Interlaboratory comparison of PCR-based methods for detection of penicillin G susceptibility in Neisseria meningitidis.

Abstract

We carried out a study for the nonculture detection of susceptibility of Neisseria meningitis to penicillin G in three laboratories of the European Monitoring Group on Meningococci (EMGM). Thirteen clinical samples (cerebrospinal fluids) and corresponding bacterial isolates from 13 cases of invasive meningococcal infection were distributed to the three laboratories. The MICs of penicillin G were determined for the isolates. Each laboratory used an "in-house" PCR-based method to determine alterations to the penA gene, which is associated with a reduced susceptibility to penicillin G. Nucleotide sequences from the 3' end of the penA gene were also determined. We observed a good correlation between genotyping of penA and the phenotypic determination (MIC) of susceptibility to penicillin G. The results obtained by the three methods for penA in the samples correlated very well with those obtained in bacterial isolates and with sequence data. The kappa coefficient that was used to estimate the level of agreement between genotypic results varied between 0.65 and 1, indicating a good agreement. This suggests that genotyping can predict susceptibility of N. meningitidis to penicillin G. These data strongly suggest that genotyping of penA should be used to determine meningococcal susceptibility to penicillin G in culture-negative cases. Although the nucleotide sequence of penA may be the gold standard in genotyping of penA, the less expensive PCR-based approach reported in this study may be quicker when a large number of isolates and clinical samples need to be tested.

Full text

Page 1

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2006, p. 887–892
0066-4804/06/$08.00?0 doi:10.1128/AAC.50.3.887–892.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 50, No. 3
Interlaboratory Comparison of PCR-Based Methods for Detection
of Penicillin G Susceptibility in Neisseria meningitidis
Muhamed-Kheir Taha,1* Maria Leticia Zarantonelli,1Arianna Neri,2Rocı ´o Enriquez,3
Julio A. Va ´zquez,3and Paola Stefanelli2
Neisseria Unit and the French National Reference Center for Meningococci, Institut Pasteur, Paris, France1; Department of Infectious,
Parasitic, and Immune-Mediated Diseases, Istituto Superiore di Sanita, Rome, Italy2; and Reference Laboratory for Neisserias,
National Center for Microbiology, National Institute of Health Carlos III, Majadahonda, Madrid, Spain3
Received 15 June 2005/Returned for modification 21 August 2005/Accepted 11 December 2005
We carried out a study for the nonculture detection of susceptibility of Neisseria meningitis to penicillin G in
three laboratories of the European Monitoring Group on Meningococci (EMGM). Thirteen clinical samples
(cerebrospinal fluids) and corresponding bacterial isolates from 13 cases of invasive meningococcal infection
were distributed to the three laboratories. The MICs of penicillin G were determined for the isolates. Each
laboratory used an “in-house” PCR-based method to determine alterations to the penA gene, which is asso-
ciated with a reduced susceptibility to penicillin G. Nucleotide sequences from the 3? end of the penA gene were
also determined. We observed a good correlation between genotyping of penA and the phenotypic determination
(MIC) of susceptibility to penicillin G. The results obtained by the three methods for penA in the samples
correlated very well with those obtained in bacterial isolates and with sequence data. The kappa coefficient that
was used to estimate the level of agreement between genotypic results varied between 0.65 and 1, indicating a
good agreement. This suggests that genotyping can predict susceptibility of N. meningitidis to penicillin G.
These data strongly suggest that genotyping of penA should be used to determine meningococcal susceptibility
to penicillin G in culture-negative cases. Although the nucleotide sequence of penA may be the gold standard
in genotyping of penA, the less expensive PCR-based approach reported in this study may be quicker when a
large number of isolates and clinical samples need to be tested.
Culture-negative cases are frequently found in suspected
meningococcal infections, particularly after early antibiotic
treatment (9). Molecular methods have been developed for the
nonculture diagnosis (identification and genogrouping) of
Neisseria meningitidis, which reduces the time needed for de-
tection and characterization of N. meningitidis in culture-neg-
ative clinical samples (25). The immediate management of
invasive meningococcal infections requires rapid diagnosis and
prompt and adequate antibiotic therapy. The first choice anti-
biotics for treating invasive meningococcal infections are beta-
lactams. However, an increasing number of meningococcal
isolates are showing reduced susceptibility to penicillin G.
