Repair and polyadenylation of a naturally occurring hepatitis C virus 3' nontranslated region-shorter variant in selectable replicon cell lines.

Abstract

The 3' nontranslated region (NTR) of the hepatitis C virus (HCV) genome is highly conserved and contains specific cis-acting RNA motifs that are essential in directing the viral replication machinery to initiate at the correct 3' end of the viral genome. Since the ends of viral genomes may be damaged by cellular RNases, preventing the initiation of viral RNA replication, stable RNA hairpin structures in the 3' NTR may also be essential in host defense against exoribonucleases. During 3'-terminal sequence analysis of serum samples of a patient with chronic hepatitis related to an HCV1b infection, a number of clones were obtained that were several nucleotides shorter at the extreme 3' end of the genome. These shorter 3' ends were engineered in selectable HCV replicons in order to enable the study of RNA replication in cell culture. When in vitro-transcribed subgenomic RNAs, containing shorter 3' ends, were introduced into Huh-7 cells, a few selectable colonies were obtained, and the 3' terminus of these subgenomic RNAs was sequenced. Interestingly, most genomes recovered from these colonies had regained the wild-type 3' ends, showing that HCV, like several other positive-stranded RNA viruses, has developed a strategy to repair deleted 3' end nucleotides. Furthermore, we found several genomes in these replicon colonies that contained a poly(A) tail and a short linker sequence preceding the poly(A) tail. After recloning and subsequent passage in Huh-7 cells, these poly(A) tails persisted and varied in length. In addition, the connecting linker became highly diverse in sequence and length, suggesting that these tails are actively replicated. The possible terminal repair mechanisms, including roles for the poly(A) tail addition, are discussed.

Full text

Page 1

JOURNAL OF VIROLOGY, May 2006, p. 4336–4343
0022-538X/06/$08.00?0
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 80, No. 9
doi:10.1128/JVI.80.9.4336–4343.2006
Repair and Polyadenylation of a Naturally Occurring Hepatitis C
Virus 3? Nontranslated Region-Shorter Variant in Selectable
Replicon Cell Lines
Hans C. van Leeuwen,* Jolanda M. P. Liefhebber, and Willy J. M. Spaan
Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center,
2300 RC Leiden, The Netherlands
Received 19 December 2005/Accepted 1 February 2006
The 3? nontranslated region (NTR) of the hepatitis C virus (HCV) genome is highly conserved and contains
specific cis-acting RNA motifs that are essential in directing the viral replication machinery to initiate at the
correct 3? end of the viral genome. Since the ends of viral genomes may be damaged by cellular RNases,
preventing the initiation of viral RNA replication, stable RNA hairpin structures in the 3? NTR may also be
essential in host defense against exoribonucleases. During 3?-terminal sequence analysis of serum samples of
a patient with chronic hepatitis related to an HCV1b infection, a number of clones were obtained that were
several nucleotides shorter at the extreme 3? end of the genome. These shorter 3? ends were engineered in
selectable HCV replicons in order to enable the study of RNA replication in cell culture. When in vitro-
transcribed subgenomic RNAs, containing shorter 3? ends, were introduced into Huh-7 cells, a few selectable
colonies were obtained, and the 3? terminus of these subgenomic RNAs was sequenced. Interestingly, most
genomes recovered from these colonies had regained the wild-type 3? ends, showing that HCV, like several other
positive-stranded RNA viruses, has developed a strategy to repair deleted 3? end nucleotides. Furthermore, we
found several genomes in these replicon colonies that contained a poly(A) tail and a short linker sequence
preceding the poly(A) tail. After recloning and subsequent passage in Huh-7 cells, these poly(A) tails persisted
and varied in length. In addition, the connecting linker became highly diverse in sequence and length,
suggesting that these tails are actively replicated. The possible terminal repair mechanisms, including roles for
the poly(A) tail addition, are discussed.
Following entry into a host cell, positive-strand RNA viruses
produce several viral proteins, including an RNA-dependent
RNA polymerase (RdRp), which is responsible for the pro-
duction of progeny genomic RNA. RNA viruses have devel-
oped several strategies to ensure that sufficient amounts of
each template are synthesized and that replication starts at the
extreme ends. Specific cis-acting RNA motifs on the 3? end of
both the plus and minus strands play critical roles in directing
the viral replication machinery to initiate at the 3? ends (9, 11,
17, 34).
For hepatitis C virus (HCV), a positive-strand RNA virus of
the Flaviviridae family, the 3? nontranslated region of the ge-
nome (3?NTR) consist of three subregions, i.e., the variable
region, the poly(U/UC) region, and the 3? X-tail (Fig. 1A).
First, directly following the open reading frame, the 3?NTR
commences with a short variable region (approximately 40
nucleotides [nt]) that is poorly conserved between different
HCV genotypes (40). Next to this 3? variable region is a poly-
homopolymeric (U/UC) tract of variable length and composi-
tion containing mainly uridines with occasionally interspersed
cytidine residues. Directly downstream of the internal poly(U/
UC) tract is the extreme 3? end of 98 highly conserved bases,
which is designated 3? X-tail or core element (19, 35). The
secondary structure of this X-tail was defined by enzymatic and
chemical approaches and consists of a 46-nt long stem-loop
structure at the extreme 3? end (SL1) (2). The upstream 52 nt
of the X-tail appear to be less ordered both in secondary
structure predictions as well as in chemical probing experi-
ments (2, 40), suggesting that there is no obvious RNA struc-
ture. Deletion of the 3? X-tail renders the genomic RNA non-
infectious in naive chimpanzees, demonstrating that this RNA
element is critical for productive in vivo replication(20, 41).
Also, in the tissue culture HCV replicon system, deletion stud-
ies demonstrated that each element in the X-tail is required for
efficient RNA replication (8, 42).
Like other Flaviviridae, the HCV RdRp, NS5b, is able to
initiate RNA synthesis without the need for a primer in a de
novo RNA synthesis assay and requires only a single nucleo-
tide for priming (25, 28, 44). A possible function for the ex-
treme 3? stem-loop structure of HCV may be to recruit the
replication complex and to ensure de novo initiation at the very
3? terminal end (28, 32). Incorrect initiation of minus strands
will lead to inadvertent loss of genetic information. Further-
more, if viral genome 3? ends are exposed to cellular exonucle-
ases, deletion of 3? nucleotides could prevent viral RNA rep-
lication. Stable 3? stem-loop structures, therefore, may be
essential in viral defense against host nucleases, by acting as a
barrier against exoribonucleolytic trimming (30). Alternatively,
RNA viruses could escape nuclease degradation via sequester-
ing replicating RNA in virus-induced membranes structures
(36), covalent linkage of amino acids (7), or polyadenylation of
the 3? end (6, 29).
We describe here an HCV1b variant, with a deletion of 5 nt
* Corresponding author. Mailing address: Department of Medical Mi-
crobiology, Center of Infectious Diseases, Leiden University Medical
Center, Albinusdreef 2, 2300 RC Leiden, The Netherlands. Phone: 31-
71-5263649. Fax: 31-71-5266761. E-mail: H.C.van_Leeuwen@lumc.nl.
4336

