In situ fluorescence analysis demonstrates active siRNA exclusion from the nucleus by Exportin 5.

Abstract

Two types of short double-stranded RNA molecules, namely microRNAs (miRNAs) and short interfering RNAs (siRNAs), have emerged recently as important regulators of gene expression. Although these molecules show similar sizes and structural features, the mechanisms of action underlying their respective target silencing activities appear to differ: siRNAs act primarily through mRNA degradation, whereas most miRNAs appear to act primarily through translational inhibition. Our understanding of how these overlapping pathways are differentially regulated within the cell remains incomplete. In the present work, quantitative fluorescence microscopy was used to study how siRNAs are processed within human cells. We found that siRNAs are excluded from non-nucleolar areas of the nucleus in an Exportin-5 dependent process that specifically recognizes key structural features shared by these and other small RNAs such as miRNAs. We further established that the Exportin-5-based exclusion of siRNAs from the nucleus can, when Exp5 itself is inhibited, become a rate-limiting step for siRNA-induced silencing activity. Exportin 5 therefore represents a key point of intersection between the siRNA and miRNA pathways, and, as such, is of fundamental importance for the design and interpretation of RNA interference experimentation.

Full text

Page 1

In situ fluorescence analysis demonstrates active
siRNA exclusion from the nucleus by Exportin 5
ThomasOhrt,DennisMerkle,KarinBirkenfeld,ChristopheJ.Echeverri1andPetraSchwille*
Institute for Biophysics, BIOTEC, Dresden University of Technology, Tatzberg 47-51, 01307 Dresden,
Germany and1Cenix BioScience GmbH, Tatzberg 47, 01307 Dresden, Germany
Received December 14, 2005; Revised and Accepted February 9, 2006
ABSTRACT
Two types of short double-stranded RNA molecules,
namely microRNAs (miRNAs) and short interfering
RNAs (siRNAs), have emerged recently as important
regulators of gene expression. Although these mole-
cules show similar sizes and structural features, the
mechanisms of action underlying their respective
target silencing activities appear to differ: siRNAs
act primarily through mRNA degradation, whereas
most miRNAs appear to act primarily through trans-
lational inhibition. Our understanding of how these
overlapping pathways are differentially regulated
within the cell remains incomplete. In the present
work, quantitative fluorescence microscopy was
used to study how siRNAs are processed within
human cells. We found that siRNAs are excluded
from non-nucleolar areas of the nucleus in an
Exportin-5dependentprocess
recognizes key structural features shared by these
and other small RNAs such as miRNAs. We further
established that the Exportin-5-based exclusion of
siRNAs from the nucleus can, when Exp5 itself is
inhibited, become a rate-limiting step for siRNA-
induced silencing activity. Exportin 5 therefore
represents a key point of intersection between the
siRNA and miRNA pathways, and, as such, is of
fundamental importance for the design and inter-
pretation of RNA interference experimentation.
thatspecifically
INTRODUCTION
Argonaute-containing complexes are emerging as key regula-
tors of gene expression, both in the context of controlling
developmental programs of gene expression and as a defence
mechanism to protect the genome against viruses and trans-
posons [Reviewed in (1–3)]. These complexes have been
shown to use short double-stranded RNA (dsRNA) molecules
as targeting co-factors, to identify cognate mRNA transcripts
whose expression is to be silenced. The mechanism by which
this silencing occurs is also determined in part by the type of
dsRNA molecule used, and two mechanisms have emerged,
directed by two distinct types of short dsRNA: small inter-
fering RNAs (siRNAs) and micro RNAs (miRNAs).
Documented in organisms from plants to humans, siRNAs
are key intermediates of an evolutionarily conserved, multi-
step pathway for post-transcriptional gene silencing known as
RNA interference (RNAi) (4–6). This process occurs in the
cytoplasm and is guided by the siRNAs which direct the
sequence-specific degradation of targeted mRNAs (7–9).
Naturally occurring siRNAs are produced by Dicer-based pro-
cessing of long dsRNA molecules derived from viral infection
or transposon activity (10–12). These siRNAs consist of a
dsRNA stem of ?19 nt containing 2 nt overhangs with free
hydroxyl groups at both 30ends and phosphates at both 50ends
(6). To act as triggers for mRNA degradation, siRNAs are
assembled with specific proteins including Argonaute 2 to
form the RNA-induced silencing complex (RISC), which cat-
alyzes target mRNA cleavage (7,13–15). The siRNA strand
with the most thermodynamically labile base pairing near
its 5’ end is preferentially used by RISC as the ‘‘guide’’ or
targeting strand, whereas the other ‘‘passenger’’ strand is
degraded (16,17). The target cleavage site in the mRNA is
defined by the siRNA sequence and is located 10 nt upstream
of the nucleotide complementary to the 50-most residue of the
guide strand (18,19).
miRNAs represent a similar yet clearly distinct class of
short RNA species, as these are actually encoded by animal
and viral genomes to direct the post-transcriptional silencing
of target genes, also using RISC-like complexes (20–23). With
hundreds of such molecules having now been identified in
various organisms, miRNAs emerge as 21–25 nt-long
single-stranded hairpin RNAs, derived from larger precursors
that form imperfect stem–loop structures and in most cases,
inhibit translation from target mRNAs in a process that
remains poorly understood (24). Two processing events
lead to mature miRNA formation, as well as to their specific
*To whom correspondence should be addressed. Tel: +49 351 463 40328; Fax: +49 351 463 40342; Email: petra.schwille@biotec.tu-dresden.de
? The Author 2006. Published by Oxford University Press. All rights reserved.
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access
version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press
areattributedastheoriginalplaceofpublicationwiththecorrectcitationdetailsgiven;ifanarticleissubsequentlyreproducedordisseminatednotinitsentiretybut
only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org
Nucleic Acids Research, 2006, Vol. 34, No. 51369–1380
doi:10.1093/nar/gkl001