These isolates are known as PenIand are defined as having an
MIC between 0.094 mg/liter and 2 mg/liter. The biological
significance of this phenotype remains to be determined for
therapy by penicillin G. The emergence of meningococcal
strains with an MIC of ?1 mg/liter can cause treatment to fail
because this threshold corresponds to the therapeutic concen-
tration obtained in the cerebrospinal fluid (CSF) during treat-
ment with penicillin G (13). PenIisolates account for 33%,
27.2%, and 37% of the total meningococcal isolates in France,
Italy (2004), and Spain, respectively (4, 24, 28). However, a
recent interlaboratory study showed that participating labora-
tories were able to detect the PenIisolates in 18.2% to 100%
of cases (29). Moreover, there is no information available on
antibiotic susceptibility for culture-negative cases. Therefore, a
consensus molecular method is needed for the reliable predic-
tion of meningococcal susceptibility to antibiotics. Three pen-
icillin-binding proteins (PBP1, PBP2, and PBP3) can be de-
tected in N. meningitidis, as also reported for the closely related
species Neisseria gonorrhoeae (6). Genes encoding additional
PBP have also been found in the complete genome sequence
of two strains of N. meningitidis (17, 27). The reduced suscep-
tibility of N. meningitidis to penicillin G involves alterations to
penicillin-binding protein 2 (PBP2) (21). In all PenIisolates,
between five and eight positions in the C-terminal part of PBP2
(amino acids 427 to 581) are modified (3). These modifications
are directly linked to a reduced susceptibility of N. meningitidis
to penicillin G and can be revealed by sequencing penA (3).
This study reports three rapid methods to detect penA poly-
morphisms. The first method amplifies the 3? part of the penA
gene and then uses restriction fragment length polymorphism
analysis to reveal alterations to penA and thus predict de-
creased susceptibility to penicillin G (2). The second method
uses a real-time PCR assay to detect one of the alterations to
the penA gene, which has been chosen as a marker of penA
modifications: a different melting temperature between PenI
and PenSisolates (22). The third method uses a differential
PCR, in which oligonucleotides were designed to obtain a
positive PCR only when penA is not altered, thus indicating an
isolate susceptible to penicillin G. These methods were applied
to meningococcal isolates for the rapid screening of the peni-
cillin-intermediate genotype (2, 22, 24). Moreover, these meth-
ods can be directly applied to clinical samples, such as cere-
brospinal fluid and blood, and allow a rapid and easily
interpretable detection of PenIisolates without requiring cul-
* Corresponding author. Mailing address: Neisseria Unit and the
French National Reference Center for Meningococci, Institut Pasteur,
28 Rue du Dr Roux, Paris, France. Phone: 33 1 44 38 95 90. Fax: 33 1
40 61 30 34. E-mail: mktaha@pasteur.fr.
887

Page 2

turing. The aim of this study was to establish gold standards for
the molecular detection of alterations to penA. We used clin-
ical samples from patients with well-known clinical histories
and the corresponding cultured and characterized isolates to
compare the three approaches as molecular methods for pre-
dicting susceptibility of N. meningitidis to penicillin G.
MATERIALS AND METHODS
Bacterial strains, samples, and conventional bacteriology. Three laboratories
(named L1 to L3), which are members of the European Monitoring Group on
Meningococci (EMGM), participated in this study. Biological samples (n ? 13,
named PenNet01 to PenNet13) were obtained from the CSF of 13 different
patients admitted to several hospitals with a clinical diagnosis of meningitis.
Samples were cultured, and bacteria were isolated using standard methods. The
MIC of penicillin G was determined using the E test on Mueller Hinton agar
supplement with 5% sheep blood, as previously described. Laboratories 3 and 1
used the breakpoints of 0.094 mg/liter or 0.125 mg/liter to define PenIisolates,
respectively (29). Serogroup was determined by bacterial agglutination with
serogroup-specific immune sera (Bio-Rad). Serotypes and serosubtypes were
determined as previously described (1, 15, 26).
