. The phosphorylation status of
p65-NF-?B, ERK1/2, and p38MAPKwere each
assessed by immunoblotting with phosphospe-
cific antibodies. E, cells were preincubated with
vehicle alone (C), SB202190 (SB; 1 ?M), or U0126
(U0;1?M)andthenexposedtoSLIGKV(100?M)or
thrombin (1 unit/ml) in the continued absence or
presence of inhibitor for the times shown. The
resulting blots were probed with an anti-phos-
pho-p65-NF-?B antibody. Immunoblots in each
panelarerepresentativeoftwoorthreeindividual
experiments.
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17JOURNAL OF BIOLOGICAL CHEMISTRY 11801
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 11

selective (e.g. tryptase; trypsin) are capable of enhancing COX-2
expression in HUVEC.
COX-2 induction in the inflammatory setting has largely been con-
sidered deleterious, but relatively less is known about its role under
normal physiological conditions. Our current data, along with our pre-
vious studies (12, 24), have shown that PGI2synthesis occurs in resting
unperturbed endothelial cells. Our data also indicate that, under our
experimentalcultureconditions,unstimulatedHUVECculturesexhibit
variableCOX-2expression.Whereasthiscouldbedueatleastinpartto
serum-stimulated induction, inhibition of basal PGI2synthesis by the
COX-2-selective inhibitor NS-398 would support the suggestion that a
component of basal release is COX-2-derived under the conditions of
our experiments. Although there is evidence that human and mouse
arteries express COX-2 ex vivo (43), further studies are required to
unequivocally demonstrate that COX-2 is present in normal endothe-
lium. PAR-2 expression in endothelium and other cells is known to be
stronglyinducedbyproinflammatorystimuli(17),andPAR-2-mediated
events can then exacerbate inflammation-based disease (44). Impor-
tantly, our results clearly show that prostanoid production in response
to PAR-2 activation occurs without the requirement for pretreatment
with a proinflammatory stimulus, suggesting that PAR-2 activation and
its associated signaling events are physiologically relevant components
of transient (and hence resolved) inflammation. The significance of
thesefindingsandthepotentialprotectiveroleofthePAR-COX-2-PGI2
axis in the vasculature are highlighted by the observations that produc-
tion of circulating PGI2is COX-2-dependent (45) and that COX-2-
derived PGI2reduces the detrimental vascular remodeling associated
with hemodynamic stress (46). Protective roles for COX-2-derived
mediators have also been reported in lung (47) and during ischemic
preconditioning, where COX-2-derived PGI2synthesis is up-regulated
and exerts cardioprotective effects (48).
Ligand binding to G-protein-coupled receptors leads to the activa-
tion of MAPK signaling cascades, and PAR-mediated signaling in a
number of cell types is known to involve activation of one or more
MAPK cascades (1, 49). In endothelial cells, we and others have shown
that activation of ERK1/2 and p38MAPKis triggered by a number of
cytokinesincludingtumornecrosisfactor-?andIL-1?(50,51)aswellas
growth factors such as vascular endothelial growth factor (52). How-
ever, there are few reports of MAPK signaling in response to PAR acti-
vation in human endothelial cells. In the present work, we investigated
the potential role of MAPKs in PAR-induced COX-2 expression. We
demonstrate that both ERK1/2 and p38MAPKpathways are required for
the induction of COX-2 in response to thrombin and PAR-2 activation.
Pharmacological inhibition of either ERK1/2 or p38MAPKabrogated
PAR-induced COX-2 protein and mRNA expression as well as PGI2
synthesis.However,PD98059andSB203580areknowntoblockCOX-1
andCOX-2activitiesinanonspecificmanner(24,53);hence,wedonot
rule out the possibility that the substantial decreases in PGI2levels
observed in the presence of these inhibitors could partly result from
inhibition of COX enzyme activities. We have shown, however, that
U0126 has no significant effect on COX activity (24). In addition,
thrombin-inducedCOX-2expressionwasnotmodifiedbypreexposure
to either indomethacin (COX-1/-2 inhibitor) or the COX-2-selective
inhibitor NS-398, suggesting that inhibition of COX-2 expression by
PD98059 and SB202190 results from kinase blockade. These results
indicate that the ERK1/2 and p38MAPKfamilies are activated by stimu-
lation of endothelial PAR-1 and PAR-2 receptors and that these path-
ways are critical regulators of PAR-induced COX-2 expression and
PGI2synthesis. Whereas it is clear that PAR-1- and PAR-2-induced
MAPK activation is functionally linked to prostanoid generation, the
PAR-4-selective peptide failed to promote either COX-2 expression
or PGI2release, despite its ability to induce both ERK1/2 and
p38MAPKphosphorylation. It is possible that PAR-4 contributes to
COX-2 induction at higher thrombin concentrations (49) and/or
that this receptor does not normally participate in regulating endo-
thelial prostanoid production (4).
