Chlamydia psittaci is variably associated with ocular adnexal MALT lymphoma in different geographical regions.

Abstract

Infectious agents play a critical role in MALT lymphoma development. Studies from Italy showed Chlamydia psittaci infection in 87% of ocular adnexal MALT lymphomas and complete or partial regression of the lymphoma after C. psittaci eradication in four of nine cases. However, C. psittaci was not demonstrated in ocular adnexal MALT lymphomas from the USA. This study was thus designed to investigate further the role of C. psittaci, and other infectious agents commonly associated with chronic eye disease, in the development of ocular adnexal MALT lymphoma. The presence of C. psittaci, C. trachomatis, C. pneumoniae, herpes simplex virus 1 and 2 (HSV1, HSV2), and adenovirus 8 and 19 (ADV8, ADV19) was assessed separately by polymerase chain reaction in 142 ocular adnexal MALT lymphomas, 53 non-marginal zone lymphomas, and 51 ocular adnexal biopsies without a lymphoproliferative disorder (LPD), from six geographical regions. C. psittaci was detected at similar low frequencies in non-LPD and non-marginal zone lymphoma groups from different geographical regions (0-14%). Overall, the prevalence of C. psittaci was significantly higher in MALT lymphomas (22%) than in non-LPD (10%, p=0.042) and non-marginal zone lymphoma cases (9%, p=0.033). However, the prevalence of C. psittaci infection in MALT lymphoma showed marked variation among the six geographical regions examined, being most frequent in Germany (47%), followed by the East Coast of the USA (35%) and the Netherlands (29%), but relatively low in Italy (13%), the UK (12%), and Southern China (11%). No significant differences in the detection of C. pneumoniae, C. trachomatis, HSV1, HSV2, ADV8, and ADV19 were found between lymphomas and controls from different geographical regions. In conclusion, our results show that C. psittaci, but not C. pneumoniae, C. trachomatis, HSV1, HSV2, ADV8 or ADV19, is associated with ocular adnexal MALT lymphoma and that this association is variable in different geographical areas.

Full text

Page 1

Journal of Pathology
J Pathol 2006; 209: 344–351
Published online 31 March 2006 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/path.1984
Original Paper
Chlamydia psittaci is variably associated with ocular
adnexal MALT lymphoma in different geographical
regions
E Chanudet,1Y Zhou,2CM Bacon,1AC Wotherspoon,3H-K M¨ uller-Hermelink,4P Adam,4HY Dong,5
D de Jong,6Y Li,7R Wei,8X Gong,9Q Wu,10R Ranaldi,11G Goteri,11SA Pileri,12H Ye,1RA Hamoudi,1
H Liu,1J Radford13and M-Q Du1*
1Department of Pathology, University of Cambridge, UK
2Nanfang Hospital, Southern Medical University, Guangzhou, China
3Department of Histopathology, Royal Marsden Hospital, London, UK
4Institute of Pathology, University of W¨ urzburg, Germany
5Genzyme Genetics, New York, USA
6Department of Pathology, Netherlands Cancer Institute, Amsterdam, The Netherlands
7Sun Yat-Sen University Ophthalmologic Hospital, Guangzhou, China
8Department of Ophthalmology, Changzheng Hospital, Shanghai, China
9Department of Pathology, Hainan Province Hospital, China
10Sun Yat-Sen University Tumour Hospital, Guangzhou, China
11Anatomia Patologica, Universit` a Politecnica delle Marche, Ancona, Italy
12Unit` a Operativa di Emolinfopatologia - Universit` a degli Studi di Bologna, Italy
13Cancer Research UK, Department of Medical Oncology, Christie Hospital, Manchester, UK
*Correspondence to:
Professor M-Q Du, University of
Cambridge, Division of Molecular
Histopathology, Box 231, Level
3, Lab Block, Addenbrooke’s
Hospital, Hills Road, Cambridge
CB2 2QQ, UK.
E-mail: mqd20@cam.ac.uk
Received: 24 January 2006
Revised: 22 February 2006
Accepted: 25 February 2006
Abstract
Infectious agents play a critical role in MALT lymphoma development. Studies from
Italy showed Chlamydia psittaci infection in 87% of ocular adnexal MALT lymphomas
and complete or partial regression of the lymphoma after C. psittaci eradication in
four of nine cases. However, C. psittaci was not demonstrated in ocular adnexal MALT
lymphomas from the USA. This study was thus designed to investigate further the role of
C. psittaci, and other infectious agents commonly associated with chronic eye disease, in the
development of ocular adnexal MALT lymphoma. The presence of C. psittaci, C. trachomatis,
C. pneumoniae, herpes simplex virus 1 and 2 (HSV1, HSV2), and adenovirus 8 and 19
(ADV8, ADV19) was assessed separately by polymerase chain reaction in 142 ocular adnexal
MALT lymphomas, 53 non-marginal zone lymphomas, and 51 ocular adnexal biopsies
without a lymphoproliferative disorder (LPD), from six geographical regions. C. psittaci
was detected at similar low frequencies in non-LPD and non-marginal zone lymphoma
groups from different geographical regions (0–14%). Overall, the prevalence of C. psittaci
was significantly higher in MALT lymphomas (22%) than in non-LPD (10%, p = 0.042)
and non-marginal zone lymphoma cases (9%, p = 0.033). However, the prevalence of C.
psittaci infection in MALT lymphoma showed marked variation among the six geographical
regions examined, being most frequent in Germany (47%), followed by the East Coast of
the USA (35%) and the Netherlands (29%), but relatively low in Italy (13%), the UK (12%),
and Southern China (11%). No significant differences in the detection of C. pneumoniae, C.
trachomatis, HSV1, HSV2, ADV8, and ADV19 were found between lymphomas and controls
from different geographical regions. In conclusion, our results show that C. psittaci, but not
C. pneumoniae, C. trachomatis, HSV1, HSV2, ADV8 or ADV19, is associated with ocular
adnexal MALT lymphoma and that this association is variable in different geographical
areas.
Copyright  2006 Pathological Society of Great Britain and Ireland. Published by John
Wiley & Sons, Ltd.
Keywords:
Chlamydia psittaci; ocular adnexal MALT lymphoma
Introduction
Extranodal marginal zone B cell lymphoma of mucosa-
associated lymphoid tissue (MALT lymphoma) arises
at a number of extranodal sites including the gas-
trointestinal tract, salivary and thyroid glands, lung,
ocular adnexa, and skin. Interestingly, these organs
are devoid of native lymphoid tissue: lymphoma at
these sites arises from the MALT acquired as a result
of a chronic inflammatory or autoimmune disorder [1].
The inflammatory disease associated with MALT lym-
phoma not only provides a microenvironment that is
Copyright  2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Page 2