Sample preparation for PCRs. Samples were freeze-thawed once, heated at
100°C for 3 min, and then centrifuged for 5 min at 10,000 ? g to obtain the
supernatant. Laboratory 1 carried out nonculture detection of N. meningitidis in
clinical samples using PCR amplification of the crgA gene, and genogrouping of
N. meningitidis was carried out using PCR amplification of serogroup-specific
genes (25). Laboratory 1 sent 200 ?l of each sample at room temperature to the
participating laboratories. Each laboratory carried out one of the rapid tech-
niques for detecting alterations to penA.
RFLP of penA. Laboratory 1 (L1) used restriction fragment length polymor-
phism (RFLP) of penA. PCR was carried out using two oligonucleotides,
penA-1F and penA-1R, to amplify a 511-bp fragment of the 3? end of the penA
gene. PCR was carried out as previously described (2, 5). Amplification products
were digested with TaqI and separated on a 3% agarose gel. PenSisolates had
the same profiles, whereas PenIisolates showed different profiles. The restriction
profiles corresponding to PenSand PenIisolates were as previously reported (2).
Real-time PCR and oligonucleotide thermal analysis. Laboratory 2 (L2) used
real-time PCR and oligonucleotide thermal analysis. Primers, fluorescent reso-
nance energy transfer probes, and PCR parameters were as previously described
(22), and primers and probes are listed in Table 1. The real-time PCR mixture
contained either 1 ?l of purified chromosomal DNA (100 ng) extracted from the
cultured isolates (22) or 10 ?l of boiled CSF added directly to the mixture with
no additional purification step.
A total of 1 ?l (10 pmol) of each primer, 2 ?l (2 pmol) of FL and LC640
probes, 2.5 ?l MgCl2(final concentration, 4 mM), 2 ?l of Fast-start master
hybridization probe reaction mixture (Roche Diagnostic, Mannheim, Ger-
many), and PCR-grade sterile water was used in a final volume of 20 ?l. PCR
included an initial denaturation step of 10 min at 95°C, followed by 40 cycles
of denaturation for 10 s at 95°C, annealing for 10 s at 48°C, polymerization for
10 s at 72°C, and detection of the fluorescence for 15 s at 38°C. This last
detection step was added to each PCR cycle to increase the red fluorescence
levels for the quantitative PCR analysis. The temperature transition rate was
20°C/s for all segments.
Fluorescence was measured in channel 2 at 640 nm. Data were analyzed with
LightCycler software, version 5.32, according to the manufacturer’s instructions
(Roche Diagnostics). The susceptible reference strain, one PenIstrain with a
defined penicillin MIC, and a negative control (sterile water instead of the DNA
template) were included for reproducibility of the results and to check contam-
ination.
Single-PCR-based method to predict penicillin susceptibility in N. meningitidis
strains and in clinical samples. Laboratory 3 (L3) used a single-PCR-based
method to predict penicillin susceptibility in N. meningitidis strains and in clinical
samples. Two oligonucleotides, RT-3(F) and RT-4(R), were designed based on
the polymorphic sites that discriminate PenS/PenIstrains. In both oligonucleo-
tides, the 3? end corresponds to one of the polymorphic sites. The oligonucleo-
tides target a complementary sequence of the penA gene in penicillin-susceptible
strains. They amplify the region from nucleotides 1526 to 1714 inclusive, which
corresponds to amino acids 509 to 572 in PenSstrains. Therefore, if the ampli-
fication is successful, this implies penicillin susceptibility, whereas no amplifica-
tion implies penicillin resistance. Amplification products were analyzed on a 2%
agarose gel.
DNA sequencing of penA and MLST. Laboratory 1 also partially sequenced
penA. The penA gene was amplified using two oligonucleotides having adaptors
that corresponded to the universal forward and reverse sequences that were
added to the 5? end upstream and downstream from oligonucleotides, respec-
tively (Table 1). After amplification, the universal forward and reverse oligonu-
cleotides were used for sequencing. Multilocus sequence typing (MLST) was
used to genotype the isolates. The polymorphism of seven chromosomal genes in
N. meningitidis that encode housekeeping enzymes was determined. The analysis
was performed on the DNA sequence of approximately 450 bp from PCR
products corresponding to these genes. The combination of the seven corre-
sponding alleles of these genes defines the sequence type (ST) of a given strain.
Oligonucleotides used for MLST were as previously described (15, 26).