Page 2

subcellular localization in animals. The nascent miRNA
transcript (pri-miRNA) is processed by the RNase-III enzyme
Drosha inside the nucleus into an ?70 nt precursor
(pre-miRNA) (25). Pre-miRNAs are then exported from the
nucleus into the cytoplasm by Exportin-5 (Exp5), a Ran-GTP
dependent nucleo–cytoplasmic transporter (26). Once the
pre-miRNA has entered the cytoplasm it is further pro-
cessed by the RNase-III enzyme Dicer to form the mature
miRNA (27,28).
Fundamentally, siRNAs and miRNAs share some common
characteristics, e.g. the dsRNA stem, the Dicer dependent
maturation (8,27,28) and the association with Argonaute-
family proteins to direct their gene silencing activity
(14,29–31). It has been shown in Drosophila that miRNAs
and siRNAs are incorporated into different, but similar effec-
tor complexes, where miRNAs associate with AGO1 and
siRNAs with AGO2 as key components of RISC (29,30).
The degree of complementarity between a siRNA or miRNA
and their target mRNA determines, at least in part, the specific
mode of post-transcriptional repression. That is, fully comple-
mentary short RNAs lead to the degradation of the target
mRNA, whereas multiple mismatches in the RNA:mRNA
helix direct translational repression without destabilization of
the mRNA (32).
The detailed analysis of siRNA and miRNA processing is
of fundamental interest to better understand their respective
pathways and to further refine the experimental power of
RNAi techniques. In the present work we employed high-
resolution fluorescence microscopy to quantitatively measure
fluorescence-labelled siRNAs delivered into HeLa SS6 cells
by microinjection. We examined the cellular localization of a
variety of siRNA-like structures, which yielded new insight
into how siRNA molecules are processed in cells. These
observations led to the demonstration that Exp5 is required
for the active exclusion of siRNAs from the nucleus and
thereby directly impacts their biological activity. This study
reveals Exp5-mediated nuclear export as another important
step common to the processing of both naturally encoded
miRNAs and exogenous synthetic siRNAs, and as such, one
that must be taken into careful consideration during RNAi
experimentation.
MATERIALS AND METHODS
Cell culture
Adherent HeLa SS6 cells were cultured at 37?C in DMEM
(Gibco, Invitrogen GmbH) with 10% fetal calf serum (PAA
Laboratories GmbH). Cells were regularly passaged at sub-
confluency and were plated in antibiotic-free medium with
2–3.5 · 104cells/ml density.
For all transfections cells were transfected with Lipo-
fectamine 2000 (Invitrogen GmbH). For the luciferase assays
exponentially growingcells were trypsinized onthe daybefore
transfection and plated into 24-well plates at a density of