Variable association of C. psittaci with ocular adnexal MALT lymphoma345
crucial for malignant transformation, but the immuno-
logical response generated during the inflammatory
process also promotes the growth of the lymphoma
cells. This is best exemplified in gastric MALT lym-
phoma, which is driven by Helicobacter pylori medi-
ated immune responses and can be effectively treated
by eradication of the bacterium in the majority of cases
[2–4]. Similarly, Borrelia burgdorferi and Campy-
lobacter jejuni infections are associated with cuta-
neous marginal zone B-cell lymphoma and immuno-
proliferative small intestinal disease respectively, and
eradication of these organisms resulted in complete
regression of the lymphoma in some cases [5–10].
Together, these findings suggest that the development
of MALT lymphomas at other sites may also be asso-
ciated with infectious agents.
Ocular adnexal MALT lymphoma represents a sig-
nificant proportion (approximately 12%) of all MALT
lymphomas [11] and is the most common lymphoma
of the ocular adnexa [12–14], occurring principally
in the conjunctiva, orbital soft tissue, and lachry-
mal apparatus. Analogous to the evolution of gastric
MALT lymphoma from H. pylori associated chronic
gastritis, ocular adnexal MALT lymphoma may be
associated with chronic conjunctivitis; interestingly,
there is a considerable overlap in both the histologi-
cal and clinical presentations of chronic conjunctivitis
and ocular adnexal MALT lymphoma [15–17]. Ocu-
lar adnexal MALT lymphoma thus may arise from the
MALT acquired as a result of chronic inflammatory
responses. Infectious agents underlying chronic eye
infection, particularly those involved in chronic con-
junctivitis such as Chlamydia, herpes simplex virus
(HSV), and adenovirus (ADV) [18–22], may therefore
play a role in the development of lymphoma.
The aetiology of ocular adnexal MALT lymphoma
is currently unclear. Recent studies from Italy showed
evidence of Chlamydia psittaci (C. psittaci) infection
in 87% of ocular adnexal MALT lymphomas [23],
and eradication of the organism by antibiotics led
to complete or partial regression of the disease in
four of nine cases studied [24]. However, such an
association was not demonstrated in cases of ocular
adnexal MALT lymphoma from South Florida and
Rochester (New York) areas in the USA [25,26]. This
raises the possibility that C. psittaci may be variably
associated with ocular adnexal MALT lymphoma in
different geographical regions and that other aetiolog-
ical factors may be involved in the development of
this lymphoma. To examine these issues, we screened
for infectious agents underlying chronic eye infection,
namely C. psittaci, C. trachomatis, C. pneumoniae,
HSV types 1 and 2, and ADV types 8 and 19, in ocu-
lar adnexal lymphomas of various subtypes as well as
ocular adnexal biopsies without a lymphoproliferative
disorder (LPD), from six geographical regions.
Materials and methods
Tissue specimens
Archival formalin-fixed paraffin-embedded
adnexal biopsies from 263 patients from six geograph-
ical areas, obtained between 1981 and 2005, were
analysed. Of these cases, 246 had adequate mate-
rial as judged by quality control polymerase chain
reaction (PCR; detailed in a later section), and were
thus suitable for PCR screening of infectious agents.
These included a total of 195 lymphomas, consist-
ing of 142 MALT lymphomas and 53 non-marginal
ocular
Table 1. Demographic and histological characteristics of ocular adnexal lymphomas and controls from different geographical areas
Characteristics UK1
Germany Netherlands Italy2
Southern China3
East coast USA4
Total
No of patients
Median age (range)
Male/female ratio
8037 242159 25 246
64 (17–93)∗
0.9∗
58 (8–95)
1.3
62 (19–93)
0.6
61 (37–86)
0.5
60 (32–87)‡
69 (28–90) 62 (8–95)
1.3 2.6‡
1.3
Diagnosis
MALT L
Non-MZL5
Non-LPD6
3319 21 15 37
20
17 142
53
51
79
9
3
—
6
—
8
402—
Anatomical localization
Conjunctiva
Orbit
Other7
50†
5†
6†
22
13
2
2291 10 114
88
25
2
—
10
2
499
69
151 cases from London, 19 cases from Manchester, and 10 cases from Cambridge.
213 cases from Ancona and eight cases from Bologna.
329 cases from Canton, 15 cases from Hainan, and 15 cases from Shanghai.
418 cases from northeast, three from mid-east, and four from southeast coast.
521 follicular lymphomas, 13 mantle-cell lymphomas, 11 diffuse large B-cell lymphomas, and eight T/NK-cell lymphomas.
639 cases were conjunctival biopsies from unselected autopsies with no prior history of conjunctival or ocular disease [27] and the remaining
cases were mainly pinguecula and occasionally chalazion.
7Eyelid, lachrymal gland, extraocular muscle, globe, and three ocular adnexal cases without details of biopsy site.
∗Excluding 19 cases from Manchester and non-LPD cases, for which data are not available.
†Excluding 19 cases from Manchester, for which data are not available.
‡Excluding 29 cases from Canton, for which data are not available.
No = number; LPD = lymphoproliferative disorder; MZL = marginal zone lymphoma; MALT L = mucosa-associated lymphoid tissue lymphoma.
J Pathol 2006; 209: 344–351