Statistical methods. We used the kappa coefficient (K) to estimate the level of
agreement between results from the PCR-based detection of penA polymor-
phisms (10). This test determines whether agreement between results exceeds
chance levels. We compared the results from each laboratory with the results
obtained from sequencing of the cultured bacteria. K was calculated using K ?
Po-Pe/1 ? Pe, where Po is the observed agreement and Pe is the agreement
obtained from a random guess. A K value of 0.60 or more was considered a good
level of agreement.
TABLE 1. Oligonucleotides used in this study
Use and primer or probeSequence
Nucleotide
positiona
Real-time PCR and oligonucleotide thermal analysis
penA-fw (primer)
penA-rev (primer)
penA-FL (probe)
penA-LC640 (probe)
5? GATTGTGGCGGTAACCATTGACG
5? CGGGGATATAACTGCGTCCGT
5? AGCCTGAACATCTTGG
5? CGTTTCTCCGACCAA
5298–5320
5644–5624
5389–5404
5406–5420
PCR-RFLP and penA sequencing
penA-1F (forward amplification)b
penA-1R (reverse amplification)b
Fw sequencing
Rev sequencing
5? gttttcccagtcacgacgttgtaATCGAACAGGCGACGATGTC
5? ttgtgagcggataacaatttcGATTAAGACGGTGTTTTGACGG
5? GTTTTCCCAGTCACGACGTTGTA
5? TTGTGAGCGGATAACAATTTC
4948–4967
5459–5438
Single-PCR-based method
RT-3
RT-4
5? ATGCCGACAACAAACACA 3?
5? GTGGCTTGGTCGGGGAAAT 3?
1526–1544
1714–1695
aThe nucleotide positions are according to EMBL/GenBank accession number AE002397 for the penA N. meningitidis gene (for L1 and L2).
bUniversal forward and reverse oligonucleotides were added as adaptors at the front of each oligonucleotide (in lowercase type). Universal forward and reverse
oligonucleotides were used for sequencing.
888TAHA ET AL.ANTIMICROB. AGENTS CHEMOTHER.

Page 3

RESULTS
Characterization of isolates and clinical samples. The bac-
terial isolates from the 13 samples belonged to four major
serogroups (6 to serogroup B, 4 to serogroup C, 2 to serogroup
W135, and 1 to serogroup Y). We also found different pheno-
types (serotypes and serosubtypes) (Table 2). Two laboratories
(L1 and L3) determined the MIC of penicillin G using the E
test. L1 applied an MIC breakpoint of 0.125, whereas L3 ap-
plied 0.094 as the penicillin MIC breakpoint. Accordingly, the
isolates were classified as PenSand PenIby the two labs. We
observed a good correlation between the results from the two
laboratories, except for isolate LNP21615, which was classified
as PenIby L1 and as PenSby L3 (Table 2). Moreover, the
MICs obtained by L1 were always higher than those found by
L3 (Table 2).
MLST typing revealed that the isolates belonged to several
genetic lineages, including major clonal complexes such as the
ST-41/44/lineage III and ST-269 clonal complexes for isolates
of serogroup B and the ST-11/ET-37 clonal complex for sero-
group C isolates (Table 2).
The nonculture detection of meningococcal DNA using crgA
and ctrA was positive in all 13 clinical samples. The results of
serogrouping by conventional agglutination of isolates were
identical to the results predicted by PCR (genogrouping) (data
not shown). The results obtained for conventional and molec-
ular characterization suggest that the panel tested corre-
sponded to different isolates and may be suitable for analyzing
penA polymorphisms.
Molecular detection of alterations to penA. The three par-
ticipating laboratories successfully amplified penA from all cul-
tured isolates. PBP2 sequences (amino acids 427 to 581) that
were predicted from the DNA sequences of the PCR products
agreed with the MIC-based phenotypic classification (Tables 2
and 3). Eight of the 13 sequences were identical and corre-
sponded to susceptible isolates (Table 3; Fig. 1). These PBP2
sequences (PBP2s) were also identical to those previously re-
ported for susceptible strains (5). Five PBP2 sequences differed
from PBP2 by 14 or 17 substitutions, showing between 89% and
91% identity with PBP2, and corresponded to PenIisolates (Fig.