5 · 104cells/well in antibiotic-free media. For 6-well plates
and MatTek chambers (MatTek Corporation, USA) cells
were sown one day before transfection at a density of
1.5–3 · 105cells/well in antibiotic-free media. The next
day, the cells were transfected with 100 nM siRNAs with
6 ml Lipofectamine 2000 and 300 ml OptiMEM in 1.5 ml
fresh medium. The medium is replaced by 2 ml fresh growth
medium 3–5 h after transfection.
siRNAs
RNA and DNA oligonucleotides were obtained from IBA
GmbH (Goettingen) and Ambion. For the silencing of
CRM1, Exp5, Pp-luc and the following oligonucleotides
were used:
g ¼ guide strand; p ¼ passenger strand
siCRM1: p UGUGGUGAAUUGCUUAUACTT; g GUAU-
AAGCAAUUCACCACATT
siExp5-1: p GCCCUCAAGUUUUGUGAGGTT; g CCU-
CACAAAACUUGAGGGCTT
siExp5-2: p UGUGAGGAGGCAUGCUUGUTT; g ACA-
AGCAUGCCUCCUCACATT
siGL2: p CGUACGCGGAAUACUUCGATT; g UCG-
AAGUAUUCCGCGUACGTT
siEGFP: p GCAGCACGACUUCUUCAAGTT; g CUU-
GAAGAAGUCGUGCUGCTT.
As negative controls a negative siRNA (NegsiRNA) from
Ambion was used and DNAs were obtained from IBA GmbH.
DNA-GL2: p CGTACGCGGAATACTTCGATT; g TCGA-
AGTATTCCGCGTACGTT
NegsiRNA: Silencer? Negative Control #1 siRNA.
For the 30–50overhang shift assay
siGL2: g UCG AAG UAU UCC GCG UAC GUG
siGL2: 302ntoh/-30: p CGU ACG CGG AAU ACU UCG
AUU
siGL2: blunt/-30: p CAC GUA CGC GGA AUA CUU CGA
siGL2: 502ntOh: p AUC ACG UAC GCG GAA UAC UUC
siGL2: 504ntOh: p ACA UCA CGU ACG CGG AAU ACU
siGL2: 505ntOh: p AAC AUC ACG UAC GCG GAA UAC
siGL2: 506ntOh: p GAA CAU CAC GUA CGC GGA AUA
siGL2: 304ntOh: p GUA AAG CUU CAU AAG GCG CAU
siGL2: 305ntOh: p UGU AAA GCU UCA UAA GGC GCA
siGL2: 306ntOh: p CUG UAA AGC UUC AUA AGG CGC
Duplex siRNAs were prepared by mixing complementary
sense siRNA and antisense siRNA at equimolar ratio,
incubating at 80?C for 2 min followed by a cooling step at
1?C/min to 15?C. The annealing procedure was performed
in the Mastercycler epGradientS (Eppendorf) in 110 mM
K-gluconate; 18 mM NaCl; 10 mM HEPES, pH 7.4 and
0.6 mM MgSO4with 10–60 mM siRNA concentrations. The
quality of the duplex siRNAs was checked by agarose gel
electrophoresis and high-performance liquid chromatography.
The prepared siRNA duplexes were stored at ?20?C.
Fluorescence-reporter plasmids
pEGFP-N1 vector (Clontech) and pDsRed2-N1 vector
(Clontech).
Agarose gel electrophoresis
For agarose gel electrophoresis a special high resolving
Metaphor?agarose (Cambrex) was used. All agarose gels
have a 4% (w/v) concentration and were used with 1· TBE
(0.1 M Tris–borate, 2 mM EDTA, pH 8.3) running buffer.
Aliquots of 1 · 10?2nmol labelled siRNA were loaded in
each pocket. The gels were analysed with a Typhoon 9410
Variable Mode Imager (Amersham Biosciences) by using the
1370Nucleic Acids Research, 2006, Vol. 34, No. 5