Page 3

346E Chanudet et al
zone lymphomas, as well as 51 ocular adnexal biopsies
without any histological evidence of a LPD (Table 1).
Cases were diagnosed or reviewed by haematopathol-
ogists. Table 1 summarises the anatomical location of
these biopsies together with the patients’ age and sex.
Local ethical guidelines were followed for the use of
archival paraffin embedded tissues for research, and
such use was approved by the local ethics committees
of the authors’ institutions where required.
DNA extraction
Tissue sections (3–5 µm) were dewaxed in xylene and
washed in ethanol. DNA was extracted and purified
using QIAamp DNA Mini Kit (QIAGEN) according
to the manufacturer’s instructions, and quantified using
a NanoDrop spectrophotometer (NanoDrop Technolo-
gies, Wilmington, USA).
Quality control PCR
The quality of each DNA sample was assessed by
PCR amplification of variously sized human gene
fragments (100 bp, 200 bp, 300 bp, and 400 bp)
(Table 2) [28]. A multiplex PCR was carried out using
ABgene Thermo-Start DNA polymerase (Surrey, UK)
following the supplier’s protocol. PCR products were
analysed by electrophoresis on 6% polyacrylamide
gels. Only cases with successful amplification of a 200
bp or larger product were used to screen for infectious
agents
Detection of infectious agents by PCR
Stringent laboratory procedures for PCR set-up and
product analyses were carefully followed to avoid
any potential cross contamination. PCRs without tem-
plate DNA were randomly interspersed among test
samples to monitor potential cross contamination. Pro-
cedures for the detection of each Chlamydia species
were validated by a double blind comparison of two
series of DNA samples with known chlamydial sta-
tus between our laboratory and Dr Dolcetti’s labora-
tory.
Chlamydiae
The detection of C. trachomatis, C. psittaci, and
C. pneumoniae was carried out using a previously
described Touchdown Enzyme Time-Release (TETR)
PCR [23,29], with the following modifications. Instead
of multiplex PCR, separate PCRs for each Chlamy-
dia species were performed. For C. trachomatis and
C. pneumoniae, new primer sets were designed to
target smaller fragments of the 16S rRNA gene
(Table 2), thus suitable for screening DNA samples
prepared from paraffin-embedded tissues. Addition-
ally, higher touchdown annealing temperatures from
66◦C to 56◦C were used for C. trachomatis detec-
tion. For all Chlamydiae screening, PCR amplifica-
tions were carried out in a 25 µl reaction mixture
containing 150 ng of template DNA. PCR products
were analysed by electrophoresis on 10% polyacry-
lamide gels.
In each case, three independent PCR amplifications
were carried out for each Chlamydia species. To make
data comparable, we adopted the approach by Ferreri
et al [23] and only cases with positive PCR results in
at least two of the three independent reactions were
regarded as true positives.
Adenovirus and Herpes simplex virus
ADV types 8 and 19 were separately detected by
PCR amplification of the viral hexon gene (Table 2).
ADV8 PCR was carried out in a 25 µl reaction mixture
Table 2. PCR primers used for DNA quality assessment and the molecular detection of infectious agents
Gene
Primer
nameSequence
Product
size (bp)
Quality control [28]TBXAS1 exon9 Q 100s
Q 100as
Q 200s
Q 200as
Q 300s
Q 300as
Q 400s
Q 400as
5?GCCCGACATTCTGCAAGTCC 3?
5?GGTGTTGCCGGGAAGGGTT 3?
5?TGTTGACTCGATCCACCCCA 3?
5?TGAGCTGCAAGTTTGGCTGAA 3?
5?TGCGATGTGGTCATCATGGTG 3?
5?CGTGTCATTGTCGTCTGAGGC 3?
5?CCGCAGCAAGCAACGAACC 3?
5?GCTTTCCTCTGGCGGCTCC 3?
5?CCCAAGGTGAGGCTGATGAC 3?
5?CAAACCGTCCTAAGACAGTTA 3?
5?ATTCGATGCAACGCGAAGGACCT 3?
5?TGCGGAAAGCTGTATTTCTACAGTT 3?
5?TATTTGGGCATCCGAGTAACG 3?
5?AGACGTCATAGCCTTGGTAGGCC 3?
5?AACCAGCCAAAGAGGATGAAAG 3?
ADV19 87as 5?TGTCTCTGAAGCCAATGTAGTTG 3?
ADV8 65s5?ATGTGGAACTCTGCGGTGGACA 3?
ADV8 65as5?TCCACACCGTGATTCTCAAT 3?
HSV1/2 92s5?CATCACCGACCCGGAGAGGGAC 3?
HSV1/2 92as 5?GGGCCAGGCGCTTGTTGGTGTA 3?
100
Recombination activating gene 1 (RAG1)
exon2
Promyelocytic leukaemia zinc finger (PLZF)
exon1
ALL1 fused gene from chromosome 4 (AF4)
exon11
200
300
400
C. psittaci [29] 16S rRNA and 16S–23S spacer rRNACPS 100s
CPS 101as
CPN 73s
CPN 91as
CTR 116s
CTR 116as
ADV19 87s
111
C. pneumoniae [29]16S rRNA73
C. trachomatis
16S rRNA116
Adenovirus type 19 Hexon gene for major capsid protein87
Adenovirus type 8 Hexon gene for major capsid protein 65
Herpes simplex virus
type 1 and 2 [30]
DNA polymerase gene 92
J Pathol 2006; 209: 344–351