1 and Tables 2 and 3). Three different sequences were observed
among these five isolates, with three isolates having identical
sequences (LNP17244, LNP21316, and LNP21338) with 14 sub-
stitutions. The other two isolates (LNP21321 and LNP21332)
were different, with 17 and 14 substitutions, respectively
(Fig. 1). All of the five altered PBP2 sequences showed
modifications in the polymorphic positions previously re-
ported to be altered in all PenIstrains (3). When the three
laboratories tested the polymorphism of penA using rapid
PCR approaches (see Materials and Methods), they all suc-
cessfully detected the altered penA alleles in the PenIiso-
lates (Table 3). Similar results were also obtained when
directly amplifying the clinical samples. However, two lab-
oratories could not amplify penA from the PenNet03 sample
despite detecting meningococcal DNA by PCR amplifica-
tion of crgA and ctrA. We obtained a good correlation be-
tween laboratories, except for the samples PenNet09 and
PenNet13, which L3 typed as susceptible while L1 and L2
detected altered penA genes in them (Table 3). However, an
altered penA gene was found in the cultured isolates by all
three laboratories, in accordance with DNA sequencing (Ta-
ble 3 and Fig. 1).
TABLE 2. Phenotype and genotype of N. meningitidis isolates
StrainPhenotypea
ST Clonal complex L1 MICc
L3 MICc
LNP16651
LNP17244
LNP18361
LNP21615
LNP21733
LNP21306
LNP21309
LNP21314
LNP21316
LNP21321
LNP21331
LNP21332
LNP21338
Y:15:P1.15
W135:NT:NST
B:15:P1.5
B:NT:P1.4
W135:NT:P1.6
C:2a:P1.5
B:NT:P1.1
B:NT:NST
C:2a:P1.2
B:NT:P1.12,13
C:NT:P1.5,2
B:1:P1.14
C:2a:P1.5
ND
ND
4498
NDb
ND
Nonassigned
ST-41/44/lineage 3
ST-22
ST-11/ET-37
ST-41/44/lineage 3
ST-269
ST-11/ET-37
ST-41/44/lineage 3
ST-11/ET-37
ST-213
ST-11/ET-37
0.064, S
0.125, I
0.064, S
0.125, I
0.094, S
0.064, S
0.064, S
0.064, S
0.5, I
0.25, I
0.064, S
0.38, I
0.5, I
0.064, S
0.094, I
0.032, S
0.023, S
0.023, S
0.023, S
0.023, S
0.016, S
0.250, I
0.125, I
0.032, S
0.094, I
0.125, I
41
4439
11
180
269
11
41
3714
4696
3714
aSerogroup:serotype:serosubtype.
bND, not determined.
cMICs (mg/liter) were determined by E test. Susceptible (S) and intermediate (I) phenotypes were determined by laboratory 1 (L1) with a breakpoint of 0.125
mg/liter and by laboratory 3 (L3) with a breakpoint of 0.094 mg/liter.
TABLE 3. penA typing in cultured isolates and clinical
samples (CSF)
StrainL1 L2 L3SampleL1 L2 L3
LNP16651
LNP17244
LNP18361
LNP21615
LNP21733
LNP21306
LNP21309
LNP21314
LNP21316
LNP21321
LNP21331
LNP21332
LNP21338
Sa
Ib
S
S
S
S
S
S
I
I
S
I
I
S
I
S
S
S
S
S
S
I
I
S
I
I
S
I
S
S
S
S
S
S
I
I
S
I
I
PenNet01
PenNet02
PenNet03
PenNet04
PenNet05
PenNet06
PenNet07
PenNet08
PenNet09
PenNet10
PenNet11
PenNet12
PenNet13
S
I
S
I
S
I
S
S
S
S
S
S
S
I
S
I
S
NDc
S
S
S
S
S
I
I
S
I
I
ND
S
S
S
S
S
I
I
S
I
I
aS, prediction of susceptible isolate.
bI, prediction of intermediate isolate.
cND, not determined, negative PCR.
VOL. 50, 2006NONCULTURE TYPING OF PENICILLIN SUSCEPTIBILITY 889

Page 4

Performance of nonculture detection of penicillin G suscep-
tibility. We estimated the performance of the three rapid ap-
proaches using kappa statistics (see Materials and Methods) by
calculating the K coefficient, using the results from each labo-
ratory and the sequencing data as references. As expected, the
agreement was perfect, with a K value of 1 (maximum agree-
ment), for the results obtained with the cultured isolates by the
three laboratories. The results from nonculture rapid ap-
proaches in detecting alterations of penA compared to se-
quencing data gave a K value of 1 for L1 and L2, whereas L3
had a K value of 0.65.