Page 3

manufacturer’s settings for Alexa488 (Molecular Probes) and
Cy5 (Amersham Biosciences).
Labelling
RNA and DNA oligonucleotides were synthesized by
IBA with a 30or 50-amino group via a C6-carbon linker
and were labelled with Alexa Fluor?488 carboxylic acid,
2,3,5,6-tetrafluorophenyl ester (Alexa488-TFP; Molecular
Probes) or Cy5 succinimidyl ester (Cy5-NHS; Amersham
Biosciences).
Single-stranded oligonucleotides (0.2 mmol) in 55 ml H2O
were mixed in 20 ml of 500 mM borate buffer, pH 8.5, with 25
ml of 10 mM aminoreactive dye [in N,N-dimethylformamide,
Merck] and incubated at room temperature for 16 h. Labelled
siRNAswere ethanol precipitated[70% (v/v)ethanol,250mM
NaOAc, pH 5.8] four times to remove most of the free unre-
acted dye. The pre-purified siRNAs were loaded on an 18%
denaturating polyacrylamide gel (SequaGel?Sequencing
system; National diagnostics) to separate unlabelled and
labelled strands and unreacted dye. The band with the labelled
RNA is cut out and eluted from the gel slice with 400 ml
of 0.3 M NaCl for 12 h at 4?C. To remove residual gel the
sample was loaded onto a microfilter with 0.2 mm2pore size
(Nanosep?MF, PALL).
Luciferase assay
Dual-luciferase assays (Promega GmbH) were performed
24–48 h after transfection according to the manufacturer’s
protocol for 24-well chambers and detected with a TD20/20
luminometer (Turner designs). Pp-luc target vector (pGL2-
Control, Promega) was co-transfected with the control vector
Rr-luc (pRL-TK; Promega GmbH).
Lipofectamine 2000 (Invitrogen GmbH) was used for the
triple transfection of the dual luciferase assay vectors pGL2-
control [contains the cDNA of Firefly luciferase (FL)] and
pRL-TK [contains the cDNA of Renilla luciferase (RL)]
together with the siRNAs. The desired amount of each siRNAs
was mixed with 0.9 mg pGL2-control and 0.1 mg pRL-TK. To
circumvent any non-specific effects caused by different
nucleic acid content, all transfections were performed at
equal final nucleic acid concentrations as indicated in the
figures and figure legends. For this adjustment we used a
short double-stranded DNA (dsDNA) (Eg5). The cells were
transfected with the indicated amounts of siRNAs, 100 ml
Opti-MEM and 2 ml Lipofectamine 2000. The medium was
replaced by 500 ml fresh growth medium 3–5 h after trans-
fection.
Microinjection
For microinjection, 1.2 · 105HeLa SS6 cells were transfered
onto MatTek chambers coated with poly-D-lysine (0.1 mg/ml;
Sigma) 24 h before microinjection. The micropipette
(Femtotip 2; Eppendorf) was loaded with 20 mM labelled
siRNAs in 110 mM K-gluconate; 18 mM NaCl; 10 mM
HEPES, pH 7.4 and 0.6 mM MgSO4. The micromanipulator
consists of a FemtoJet and InjectMan NI2 which was mounted
directly on an Olympus microscope IX-71. Working pressure
for injection in adherent cells was between 45–90 hPa for 0.1 s
and a holding pressure of 35–40 hPa. For the injection of
plasmids the injection pressure was kept below 90 hPa to