NF-?B is known to be involved in the transcriptional regulation of
several immune and inflammatory markers, including the COX-2 gene
(35). In the current work, we investigated the involvement of this tran-
scription factor in PAR-induced COX-2 up-regulation. Thrombin, the
PAR-1-selectivepeptide,andthePAR-2-selectivepeptideallstimulated
the transcriptional activity of NF-?B. Our data showing a failure of the
PAR-4 peptide to promote NF-?B activation in AdNF-?B-Luc-infected
HUVEC corroborate the lack of effect of PAR-4 activation on COX-2
expression. NF-?B activation by PARs was associated with transloca-
tion of p65-NF-?B to the nucleus and coincided temporally with PAR-
induced COX-2 expression and sustained PGI2formation. The NF-?B
inhibitor PG490 also attenuated PAR-induced COX-2 expression as
wellasPGI2synthesis,providingfurthersupportforthehypothesisthat
signaling to NF-?B plays a critical role in COX-2 induction and endo-
thelial prostacyclin release.
NF-?B activation in response to proinflammatory stimuli as well as
growth factors involves phosphorylation of the I?B? protein. Recruit-
ment and activation of the classical I?B-kinase (IKK) complex (includ-
ing IKK? and IKK?) leads to serine phosphorylation of I?B and subse-
quent degradation via the proteasome pathway. An alternative
mechanism for NF-?B activation involves tyrosine (Tyr42) phosphoryl-
ation of I?B?, and this pathway does not require I?B? degradation
(reviewed in Refs. 29 and 38). We used recombinant adenoviruses
encoding wild-type I?B? and mutated I?B? (Y42F) to begin to probe
the potential involvement of I?B?-dependent pathways in PAR-in-
duced NF-?B activation and hence in COX-2 expression and PGI2syn-
thesis. We found that NF-?B activation was inhibited by co-infection
with either AdI?B? or AdI?B?Y42F, suggesting that I?B?-dependent
activationofNF-?BoccursinendothelialcellsexposedtoPARagonists.
Moreover, PAR-driven PGI2formation was also significantly abrogated
incellsoverexpressingeitherI?B?orI?B?Y42F,providingevidencefor
a role for I?B? in regulating PGI2synthesis in response to PARs activa-
tion.TheinhibitionofNF-?BactivationbyinfectionwithAdI?B?Y42F
raises the possibility that tyrosine phosphorylation of I?B? participates
in regulating PAR-mediated responses in HUVEC. Indeed, recent stud-
ies using AdI?B?Y42F have indicated that tyrosine phosphorylation of
I?B? contributes to regulation of vascular endothelial growth factor-
induced NF-?B activation in HUVEC,4a growth factor that we have
previously shown induces COX-2 expression and PGI2synthesis in
human endothelial cells (12). The kinase(s) responsible for triggering
tyrosine phosphorylation of I?B? in various cell types are not defined,
but recent evidence suggests that c-Src is a possible candidate mediator
of this event in macrophages (54). In this respect, we have previously
shown that c-Src activity is required for PAR-stimulated ERK1/2 acti-
vation in HUVEC, suggesting that activation of c-Src is a component
of PAR signaling (55). Our observations that marginal I?B? degra-
dation occurs following PAR-1 or PAR-2 activation and that the
proteosome inhibitor MG-132 only partially reduces PAR-induced
COX-2 expression and PGI2formation lend support to the possibil-
ity that PAR-mediated NF-?B activation and its downstream events
in HUVEC are regulated principally through degradation-indepen-
dent pathways.
4J. Grosjean, S. Kiriakidis, K. Reilly, M. Feldmann, and E. Paleolog, submitted for
publication.