Page 4

Variable association of C. psittaci with ocular adnexal MALT lymphoma347
using ABgene Thermo-Start DNA polymerase. The
touchdown protocol used consisted of 95◦C × 30 s,
63◦C × 45 s (decreased 1◦C every two cycles until
60◦C), and 72◦C × 30 s, followed by 35 cycles with
the annealing temperature at 59◦C. The cycle param-
eters for ADV19 PCR were identical to those used for
C. trachomatis PCR.
HSV types 1 and 2 (HSV1/2) were simultaneously
screened with a common primer set [30] (Table 2).
The cycle parameters for HSV1/2 PCR were identical
to those used for ADV8 PCR.
PCR products were analysed by electrophoresis on
10% polyacrylamide gels. As with our assays for
Chlamydiae, a case was considered positive when
the virus was detected in at least two of three
PCRs.
DNA sequencing
PCR products from selected cases of different geo-
graphical origins were purified and sequenced in both
orientations using an ABI 377 DNA sequencer (ABI
PRISM Perkin Elmer Warrington, UK). Sequences
were analysed by BLAST search of the NCBI database
(http://www.ncbi.
nlm.nih.gov/blast, accessed 9 March 2006).
Statistical analysis
Differences in the prevalence of infectious agents
among various lymphoma subtypes and controls were
analysed using Fisher’s exact test (“stats Package” in
R version 2.1.1).
Results
C. psittaci is detected at variable frequencies in
ocular adnexal MALT lymphomas from different
geographical regions
A total of 246 ocular adnexal biopsies were assessed
for the presence of C. trachomatis, C. psittaci, and
C. pneumoniae by separate PCRs (Figure 1). Quality
control did not show any differences in the quality
of DNA samples from lymphoma specimens from the
various geographical regions. We sequenced 17 C.
psittaci, 10 C. trachomatis, and 10 C. pneumoniae
PCR products from different geographical regions and
all were confirmed to be specific, demonstrating the
reliability of the method. With the exception of one C.
psittaci and two C. pneumoniae PCR products, each
of which contained a single nucleotide change, the
PCR products sequenced did not show any sequence
variations.
Overall, 31/142 (22%) cases of MALT lymphoma
from all regions were positive for C. psittaci, a fre-
quency significantly higher than that observed in both
non-LPD samples (p = 0.042) and non-marginal zone
lymphoma samples (p = 0.033) from all areas. C.
psittaci DNA was detected at broadly similar fre-
quencies in both non-LPD and non-marginal zone
lymphoma groups from different geographical regions
(0–14%) (Table 3). In contrast, the bacterium was
found at variable prevalences in MALT lymphomas
from different regions, being more frequent in Ger-
many (47%), followed by the East Coast of the USA
(35%) and the Netherlands (29%), but relatively low in
Figure 1. PCR detection of C. psittaci, C. pneumoniae, and C. trachomatis DNA in ocular adnexal MALT lymphoma specimens (10%
polyacrylamide gel). M, molecular weight marker; −/+, negative/positive controls. S1–S10: MALT lymphomas (S1–S3 W¨ urzburg,
Germany; S4–S5 Manchester, UK; S6–S7, Bologna, Italy; S8, Hainan, China; S9–S10, Canton, China). S6: positive for both C.
pneumoniae and C. trachomatis
J Pathol 2006; 209: 344–351