avoid destructive shearing.
Laser scanning confocal fluorescence microscopy
LSM imaging was performed using a commercial Zeiss
ConfoCor 2 laser scanning microscope (Zeiss, Jena, Germany)
with argon ion (488 nm, 25 mW, at 18% of maximum power
output), helium–neon (543, 1 mW, at 30% of maximum power
output) and helium–neon (633 nm, 5.0 mW, at 12% of maxi-
mum power) lasers. A water immersion objective 40·/1.2W
(Zeiss) was used in the epidetection configuration with an
adjustable pinhole set at 71 mm. A band-pass filter trans-
mitting 505–550 nm (Zeiss) was used in the experiments
with Alexa488, while a long-pass filter at 650 nm (Zeiss)
was applied to separate Cy-5 fluorescence. For the experi-
ments with DsRed2 and EGFP a water immersion objective
20·/0.5W Ph2 (Zeiss) was used in the epidetection configura-
tion with an adjustable pinhole set at 73.4 mm for the red
channel and 80 mm for the green channel. A band-pass filter
transmitting 505–530 nm (Zeiss) was used in the experiments
with EGFP, while a long-pass filter at 560 nm (Zeiss) was
applied to separate DsRed2 fluorescence. In order to avoid
saturation of the fluorescence intensity in the scanned images
the detector settings were optimized by using the feature
Range Indicator provided by the Zeiss software (Operating
Manual LSM510; Zeiss, Jena, Germany).
Cell extract and western blot
For western blot analysis the cells were lysed 48 h after siRNA
transfection (100 nM or siRNA amounts are indicated in the
figure) with PLC buffer [1% (v/v) TX100; 10% (v/v) glycerol;
150 mM NaCl; 50 mM HEPES, pH 7.4; 1.5 mM MgCl2; 1 mM
EGTA; 0.2 mM PMSF; 0.1 mg/ml Pepstatin; 0.1 mM Benza-
mide] for 15 min at 4?C. The crude extracts were sonicated
10 times (Bandelin, Sonopuls; duration, 0.1 sec; power, 10%)
and centrifuged 10 min at 14000 r.p.m. (Eppendorf 5417R).
The supernatant was frozen in liquid nitrogen and stored
at ?80?C. The S20 HeLa extract was prepared as described
by Ford and Wilusz (33) except that the final centrifugation
step was performed at 20000 g instead of 100000 g.
For immunoblotting, proteins were run on an 8% PAGE and
subsequently transferred onto Protran?Nitrocellulose Trans-
fer Membrane (Schleicher & Schuell) by semi-dry blotting.
Membranes were blocked for 1 h in phosphate-buffered saline
(PBS) containing 5% milk and 0.05% Tween (PBS-T), incu-
bated for 1 h with a primary antibody, followed by a 1 h
incubation of the secondary antibody linked to horseradish
peroxidase (Novagen). Immunoreactive protein bands were
detected using ECL? western blotting detection reagents
according to the manufacturer’s protocol (Amersham Bio-
sciences) and a documentary station (LAS 3000, Fujifilm).
Antibodies
CRM1
polyclonal)
GAPDH-HRP (Abcam): Clone mAbcam 9484; Dilution
1:40000 (mouse monoclonal)
Alpha-Tubulin (Sigma): Clone DM1A; Dilution 1:100000
(mouse, monoclonal)
(Santa Cruz):H-300; Dilution1:600(rabbit,
Nucleic Acids Research, 2006, Vol. 34, No. 51371