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11802 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 12

Increasing evidence suggests that post-translational modifications of
NF-?B proteins are required for efficient gene transcription. In partic-
ular,phosphorylationofp65-NF-?BonSer536regulatesitstransactivat-
ing ability following binding to its consensus sequence (10, 56). We
determined whether PAR agonists modify phosphorylation of p65-
NF-?B on Ser536. We found that thrombin and SLIGKV, as well as
IL-1?,stimulatedarapidandsustainedincreaseinthephosphorylation
stateofp65-NF-?B.SincethetimecourseofNF-?Bphosphorylationin
responsetoeitherthrombinorPAR-2peptidecoincidedwiththekinet-
icsofERK1/2andp38MAPKphosphorylation,weexaminedthepotential
for interaction between these pathways to regulate PAR-induced p65
phosphorylation. Blockade of NF-?B activity did not affect PAR-in-
ducedERK1/2orp38MAPKactivation,confirmingthatMAPKactivation
does not require NF-?B activity. However, inhibition of either MEK or
p38MAPKpartially inhibited thrombin-induced p65 phosphorylation
withoutmodifyingtheresponsetoPAR-2activation.Theidentityofthe
kinase(s) that phosphorylates p65-NF-?B in response to PAR-1 and
PAR-2 activation is unknown, but our data suggest that p65 phospho-
rylation on Ser536in thrombin-stimulated but not PAR-2 peptide-stim-
ulated endothelial cells is at least partially dependent upon ERK1/2 and
p38MAPKactivities. This would be consistent with a role for p65 phos-
phorylation in regulating thrombin-induced COX-2 expression and
PGI2release. Our findings do not rule out the possibility that PAR acti-
vation may be accompanied by changes in the phosphorylation state of
p65onsitesotherthanSer536orthatPAR-stimulatedkinasesotherthan
the MAPKs are involved in regulating Ser536phosphorylation. The
mechanismsmediatingtheearlyphosphorylationofp65-NF-?Bandits
significance for PAR-mediated COX-2 induction remain to be eluci-
dated. Potential candidates involved in this regulation, including
IKK?/? and the Akt pathway, are currently under examination in our
laboratory.
Inconclusion,thisstudyhasdemonstratedthatERK1/2andp38MAPK
as well as the NF-?B pathway participate in the PAR-mediated regula-
tion of COX-2 expression and hence regulate sustained PGI2synthesis
by human endothelial cells exposed to PAR activators. These findings
provide new insights into the molecular mechanisms used by proteases
and PARs to regulate generation of the cytoprotective molecule PGI2
through changes in endothelial COX-2 expression.
Acknowledgments—We thank the midwives and staff of the London Hospital
and the Portland Hospital for Women and Children for help in providing
umbilical cords. We are grateful to Drs. A. Byrnes and M. Wood (Oxford
University),Dr.R.deMartin(UniversityofVienna),andDr.P.McCrayJr.and
Prof. J. Engelhardt (University of Iowa) for provision of adenoviruses. We also
thank Elaine Shervill and Helen Smith for expert technical assistance.