Page 5

348E Chanudet et al
Table 3. Frequencies of Chlamydiae detected in ocular adnexal lymphomas and controls from different geographical areas∗
UKGermany Netherlands ItalySouthern China East coast USATotal
Chlamydiae
DiagnosisNo% No% No% No% No% No% No%
C. psittaci
MALT L
Non-MZL†
Non-LPD
4/33
1/7
4/40
12
14
10
9/19
0/9
1/9
471
0
11
6/21
2/3
—
29 2/15
0/6
—
134/37
2/20
0/2
11
10
6/17
0/8
—
352
0
—
31/142
5/53
5/51
223
9
10
0
——
C. pneumoniae
MALT L
Non-MZL†
Non-LPD
5/30
0/5
10/40
17 4/19
0/9
2/9
21 0/12
0/3
—
0 0/15
1/6
—
0 8/37
2/20
0/2
22
10
0/14
0/4
—
017/127
3/47
12/51
13
017
—
6
25 22—— 24
C. trachomatis
MALT L
Non-MZL†
Non-LPD
6/30
3/5
10/40
201/19
0/9
0/9
5
0
0
2/12
1/3
—
171/15
0/6
—
7
0
0/37
0/20
0/2
0
0
2/14
1/4
—
14 12/127
5/47
10/51
9
11
20 25———
∗A case was regarded as positive if the screened bacterium was detected in at least two of three independent PCRs [23]. Percentages are only
provided for groups with more than five cases.
†Follicular lymphoma, mantle-cell lymphoma, diffuse large B-cell lymphoma, and T/NK-cell lymphoma.
1Significantly different from non-MZLs from Germany (p = 0.013) and also significantly different from MALT lymphomas from the UK (p = 0.007),
Italy (p = 0.039), and Southern China (p = 0.004).
2Significantly different from MALT lymphomas from Southern China (p = 0.041).
3Significantly different from all non-LPDs (p = 0.042) and from all non-MZLs (p = 0.033).
MALT L = mucosa-associated lymphoid tissue lymphoma; MZL = marginal zone lymphoma; LPD = lymphoproliferative disorder.
Italy (13%), the UK (12%), and Southern China (11%)
(Table 3). Interestingly, three of the six positive cases
detected within our USA group were from Florida and
New York, where no association was found between
C. psittaci infection and ocular adnexal MALT lym-
phomas in previous studies [25,26]. The prevalence of
C. psittaci in MALT lymphomas from Germany was
significantly higher than those observed in the UK,
Italy, and Southern China (p < 0.04). There was no
correlation between C. psittaci positivity and either the
age or sex of the patients or the anatomical location
of the lymphoma. The prevalence of C. psittaci posi-
tivity was nearly identical between cases that occurred
in the orbit (15%) and those involving the conjunctiva
(16%). In addition, there was no apparent difference in
the prevalence of C. psittaci among various subtypes
of non-marginal zone lymphomas.
A total of 225 cases with sufficient DNA quan-
tity were screened for the presence of C. pneumo-
niae and C. trachomatis. Both bacteria were found
at variable frequencies in non-LPD and non-marginal
zone lymphoma groups from different geographical
regions (0–25%) (Table 3). Only cases from South-
ern China showed a trend towards a higher prevalence
of C. pneumoniae in MALT lymphomas than in non-
LPD and non-marginal zone lymphoma cases from
the same region (Table 3), but these differences were
not statistically significant. There was no difference
in the prevalences of C. trachomatis between MALT
lymphoma and control groups, both non-LPDs, and
non-marginal zone lymphomas, from the same geo-
graphical regions. In general, the presence of these
Chlamydiae was mutually exclusive.
To examine whether there was any correlation
between the positivity for Chlamydiae and the extent
of lymphoid infiltration in the non-LPD group, the his-
tology of these cases was reviewed. These specimens
typically showed variable infiltrates of mature lympho-
cytes and plasma cells within the lamina propria, and
some contained a few intraepithelial neutrophils. Occa-
sionally, the infiltrating lymphocytes formed small
aggregates but no lymphoid follicles were seen. There
was no correlation between the positivity for Chlamy-
diae and the extent of lymphoid infiltration in these
control samples.
Adenovirus and herpes simplex virus are not
associated with ocular adnexal lymphoma
A total of 152 cases with adequate DNA quality had a
sufficient quantity of DNA to screen for the presence
of ADV8, ADV19 and HSV1/2. Sequencing confirmed
the specificity of the PCR products in all positive
cases. Only low levels of positivity (0–14%) for these
viruses were found in both control and MALT lym-
phoma groups. No difference was seen in the preva-
lences of these viruses between MALT lymphoma and
control groups from different geographical regions.
Discussion
By retrospective investigation of archival ocular
adnexal MALT lymphomas from six geographical
regions, we provide evidence that C. psittaci is asso-
ciated with ocular adnexal MALT lymphoma but that
this association is highly variable according to the geo-
graphical origin, with a frequency of C. psittaci in
ocular adnexal MALT lymphoma ranging from 11% to
nearly 50% in the different geographical areas exam-
ined. Importantly, these findings provide an explana-
tion for the discrepancy between the original study
by Ferreri et al (Milan, Italy) and subsequent reports:
in Italy, C. psittaci was detected in 87% of ocular
adnexal MALT lymphoma [23], while no evidence of
J Pathol 2006; 209: 344–351