Page 4

Exportin-5 [kindly provided by U. Kutay (26)]: Dilution
1:1000 (rabbit, polyclonal)
Anti-rabbit-HRP(Dianova): Dilution 1:40000 (goat)
Anti-mouse-HRP (Dianova): Dilution 1:40000 (goat).
RESULTS
Establishment of labelling and delivery conditions for
in situ study of siRNA processing
Single strands of a pre-validated siRNA sequence directed
against Firefly luciferase (siGL2) (5) were synthesized and
subsequently fluorescently labelled on the 30and 50ends
with Alexa488 on the guide strand and Cy5 on the passenger
strand (Figure 1A and B). These single-stranded RNAs
(ssRNAs) were also purified from a polyacrylamide gel and
subsequently annealed to produce the active siGL2 dsRNA
(Materials and Methods and Figure 1B). To examine if the 30
linkeddyes had anyinfluence onsilencing, the double-labelled
siGL2 dsRNA was co-transfected with the reporter plasmid
combination pGL2-Control/ pRL-TK-Control into HeLa SS6
cells (5). Luciferase activities were determined 48 h after
transfection by a dual luciferase assay (Figure 1C) and the
ratios of target to control luciferase were normalized to a
NegsiRNA, which has no significant sequence similarity to
mouse, rat or human gene sequences. For comparison, the
interference ratios of the siGL2 labelled variants were grouped
together for each concentration. Both unlabelled (Figure 1C,
grey bars) and double 30labelled (Figure 1C, open bars)
duplexes showed a similar concentration-dependent silencing
of Firefly luciferase, consistent with previous studies in which
various 30modifications were examined (34,35). Furthermore,
using an siRNA against Renilla luciferase (siTK) and switch-
ing Alexa488 to the passenger strand and Cy5 to the guide
strand also did not change the silencing activity of the siRNA
(data not shown). A 50dual-labelled siGL2 (Figure 1A) was
also tested in this system, since it has been shown that
blocking of the 50end of the guide strand has a strong
Figure 1. Effectof30and 50duallabellingon siRNAactivity.(A) Illustration of differently labelled GL2siRNA(siGL2) withAlexa488andCy5 usedfortargeting
firefly luciferase (pGL2-control). (B) Purification control of the labelled siRNAs (as described in Materials and Methods) on a 4% agarose gel. In the left panel the
guidestrand,30labelledwithAlexa488,indicatedassiGL2guide30A488andthepassengerstrand,30labelledwithCy5,indicatedassiGL2passenger30Cy5areshown.
The annealeddouble30labelledsiGL2duplex(siGL2-30-Duplex)is shownin lane3. The50labelledvariantsofsiGL2are shownin therightpanel,startingwiththe
guide strand labelled with Alexa488 (siGL2guide50A488), followed by the passenger strand labelled with Cy5 (siGL2passenger50Cy5). The annealed 50double-
labelled siGL2duplex(siGL2-50-Duplex) is shownin lane3. (C) HeLaSS6 cells weretransfected withthe indicatedamountsofdifferentlylabelled siGL2together
with the fixed concentration of the pGL2-Control [Firefly luciferase (FL)] and pRL-TK [Renilla luciferase (RL)] reporter plasmids as described in Materials and
Methods.After48htheratiosoftargettocontrolluciferaseconcentrationwerenormalizedtotheNegsiRNAcontrolindicatedinblack;the50double-labelledsiGL2
is indicated by the dark grey bar; the 30double-labelled siGL2 is indicated by the open bar; the unlabelled siGL2 is indicated by the grey bar. The plotted data were
averaged from six independent experiments ±SD.
1372Nucleic Acids Research, 2006, Vol. 34, No. 5