The sensitivity and specificity of methods for detecting the
PenIisolates used by L1 and L2 were both 100%, whereas they
were 100% and 80%, respectively, for L3.
DISCUSSION
The phenotypic determination of susceptibility to penicillin
G by the E test is still difficult due to differences in the critical
values used by different laboratories (29). Moreover, our data
indicate that differences in MICs for the same set of isolates
may be observed even when using the same medium. This
could be due to differences in the sources or batches of me-
dium and/or sheep blood. Nonculture PCR-based methods are
increasingly being used for diagnosis of meningococcal infec-
tion. Although current nonculture diagnosis approaches allow
the identification and genogrouping of N. meningitidis, they
cannot predict meningococcal susceptibility to antibiotics. The
global approach to immediate management of invasive menin-
gococcal infections requires information on antibiotic suscep-
tibility to provide adequate treatment for patients and prophy-
laxis for contacts. This study is the first attempt to find a rapid
test for penicillin G resistance for wide clinical application.
The major antibiotics currently used in treatment and pro-
phylaxis are beta-lactams, quinolones, chloramphenicol, and
rifampin. Several studies have shown that alterations to penA
are directly linked to reduced meningococcal susceptibility to
penicillin G (3, 18, 21) and that no isolate with a sequence
characteristic of susceptible strains has ever had the same MIC
as PenIstrains. Mutations in the rpoB gene encoding the beta
subunit of the RNA polymerase are directly linked to high
levels of meningococcal resistance to rifampin (8, 16, 23). Me-
ningococcal resistance to quinolones can also be inferred from
mutations in the gyrA, parC, and mtr genes (11, 19). Resistance
to chloramphenicol can be inferred from the catP gene (12,
20), and resistance to sulfonamide can be inferred from mu-
tation in folP gene (7, 14). Therefore, molecular methods have
been developed to detect alterations in these genes.
FIG. 1. The partial sequences of the C-terminal part of PBP2 (amino acids 427 to 581) from the sequences of penA genes from isolates of N.
meningitidis tested in this study. Ditto marks indicate identical residues. Polymorphic residues are indicated by a one-letter code. The positions that
are modified in all PenIisolates are indicated by asterisks. The KTG motif is indicated in a box. The isolate number is indicated on the left.
890TAHA ET AL.ANTIMICROB. AGENTS CHEMOTHER.

Page 5

The enhanced surveillance of invasive meningococcal in-
fections worldwide requires standardized methods. The
EMGM represents a good forum for conducting interlabo-
ratory comparisons of PCR-based methods. An interlabora-
tory study of PCR methods of identification and genogroup-
ing of N. meningitidis in laboratories of the EMGM has
already been carried out (25). The current study is a part of
our effort in the EMGM to provide a basis for detecting
standardized protocols for molecular identification and
characterization of N. meningitidis.
Our sequencing data of the 3? part of the penA gene clearly
confirmed the direct correlation between alterations in this
region and the PenIphenotype. The detection of those posi-
tions that are always modified in PenIstrains is a powerful tool
for identifying PenIstrains. The three rapid PCR-based meth-
ods reported in this study were in total agreement with each
other and completely correlated with sequences from cultured
bacteria. We observed the same level of agreement with clin-
ical samples and the nonculture characterization of the penA
gene using PCR-based RFLP of penA (laboratory L1) and
real-time PCR and oligonucleotide thermal analysis (labora-
tory L2). The discrepancy with a different PCR method (lab-
oratory L3) that we observed for the PenNet09 and PenNet13
samples suggests that recommended PCR-based methods for
penA typing should give a positive PCR regardless of the phe-
notype of the isolates. It is most likely that this discrepancy is
related to the method used by laboratory 3.
The molecular detection of penA alterations should not be
used in first-line detection of N. meningitidis. Nonculture de-
tection and genogrouping have been previously reported, and
their sensitivity and specificity have also been estimated (25).