Page 6

Variable association of C. psittaci with ocular adnexal MALT lymphoma349
infection by this bacterium was demonstrated in cases
from the South Florida and Rochester (New York)
areas of the USA [25,26]. Such geographical varia-
tions are further supported by recent meeting abstracts
showing a high prevalence of C. psittaci in ocular
adnexal MALT lymphomas from South Korea (26/33)
[31], but an absence or a low prevalence in cases
from North America (0/15) [32] and Cuba (1/21) [33].
Interestingly, such a geographically variable associa-
tion may also exist within the same country as shown
by the differences in the prevalence of C. psittaci in
ocular adnexal MALT lymphomas from Italy and the
USA observed between the current study and previous
reports [23,25,26,32].
The reasons underlying the marked variations in the
prevalences of C. psittaci in ocular adnexal MALT
lymphoma from different geographical regions are cur-
rently unknown. However, such geographical differ-
ences in linking infectious organisms with lymphoma,
including within the same country, are not unprece-
dented, as the established associations between lym-
phoma and respectively hepatitis C virus, Borrelia
burgdorferi and H. pylori are subject to marked geo-
graphical variations [34–36]. The prevalences of C.
psittaci infection among the general populations of
the geographical regions studied may vary, but epi-
demiological data specifically on ocular infection by
C. psittaci are lacking. Given that the prevalence of
C. psittaci infection in ocular adnexal MALT lym-
phoma is relatively low, at least in several geograph-
ical regions, and that variable prevalences are also
found within the same country, the bacterial infection
could be sporadic. Indeed, there is substantial evidence
that C. psittaci infection in man is significantly asso-
ciated with the environmental context, especially with
exposure to pet birds and pet cats [37]. Interestingly,
in the study by Ferreri [23], 13/24 interviewed patients
with C. psittaci-positive ocular adnexal lymphomas
had prolonged contact with household animals.
Overall, C. psittaci was found at a significantly
higher prevalence in MALT lymphomas than in non-
marginal zone lymphomas. The frequency of C.
psittaci in non-marginal zone lymphoma cases was
similar to the frequency observed in the non-LPD
cases. These results suggest that the bacterium might
be preferentially associated with MALT lymphoma,
further implicating its role in the development of
MALT lymphoma. In this context, it would be interest-
ing to examine whether different strains of C. psittaci,
with potentially different pathogenic capacities, could
be differentially associated with various types of lym-
phoma, or with different geographical regions show-
ing variable prevalences of C. psittaci-positive MALT
lymphoma. Indeed, various strains of H. pylori have
been shown to be differentially involved in several
gastric diseases, with the virulent strains being prefer-
entially associated with gastric cancer or peptic ulcer
rather than with gastritis [38–40].
The demonstration of variable association of C.
psittaci with ocular adnexal MALT lymphoma in
different geographical regions is clinically important.
In Italy, eradication of C. psittaci by antibiotics
led to complete or partial regression of the disease
in four of nine cases studied [24]. Patients who
responded to antibiotics included some who did not
respond to radiotherapy or chemotherapy, or showed
repeated relapses of the disease after such treatment.
Given that antibiotic treatment has relatively few side
effects and ocular adnexal MALT lymphoma is an
indolent disease, further clinical trials are warranted
to determine the role of antibiotics in the treatment of
this lymphoma. In this context, the prevalence of C.
psittaci in ocular adnexal MALT lymphoma in a given
geographical area is likely to be a major determinant
of the value of such treatment in each clinical setting.
Among the six geographical regions examined in
the current study, the highest prevalence of C. psittaci
observed was in ocular adnexal MALT lymphomas
from Germany (47%). This is much lower than the
frequency observed in the original study from Italy
(87%) [23]. It could be argued that the concentration
of C. psittaci DNA in some of the tumour specimens
might be low, potentially leading to underestimation
of its true prevalence. However, the lower detection
rate in the current study is unlikely to be due to a
lack of sensitivity of our assays. Firstly, an identical
PCR amplification of the same gene fragment specific
to C. psittaci was used in both the original study and
our current study. Secondly, we performed separate
PCRs for each Chlamydia species and analysed PCR
products on high-resolution gels, further ensuring
the sensitivity and specificity of the method. The
reliability of our data is supported by the finding that,
in 80% of the positive cases, C. psittaci was detected
in all three PCRs independently performed for each
case.
Although we provide compelling evidence that ocu-
lar adnexal MALT lymphoma may develop from the
MALT acquired as a result of chronic inflammation
associated with C. psittaci, the low prevalence of C.
psittaci in ocular adnexal MALT lymphoma in sev-
eral geographical regions raises the possibility that
other aetiological factors may be involved in the devel-
opment of this lymphoma. Several other organisms,
including C. trachomatis, C. pneumoniae, ADV types
8 and 19, and HSV types 1 and 2, are known to
cause chronic eye infection [18–20]. We screened
our cases for these infectious agents and found that
their prevalences in both ocular adnexal MALT lym-
phoma and control groups were relatively low. Our
results thus suggest that these infectious agents are
unlikely to be associated with ocular adnexal MALT
lymphoma, at least in the geographical regions investi-
gated. Other aetiological factors underlying the devel-
opment of adnexal MALT lymphoma remain to be
investigated. Interestingly, some autoimmune disor-
ders are known to be associated with an increased risk
of lymphoma development [41,42], including MALT
lymphoma [43–45], and some of them, such as sys-
temic lupus erythematosus and Sj¨ ogren’s syndrome,
J Pathol 2006; 209: 344–351