Page 5

deleterious impact on siRNA silencing activity (7,34). The
50labelled siGL2 showed no significant silencing activity
up to 1 nM and could not silence firefly luciferase beyond
50% even at 50 nM concentrations (Figure 1C, dark grey
bar). These results demonstrate that siRNAs dual labelled
with Alexa488 and Cy5 on the 30termini have no detectible
impact on silencing activity and are therefore a suitable dye
pair for in situ observations. Additionally, it was confirmed
that blocking of the 50end of the guide strand is inhibitory
towards efficient RNAi (7,34,35).
Labelled siRNAs were microinjected directly into the
cytoplasm in order to monitor their subcellular location.
This was done to avoid potential risks of siRNA segregation
within endocytic compartments, as can occur with lipid-based
transfection methods. To confirm that microinjected siRNAs
participate in the RNAi pathway, we developed a dual fluo-
rescent reporter system to quantify target-silencing efficiency.
The reporter plasmids pEGFP-N1 (expressing EGFP protein)
and pDsRed2-N1 (expressing DsRed2 protein) were co-
microinjected into HeLa SS6 cells together with either an
unlabelled siRNA targeting EGFP (siEGFP) or the unlabelled
NegsiRNA with no target (described above). After 48h the
cells were imaged by laser scanning confocal microscopy
(Figure 2A), and all red cells were further analysed. The
ratio of green-expressing cells to red-expressing cells was
calculated (Figure 2B). In three independent injection experi-
ments, fluorescent cells from the negative control (NegsiRNA)
injections exhibited a ratio of ?1.0, indicating that the expres-
sion levels of both DsRed2 and EGFP were not differentially
affected by NegsiRNA (Figure 2A, left panel; Figure 2B,
closed symbols). When the reporter plasmids were injected
together with siEGFP (Figure 2A, right panel; Figure 2B, open
symbols), the ratio of green to red cells decreased with
increasing amounts of siEGFP. This result demonstrated
that siRNAs delivered directly to the cytoplasm via microin-
jection successfully entered the RNAi pathway and mediated
sequence-specific silencing.
siRNAs are specifically excluded from non-nucleolar
regions of the nucleus
We investigated the impact of several key determinants of
siRNA structure on the subcellular localization of labelled
siRNA-like molecules after microinjection into the cytoplasm
of cultured human cells. We prepared single-labelled siRNAs
(siGL2) as well as labelled controls consisting of ssRNAs
(siGL2-ssRNA), dsDNAs (siGL2-DNA) of the same size
and single-stranded DNAs (siGL2-ssDNA) of the same size
(Materials and Methods). These variants were then micro-
injected at a concentration of 20 mM into the cytoplasm of
HeLa SS6 cells. An intra-needle siRNA concentration of
20 mM was found to give effective silencing activity
(Figure 2B) as well as detectible fluorescence signal intensities
under our recording conditions (Figure 3). The intracellular
concentration of microinjected siRNAs, as measured by fluo-
rescence correlation spectroscopy (FCS), was ?250 nM (data
not shown).
Within 15 min after microinjection, the labelled siGL2 was
located predominantly throughout the cytoplasm. The siRNA
was excluded from the nucleus, with the exception of faint
fluorescence in the nucleolar region. Although the nucleolar
fluorescene increased over time (open arrow), the siRNA
was excluded from non-nucleolar regions of the nucleus for
>1 h post-injection, irrespective of which siRNA strand was
labelled ((Figure 3A and data not shown). After 1 h, the fluo-
rescence intensity increased slightly in the non-nucleolar
regions of the nucleus, which could be due to degradation
of the labelled siRNAs (Figure 3A). No difference was
observed when labelling with Alexa488 (Figure 3B, left
panel) or Cy5 (Figure 3D, left panel). Similar results were
obtained with other siRNA sequences targeting endogenous
genes (such as the kinesin-related motor protein Eg5), and
with a different cell line (HEK cells; data not shown). In
contrast to the results obtained with siGL2 dsRNA, microin-
jection of labelled siGL2-ssRNA yielded a marked accumu-
lation of fluorescence signal within all areas of the nucleus
regardless of the dye used (Figure 3B and D, right panel) or
the end that was labelled (Figure 3F, left panel). This result
Figure 2. Dual fluorescence-reporter assay for silencing activity analysis of
microinjectedsiRNAs.(A)HeLaSS6cellsweremicroinjectedwith2.5ng/mlof
both pDsRed2-N1 and pEGFP (Ratio 1:1) together with NegsiRNA panel 1 or
siEGFPdirectedagainstEGFP panel2. Recordingofthe confocalpictureswas
after 48 h. Scale bars ¼ 20 mm. (B) Quantitative analysis of silencing after
microinjection with the indicated siRNA concentrations. To normalize the
results the number of red and green cells is divided by the total number of
counted cells (in each experiment >50 cells). NegsiRNA effect on DsRed2 and
EGFPexpressionisshowninclosedsymbol(closeddiamond),siEGFPinopen
symbols(opensquare).Theplotteddatawereaveragedfromthreeindependent
experiments ±SD.
Nucleic Acids Research, 2006, Vol. 34, No. 5 1373