Subsequent analysis of the products of PCR amplification of
the penA gene can be used to predict susceptibility to penicillin
G. As a nonculture method on clinical samples, amplification
of penA may be less sensitive than amplification of crgA and
ctrA for detecting meningococcal DNA, as suggested by the
failure of PCR for one clinical sample (PenNet03). However,
transport and/or storage conditions of samples may also be
responsible for this failure. It may be prudent to ship processed
samples frozen. Moreover, the performance of the amplifica-
tion may be improved by designing different primers. Stan-
dardization of PCR-based methods might also benefit from a
collection of seeded sterile CSF samples with known concen-
trations of N. meningitidis organisms.
Nonculture assays for diagnosis of meningococcal disease
should be used together with conventional methods, in partic-
ular when culturing fails to isolate bacteria. Nonculture assays
should not replace culturing, which should always be carried
out, as cultured bacteria are still an invaluable source of infor-
mation on meningococcal pathogenesis.
ACKNOWLEDGMENTS
This work was supported by European Union Contract no. QLK2-
CT-2001-01436.
We thank a number of reviewers who improved the quality of the
manuscript with their comments and criticisms.
REFERENCES
1. Abdillahi, H., and J. T. Poolman. 1988. Neisseria meningitidis group B sero-
subtyping using monoclonal antibodies in whole-cell ELISA. Microb.
Pathog. 4:27–32.
2. Antignac, A., J. M. Alonso, and M. K. Taha. 2001. Nonculture prediction of
Neisseria meningitidis susceptibility to penicillin. Antimicrob. Agents Che-
mother. 45:3625–3628.
3. Antignac, A., I. G. Boneca, J. C. Rousselle, A. Namane, J. P. Carlier, J. A.
Vazquez, A. Fox, J. M. Alonso, and M. K. Taha. 2003. Correlation between
alterations of the penicillin-binding protein 2 and modifications of the pep-
tidoglycan structure in Neisseria meningitidis with reduced susceptibility to
penicillin G. J. Biol. Chem. 278:31529–31535.
4. Antignac, A., M. Ducos-Galand, A. Guiyoule, R. Pires, J. M. Alonso, and
M. K. Taha. 2003. Neisseria meningitidis strains isolated from invasive infec-
tions in France (1999–2002): phenotypes and antibiotic susceptibility pat-
terns. Clin. Infect. Dis. 37:912–920.
5. Antignac, A., P. Kriz, G. Tzanakaki, J. M. Alonso, and M. K. Taha. 2001.
Polymorphism of Neisseria meningitidis penA gene associated with reduced
susceptibility to penicillin. J. Antimicrob. Chemother. 47:285–296.
6. Barbour, A. G. 1981. Properties of penicillin-binding proteins in Neisseria
gonorrhoeae. Antimicrob Agents Chemother. 19:316–322.
7. Bennett, D. E., and M. T. Cafferkey. 2003. PCR and restriction endonuclease
assayfordetectionofanovelmutationassociatedwithsulfonamideresistancein
Neisseria meningitidis. Antimicrob. Agents Chemother. 47:3336–3338.
8. Carter, P. E., F. J. Abadi, D. E. Yakubu, and T. H. Pennington. 1994.
Molecular characterization of rifampin-resistant Neisseria meningitidis. Anti-
microb. Agents Chemother. 38:1256–1261.
9. Cartwright, K. A., S. Reilly, D. White, and J. Stuart. 1992. Early treatment
with parenteral penicillin in meningococcal disease. Br. Med. J. 305:143–147.
10. Cohen, J. 1960. A coefficient of agreement for nominal scales. Educ. Psychol.
Meas. 20:37–46.
11. Corso, A., D. Faccone, M. Miranda, M. Rodriguez, M. Regueira, C. Carranza,
C. Vencina, J. A. Vazquez, and M. Galas. 2005. Emergence of Neisseria
meningitidis with decreased susceptibility to ciprofloxacin in Argentina. J.
Antimicrob. Chemother. 55:596–597.
12. Galimand, M., G. Gerbaud, M. Guibourdenche, J. Y. Riou, and P. Courvalin.
1998. High-level chloramphenicol resistance in Neisseria meningitidis.
N. Engl. J. Med. 339:868–874.
13. Hieber, J. P., and J. D. Nelson. 1977. A pharmacologic evaluation of peni-
cillin in children with purulent meningitis. N. Engl. J. Med. 297:410–413.