Page 7

350E Chanudet et al
often affect the ocular adnexa [46,47]. In this regard,
it would be interesting to examine any possible role
for autoimmunity in the development of ocular adnexal
MALT lymphoma [48].
In summary, our results demonstrate that C. psittaci
is variably associated with ocular adnexal MALT
lymphoma in different geographical regions. Among
different subtypes of ocular adnexal lymphomas, the
bacterium appeared to be preferentially associated with
MALT lymphomas. These findings have important
clinical implications when considering the use of
antibiotics to treat ocular adnexal MALT lymphomas.
Acknowledgements
The Du Lab is supported by research grants from the
Leukaemia and Lymphoma Society, USA, Association for
International Cancer Research, and Leukaemia Research Fund,
UK. CB is supported by a Senior Clinician Scientist Fellowship
from the Health Foundation, the Royal College of Patholo-
gists, and the Pathological Society of Great Britain and Ireland.
We thank Dr Riccardo Dolcetti, IRCCS National Cancer Insti-
tute, Aviano Italy, for providing Chlamydiae positive control
samples and performing the double blind investigation for opti-
misation of the PCR screening protocols; Dr Hongyi Zhang,
Department of Clinical Virology, Addenbrooke NHS Trust, for
providing herpes simplex virus positive control samples; and
Dr G Gallucci, CDC, Atlanta, for providing adenovirus positive
control samples. We would also like to thank Professor Li Qun
of Hainan Medical College, Jan Paul de Boer of the Netherlands
Cancer, Mr Mark Staveley, and Ms Sue Goddard for retrieving
tissue blocks and patient information for the study.
References
1. Du MQ, Isaacson PG. Gastric MALT lymphoma: from aetiology
to treatment. Lancet Oncol 2002;3:97–104.
2. Hussell T, Isaacson PG, Crabtree JE, Spencer J. The response
of cells from low-grade B-cell gastric lymphomas of mucosa-
associated lymphoid tissue to Helicobacter pylori. Lancet
1993;342:571–574.
3. Hussell T, Isaacson PG, Crabtree JE, Spencer J. Helicobacter
pylori-specifictumour-infiltrating
dependent help for the growth of malignant B cells in low-grade
gastric lymphoma of mucosa-associated lymphoid tissue. J Pathol
1996;178:122–127.
4. Wotherspoon AC, Doglioni C, Diss TC, Pan L, Moschini A, de
Boni M, et al. Regression of primary low-grade B-cell gastric
lymphoma of mucosa-associated lymphoid tissue type after
eradication of Helicobacter pylori. Lancet 1993;342:575–577.
5. Kutting B, Bonsmann G, Metze D, Luger TA, Cerroni L. Borrelia
burgdorferi-associated primary cutaneous B cell lymphoma:
complete clearing of skin lesions after antibiotic pulse therapy or
intralesional injection of interferon alfa-2a. J Am Acad Dermatol
1997;36:311–314.
6. Cerroni L, Zochling N, Putz B, Kerl H. Infection by Borrelia
burgdorferi and cutaneous B-cell lymphoma. J Cutan Pathol
1997;24:457–461.
7. Roggero E, Zucca E, Mainetti C, Bertoni F, Valsangiacomo C,
Pedrinis E, et al. Eradication of Borrelia burgdorferi infection in
primary marginal zone B-cell lymphoma of the skin. Hum Pathol
2000;31:263–268.
8. Goodlad JR, Davidson MM, Hollowood K, Ling C, MacKen-
zie C, Christie I, et al. Primary cutaneous B-cell lymphoma and
Borrelia burgdorferi infection in patients from the Highlands of
Scotland. Am J Surg Pathol 2000;24:1279–1285.
T cells providecontact
9. Lecuit M, Abachin E, Martin A, Poyart C, Pochart P, Suarez F,
et al. Immunoproliferative small intestinal disease associated with
Campylobacter jejuni. N Engl J Med 2004;350:239–248.
10. Al Saleem T,Al Mondhiry H.
intestinal disease (IPSID): a model for mature B-cell neoplasms.
Blood 2005;105:2274–2280.
11. Isaacson PG, Muller-Hermelink HK, Berger F. Extranodal
marginal zone B-cell lymphoma (MALT lymphoma). In WHO
Classification of Tumours, Pathology and Genetics of Tumours of
Haematopoietic and Lymphoid Tissue, Jaffe E, et al (eds). IARC
Press: Lyon, 2001; 157–160.
12. Jenkins C, Rose GE, Bunce C, Wright JE, Cree IA, Plowman N,
et al. Histological features of ocular adnexal lymphoma (REAL
classification) and their association with patient morbidity and
survival. Br J Ophthalmol 2000;84:907–913.
13. Auw-Haedrich C, Coupland SE, Kapp A, Schmitt-Graff A, Buchen
R, Witschel H. Long term outcome of ocular adnexal lymphoma
subtyped according to the REAL classification. Revised European
and American Lymphoma. Br J Ophthalmol 2001;85:63–69.
14. Fung CY, Tarbell NJ, Lucarelli MJ, Goldberg SI, Linggood RM,
Harris NL, et al. Ocular adnexal lymphoma: clinical behavior of
distinct World Health Organization classification subtypes. Int J
Radiat Oncol Biol Phys 2003;57:1382–1391.
15. Akpek EK, Polcharoen W, Chan R, Foster CS. Ocular surface
neoplasia masquerading as chronic blepharoconjunctivitis. Cornea
1999;18:282–288.
16. Mannami T, Yoshino T, Oshima K, Takase S, Kondo E, Ohara N,
et al. Clinical, histopathological, and immunogenetic analysis of
ocular adnexal lymphoproliferative disorders: characterization of
MALT lymphoma and reactive lymphoid hyperplasia. Mod Pathol
2001;14:641–649.
17. Lee DH, Sohn HW, Park SH, Kang YK. Bilateral conjunctival
mucosa-associated lymphoid tissue lymphoma misdiagnosed as
allergic conjunctivitis. Cornea 2001;20:427–429.
18. Darougar S, Monnickendam MA, Woodland RM. Management
and prevention of ocular viral and chlamydial infections. Crit Rev
Microbiol 1989;16:369–418.
19. Morrow GL, Abbott RL. Conjunctivitis. Am Fam Physician
1998;57:735–746.
20. Lee SY, Laibson PR. Medical management of herpes simplex
ocular infections. Int Ophthalmol Clin 1996;36:85–97.
21. Elnifro EM,Cooper RJ, Klapper PE,
Diagnosis of viral and chlamydial keratoconjunctivitis: which
laboratory test? Br J Ophthalmol 1999;83:622–627.
22. Lietman T,Brooks D,Moncada J,
Dean D. Chronic follicular
Chlamydia psittaci or Chlamydia pneumoniae. Clin Infect Dis
1998;26:1335–1340.
23. Ferreri AJ, Guidoboni M, Ponzoni M, De Conciliis C, Dell’Oro S,
Fleischhauer K, et al. Evidence for an association between
Chlamydia psittaci and ocular adnexal lymphomas. J Natl Cancer
Inst 2004;96:586–594.
24. Ferreri AJ, Ponzoni M, Guidoboni M, De Conciliis C, Resti AG,
Mazzi B, et al. Regression of ocular adnexal lymphoma after
Chlamydia psittaci-eradicating antibiotic therapy. J Clin Oncol
2005;23:5067–5073.
25. Rosado MF, Byrne GE Jr, Ding F, Fields KA, Ruiz P, Dubovy
SR, et al. Ocular adnexal lymphoma: a clinicopathological study
of a large cohort of patients with no evidence for an association
with Chlamydia psittaci. Blood 2006;107:467–472.
26. Vargas RL, Fallone E, Felgar RE, Friedberg JW, Arbini AA,
Andersen AA, et al. Is there an association between ocular adnexal
lymphoma and infection with Chlamydia psittaci? The University
of Rochester experience. Leuk Res 2005;Oct 21; [Epub ahead of
print].
27. Wotherspoon AC, Hardman-Lea S, Isaacson PG. Mucosa-
associated lymphoid tissue (MALT) in the human conjunctiva. J
Pathol 1994;174:33–37.
28. Van Dongen JJ,Langerak AW,
Hummel M, Lavender FL, et al. Design and standardization
ofPCR primers and protocols
immunoglobulin and T-cell receptor gene recombinations in
Immunoproliferativesmall
Bailey AS, Tullo AB.
Schachter J,Dawson C,
conjunctivitisassociated with
Bruggemann M, Evans PA,
fordetection of clonal
J Pathol 2006; 209: 344–351