REFERENCES
1. Macfarlane, S. R., Seatter, M. J., Kanke, T., Hunter, G. D., and Plevin, R. (2001)
Pharmacol. Rev. 53, 245–282
2. Hollenberg, M. D. (2005) J. Pharmacol. Sci. 97, 8–13
3. Mason, J. C., Lidington, E. A., Yarwood, H., Lubin, D. M., and Haskard, D. O. (2001)
Arthritis Rheum. 44, 138–150
4. Kataoka, H., Hamilton, J. R., McKemy, D. D., Camerer, E., Zheng, Y. W., Cheng, A.,
Griffin, C., and Coughlin, S. R. (2003) Blood 102, 3224–3231
5. Takeuchi, T., Harris, J. L., Huang, W., Yan, K. W., Coughlin, S. R., and Craik, C. S.
(2000) J. Biol. Chem. 275, 26333–26342
6. Wheeler-Jones,C.P.,May,M.J.,Houliston,R.A.,andPearson,J.D.(1996)FEBSLett.
388, 180–184
7. Ludeman,M.J.,Kataoka,H.,Srinivasan,Y.,Esmon,N.L.,Esmon,C.T.,andCoughlin,
S. R. (2005) J. Biol. Chem. 280, 13122–13128
8. Minami, T., Sugiyama, A., Wu, S. Q., Abid, R., Kodama, T., and Aird, W. C. (2004)
Arterioscler. Thromb. Vasc. Biol. 24, 41–53
9. Tang, H., Low, B., Rutherford, S. A., and Hao, Q. (2005) Blood 105, 1977–1985
10. Mattioli,I.,Sebald,A.,Bucher,C.,Charles,R.-P.,Nakano,H.,Doi,T.,Kracht,M.,and
Schmitz, M. L. (2004) J. Immunol. 172, 6336–6344
11. Chung, A., Wildhirt, S. M., Wang, S., Koshal, A., and Radomski, M. W. (2005) J. Tho-
rac. Cardiovasc. Surg. 129, 782–790
12. Houliston,R.A.,Keogh,R.J.,Sugden,D.,Dudhia,J.,Carter,T.D.,andWheeler-Jones,
C. P. D. (2002) Thromb. Haemost. 88, 321–328
13. Shirotani, M., Yui, Y., Hattori, R., and Kawai, C. (1991) Prostaglandins 41, 97–110
14. Stratton, R., Rajkumar, V., Ponticos, M., Nichols, B., Shiwen, X., Black, C. M., Abra-
ham, D. J., and Leask, A. (2002) FASEB J. 14, 1949–19451
15. Fiorucci, S., Mencarelli, A., Palazzetti, B., Distrutti, E., Vergnolle, N., Hollenberg,
M. D., Wallace, J. L., Morelli, A., and Cirino, G. (2001) Proc. Natl. Acad. Sci. 98,
13936–13941
16. Ferrell, W. R., Lockhart, J. C., Kelso, E. B., Dunning, L., Plevin, R., Meek, S. E., Smith,
A. J., Hunter, G. D., McLean, J. S., McGarry, F., Ramage, R., Jiang, L., Kanke, T., and
Kawagoe, J. (2003) J. Clin. Invest. 111, 35–41
17. Nystedt, S., Ramakrishnan, V., and Sundelin, J. (1996) J. Biol. Chem. 271,
14910–14915
18. Fitzpatrick, F. A. (2004) Curr. Pharm. Des. 10, 577–588
19. Pruzanski, W., Stefanski, E., Vadas, P., Kennedy, B. P., and van den Bosch, H. (1998)
Biochim. Biophys. Acta 27, 47–56
20. Minghetti, L. (2004) J. Neuropathol. Exp. Neurol. 63, 90–110
21. Dean, J. L., Sarsfield, S. J., Tsounakou, E., and Saklatvala, J. (2003) J. Biol. Chem. 278,
39470–39476
22. LaPointe, M. C., and Isenovic, E. (1999) Hypertension 33, 276–282
23. Lin,C.C.,Sun,C.C.,Luo,S.F.,Tsai,A.C.,Chien,C.S.,Hsiao,L.D.,Lee,C.W.,Hsieh,
J. T., and Yang, C. M. (2004) J. Biomed. Sci. 11, 377–390
24. Houliston,R.A.,Pearson,J.D.,andWheeler-Jones,C.P.D.(2001)Am.J.Physiol.281,
C1266–C1276
25. Chen, J., Zhao, M., Rao, R., Inoue, H., and Hao, C. M. (2005) J. Biol. Chem. 280,
16354–16359
26. Caramori, G., Adcock, I. M., and Ito, K. (2004) Curr. Opin. Investig. Drugs. 11,
1141–1147
27. Brown, M., McGuinness, M., Wright, T., Ren, X., Wang, Y., Boivin, G. P., Hahn, H.,
Feldman, A. M., and Jones, W. K. (2005) Am. J. Physiol. 289, H466–H476
28. Misra, A., Haudek, S. B., Knuefermann, P., Vallejo, J. G., Chen, Z. J., Michael, L. H.,
Sivasubramanian,N.,Olson,E.N.,Entman,M.L.,andMann,D.L.(2003)Circulation
108, 3075–3078
29. Schmitz, M. L., Mattioli, I., Buss, H., and Kracht, M. (2004) Chembiochem 5,
1348–1358
30. Bretschneider, E., Wittpoth, M., Weber, A. A., Glusa, E., and Schror, K. (1997) Bio-
chem. Biophys. Res. Commun. 235, 365–368
31. Bretschneider, E., Kaufmann, R., Braun, M., Wittpoth, M., Glusa, E., Nowak, G., and
Schror, K. (1999) Br. J. Pharmacol. 126, 1735–1740
32. Kawabata, A., Kanke, T., Yonezawa, D., Ishiki, T., Saka, M., Kabeya, M., Sekiguchi, F.,
Kubo, S., Kuroda, R., Iwaki, M., Katsura, K., and Plevin, R. (2004) J. Pharmacol. Exp.
Ther. 309, 1098–1107
33. Keogh, R. J., Houliston, R. A., and Wheeler-Jones, C. P. (2002) Biochem. Biophys. Res.
Commun. 290, 1470–1477
34. Monaco, C., and Paleolog, E. (2004) Cardiovasc. Res. 61, 671–682
35. Tsai, S. H., Liang, Y. C., Chen, L., Ho, F. M., Hsieh, M. S., and Lin, J. K. (2002) J. Cell.
Biochem. 84, 750–758
36. Nadjar, A., Tridon, V., May, M. J., Ghosh, S., Dantzer, R., Amedee, T., and Parnet, P.
(2005) J. Cereb. Blood Flow Metab. 25, 1047–1059
37. Sanlioglu, S., Williams, C. M., Samavati, L., Butler, N. S., Wang, G., McCray, P. B., Jr.,
Ritchie, T. C., Hunninghake, G. W., Zandi, E., and Engelhardt, J. F. (2001) J. Biol.