14. Kristiansen, B. E., C. Fermer, A. Jenkins, E. Ask, G. Swedberg, and O.
Skold. 1995. PCR amplicon restriction endonuclease analysis of the chro-
mosomal dhps gene of Neisseria meningitidis: a method for studying spread of
the disease-causing strain in contacts of patients with meningococcal disease.
J. Clin. Microbiol. 33:1174–1179.
15. Maiden, M. C., J. A. Bygraves, E. Feil, G. Morelli, J. E. Russell, R. Urwin,
Q. Zhang, J. Zhou, K. Zurth, D. A. Caugant, I. M. Feavers, M. Achtman, and
B. G. Spratt. 1998. Multilocus sequence typing: a portable approach to the
identification of clones within populations of pathogenic microorganisms.
Proc. Natl. Acad. Sci. USA 95:3140–3145.
16. Nolte, O., M. Muller, S. Reitz, S. Ledig, I. Ehrhard, and H. G. Sonntag. 2003.
Description of new mutations in the rpoB gene in rifampicin-resistant Neis-
seria meningitidis selected in vitro in a stepwise manner. J. Med. Microbiol.
52:1077–1081.
17. Parkhill, J., M. Achtman, K. D. James, S. D. Bentley, C. Churcher, S. R.
Klee, G. Morelli, D. Basham, D. Brown, T. Chillingworth, R. M. Davies, P.
Davis, K. Devlin, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Leather,
S. Moule, K. Mungall, M. A. Quail, M. A. Rajandream, K. M. Rutherford,
M. Simmonds, J. Skelton, S. Whitehead, B. G. Spratt, and B. G. Barrell.
2000. Complete DNA sequence of a serogroup A strain of Neisseria menin-
gitidis Z2491. Nature 404:502–506.
18. Saez Nieto, J. A., J. A. Vazquez, and C. Marcos. 1990. Meningococci mod-
erately resistant to penicillin. Lancet 336:54.
19. Shultz, T. R., J. W. Tapsall, P. A. White, and P. J. Newton. 2000. An invasive
isolate of Neisseria meningitidis showing decreased susceptibility to quino-
lones. Antimicrob. Agents Chemother. 44:1116.
20. Shultz, T. R., J. W. Tapsall, P. A. White, C. S. Ryan, D. Lyras, J. I. Rood, E.
Binotto, and C. J. Richardson. 2003. Chloramphenicol-resistant Neisseria
meningitidis containing catP isolated in Australia. J. Antimicrob. Chemother.
52:856–859.
21. Spratt, B. G. 1994. Resistance to antibiotics mediated by target alterations.
Science 264:388–393.
22. Stefanelli, P., A. Carattoli, A. Neri, C. Fazio, and P. Mastrantonio. 2003.
Prediction of decreased susceptibility to penicillin of Neisseria meningitidis
strains by real-time PCR. J. Clin. Microbiol. 41:4666–4670.
23. Stefanelli, P., C. Fazio, G. La Rosa, C. Marianelli, M. Muscillo, and P.
Mastrantonio. 2001. Rifampicin-resistant meningococci causing invasive dis-
ease: detection of point mutations in the rpoB gene and molecular charac-
terization of the strains. J. Antimicrob. Chemother. 47:219–222.
24. Stefanelli, P., C. Fazio, A. Neri, T. Sofia, and P. Mastrantonio. 2004. Emer-
gence in Italy of a Neisseria meningitidis clone with decreased susceptibility to
penicillin. Antimicrob. Agents Chemother. 48:3103–3106.
25. Taha, M. K., J. M. Alonso, M. Cafferkey, D. A. Caugant, S. C. Clarke,
M. A. Diggle, A. Fox, M. Frosch, S. J. Gray, M. Guiver, S. Heuberger, J.
Kalmusova, K. Kesanopoulos, A. M. Klem, P. Kriz, J. Marsh, P. Mo ¨lling, K.
Murphy, P. Olce ´n, O. Sanou, G. Tzanakaki, and U. Vogel. 2005. Interlabo-
VOL. 50, 2006NONCULTURE TYPING OF PENICILLIN SUSCEPTIBILITY 891