Page 8

Variable association of C. psittaci with ocular adnexal MALT lymphoma351
suspect lymphoproliferations: report of the BIOMED-2 Concerted
Action BMH4-CT98–3936. Leukemia 2003;17:2257–2317.
29. Madico G, Quinn TC, Boman J, Gaydos CA. Touchdown enzyme
time release-PCR for detection and identification of Chlamydia
trachomatis,
C.pneumoniae,
16S and 16S-23S spacer rRNA genes. J Clin Microbiol
2000;38:1085–1093.
30. Branco BC, Gaudio PA, Margolis TP. Epidemiology and molecu-
lar analysis of herpes simplex keratitis requiring primary penetrat-
ing keratoplasty. Br J Ophthalmol 2004;88:1285–1288.
31. You C, Ryu M, Huh J, Park J, Ahn H, Lee Y, et al. Ocular
adnexal lymphoma is highly associated with Chlamydia psittaci.
Proceedings of the European Cancer Conference ECCO 13, Paris
France, November 2005 (abstract 982).
32. Zhang GS, Winter JN, Variakojis D, Reich S, Lissner GS,
Bryar P, et al. No association between Chlamydia psittaci and
ocular adnexal lymphoma in North American samples. Blood
2005;106:abstr 999.
33. Gracia E, Mazzucchelli L, Fr¨ osch P, Jimerez J, Rodriguez D,
Capo V, et al. Low prevalence of Chlamydia psittaci infection
in ocular adnexal lymphomas (OAL) from Cuban patients. Ann
Oncol 2005;16(suppl):abstr 303.
34. Negri E, Little D, Boiocchi M, La Vecchia C, Franceschi S. B-
cell non-Hodgkin’s lymphoma and hepatitis C virus infection: a
systematic review. Int J Cancer 2004;111:1–8.
35. Wood GS, Kamath NV, Guitart J, Heald P, Kohler S, Smoller BR,
et al. Absence of Borrelia burgdorferi
B-cell lymphomas from the United States. J Cutan Pathol
2001;28:502–507.
36. Doglioni C, Wotherspoon AC, Moschini A, de Boni M, Isaac-
son PG. High incidence of primary gastric lymphoma in north-
eastern Italy. Lancet 1992;339:834–835.
37. Smith KA, Bradley KK, Stobierski MG, Tengelsen LA. Com-
pendium of measures to control Chlamydophila psittaci (formerly
Chlamydia psittaci) infection among humans (psittacosis) and pet
birds, 2005. J Am Vet Med Assoc 2005;226:532–539.
and
C.psittaci
usingthe
DNA in cutaneous
38. Van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schnee-
berger P, de Boer W, et al. Clinical relevance of the cagA,
vacA and iceA status of Helicobacter pylori. Gastroenterology
1998;115:58–66.
39. Miehlke S, Kirsch C, Agha-Amiri K, Gunther T, Lehn N, Malfer-
theiner P, et al. The Helicobacter pylori vacA s1, m1 genotype
and cagA is associated with gastric carcinoma in Germany. Int J
Cancer 2000;87:322–327.
40. Correa P, Schneider BG. Etiology of gastric cancer: what is new?
Cancer Epidemiol Biomarkers Prev 2005;14:1865–1868.
41. Cuttner J, Spiera H, Troy K, Wallenstein S. Autoimmune disease
is a risk factor for the development of non-Hodgkin’s lymphoma.
J Rheumatol 2005;32:1884–1887.
42. Engels EA, Cerhan JR, Linet MS, Cozen W, Colt JS, Davis S,
et al. Immune-related conditions and immune-modulating medica-
tions as risk factors for non-Hodgkin’s lymphoma: a case-control
study. Am J Epidemiol 2005;162:1153–1161.
43. Abbondanzo SL. Extranodal marginal-zone B-cell lymphoma of
the salivary gland. Ann Diagn Pathol 2001;5:246–254.
44. Hyjek E, Isaacson PG. Primary B cell lymphoma of the thyroid
and its relationship to Hashimoto’s thyroiditis. Hum Pathol
1988;19:1315–1326.
45. Pedersen RK, Pedersen NT. Primary non-Hodgkin’s lymphoma
of the thyroid gland: a population based study. Histopathology
1996;28:25–32.
46. Arevalo JF, Lowder CY, Muci-Mendoza R. Ocular manifestations
ofsystemiclupus erythematosus.
2002;13:404–410.
47. Bjerrum KB. Primary Sjogren’s syndrome and keratoconjunctivitis
sicca: diagnostic methods, frequency and social disease aspects.
Acta Ophthalmol Scand Suppl 2000;231:1–37.
48. Nutting CM, Shah-Desai S, Rose GE, Norton AP, Plowman
PN. Thyroid orbitopathy possibly predisposes to late-onset
of periocular lymphoma. Eye 2005;Aug 26; [Epub ahead of
print].
Curr Opin Ophthalmol
J Pathol 2006; 209: 344–351