Chem. 276, 30188–30198
38. Viatour,P.,Merville,M.P.,Bours,V.,andChariot,A.(2005)TrendsBiochem.Sci.30,
43–52
39. Doyle,S.L.,Jefferies,C.A.,andO’Neill,L.A.(2005)J.Biol.Chem.280,23496–23501
40. O’Brien,P.J.,Prevost,N.,Molino,M.,Hollinger,M.K.,Woolkalis,M.J.,Woulfe,D.S.,
and Brass, L. F. (2000) J. Biol. Chem. 275, 13502–13509
41. Sato, T., Sawada, S., Tsuda, Y., Komatsu, S., Akamatsu, N., Kono, Y., Higaki, T.,
Imamura, H., Tada, Y., Yamasaki, S., Tamagaki, T., Nakagawa, K., Tsuji, H., and
Nakagawa, M. (1999) J. Pharmacol. Toxicol. Methods 41, 173–182
42. Brueckmann, M., Horn, S., Lang, S., Fukudome, K., Schulze Nahrup, A., Hoffmann,
U.,Kaden,J.J.,Borggrefe,M.,Haase,K.K.,andHuhle,G.(2005)Thromb.Haemostasis
93, 743–750
43. Grosser, T., Fries, S., and FitzGerald, G. A. (2006) J. Clin. Invest. 116, 4–15
44. Holzhausen, M., Spolidorio, L. C., and Vergnolle, N. (2005) J. Dent. Res. 84,
154–159
45. McAdam, B. F., Catella-Lawson, F., Mardini, I. A., Kapoor, S., Lawson, J. A., and
FitzGerald, G. A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 272–277
46. Rudic, R. D., Brinster, D., Cheng, Y., Fries, S., Song, W. L., Austin, S., Coffman, T. M.,
and FitzGerald, G. A. (2005) Circ. Res. 96, 1240–1247
47. Fukunaga, K., Kohli, P., Bonnans, C., Fredenburgh, L. E., and Levy, B. D. (2005)
J. Immunol. 174, 5033–5039
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
APRIL 28, 2006•VOLUME 281•NUMBER 17JOURNAL OF BIOLOGICAL CHEMISTRY 11803
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from

Page 13

48. Wang, Y., Kodani, E., Wang, J., Zhang, S. X., Takano, H., Tang, X. L., and Bolli, R.
(2004) Circ. Res. 95, 84–91
49. Sabri, A., Guo, J., Elouardighi, H., Darrow, A. L., Andrade-Gordon, P., and Steinberg,
S. F. (2003) J. Biol. Chem. 278, 11714–11720
50. May, M. J., Wheeler-Jones, C. P. D., Houliston, R. A., and Pearson, J. D. (1998) Am. J.
Physiol. 274, C789–C798
51. Pru, J. K., Lynch, M. P., Davis, J. S., and Rueda, B. R. (2003) Reprod. Biol. Endocri-
nol. 1, 17
52. Gliki, G., Abu-Ghazaleh, R., Jezequel, S., Wheeler-Jones, C., and Zachary, I. (2001)
Biochem. J. 353, 503–512
53. Borsch-Haubold, A. G., Pasquet, S., and Watson, S. P. (1998) J. Biol. Chem. 273,
28766–28772
54. Abu-Amer, Y., Ross, F. P., McHugh, K. P., Livolsi, A., Peyron, J. F., and Teitelbaum,
S. L. (1998) J. Biol. Chem. 273, 29417–29423
55. Keogh, R. J., Houliston, R. A., and Wheeler-Jones, C. P. (2002) Biochem. Biophys. Res.
Commun. 294, 1001–1008
56. Jiang, X., Takahashi, N., Ando, K., Otsuka, T., Tetsuka, T., and Okamoto, T. (2003)
Biochem. Biophys. Res. Commun. 301, 583–590
PAR-inducedCOX-2ExpressionandProstanoidSynthesis
11804 JOURNAL OF BIOLOGICAL CHEMISTRYVOLUME 281•NUMBER 17•APRIL 28, 2006
at MRC National Institute for Medical Research, on August 20, 2010
www.jbc.org
Downloaded from