Page 2

in the 3?-terminal end, that is repaired in subgenomic HCV
replicons when introduced in human hepatoma Huh-7 cells.
This suggests that there is a selective pressure for the restora-
tion of truncated ends. Analysis of the restored 3? ends further
revealed that in the repair process a subpopulation of the
genomic RNA was polyadenylated at the 3?end and contained
an additional linker sequence between the 3?NTR and
poly(A), which is atypical for Flaviviridae but reminiscent of
Sindbis virus genome termini.
MATERIALS AND METHODS
Cell culture. Huh-7 hepatocellular carcinoma cells were maintained in Dul-
becco modified Eagle medium (Cambrex, Belgium) supplemented with 10%
heat-inactivated fetal calf serum (PAA Laboratories), 2 mM L-glutamine, and
1% nonessential amino acids (Invitrogen). For cell lines carrying HCV replicons,
500 ?g of G418 ml?1was added (Geneticin; Life Technologies).
HCV 3?NTR amplification. 3?-End determination of serum extracted HCV
RNA was performed as previously described (19). In brief, a 3?-blocked and
5?-phosphorylated oligonucleotide 760 (GACTGTTGTGGCCTGCAGGGCCG
AATT) was ligated to the 3? end of the HCV genome by using T4 RNA ligase
(Invitrogen). From this ligation reaction, cDNA was made by using an antisense
primer (TAATTCGGCCCTGCAGGCCACAACA) partially complementary to
the ligated oligonucleotide 760 using Thermoscript reverse transcriptase (In-
vitrogen). First-strand cDNA was amplified by using the primers 799 (9246?-T
GGTTCGTTGCTGGTTACAGC?-9266; forward primer) and 758 (AATTCGG
CCCTGCAGGCCACAACAGTC; reverse primer), complementary to the
ligated oligonucleotide 760, in the Expand High Fidelity PCR system (Roche).
The resulting band of approximately 360 bp was cloned into the pCR2.1-Topo
vector (Invitrogen) and then sequenced using T7forward and M13rev primers;
Invitrogen) in both directions with an ABI Prism 310 Genetic Analyzer (Applied
Biosystems) and the Dye Dideoxy terminator sequencing kit (Applied Biosys-
tems). For determination of 3? ends from replicon cells extracted RNA, an
identical procedure was followed except the forward primer 799 was replaced
with 800 (9504?-CTTTGGTGGCTCCATCTTAG?-9523).
Plasmid constructions. The replicon vector used to test 3?NTR variants was
pFK-I389neo/NS3-5/5.1 (pFK5.1 [21]). Shorter and longer 3?NTR replicons were
generated by using the cloned 3?NTR cDNA pCR2.1-Topo plasmids (see above)
as a template for PCR amplification. The forward primer for all of these PCR
products was primer 800 (see above). The reverse primers were as follows: for
construct pFK5.1?5, primer 1158 (CCACTAGTGATATCTGCAGAGAGGCC
AGTATC?-9580), for pFK5.1C-5U, primer 1222 (GGGACTAGTAGTACTTA
ATCTGCAGAGAGGCCAGC?-9584); and for pFK5.1pA57 and pFK5.1pA65,
primer 1250 (CGGACTAGTTTCGGCCCTGCAGGCCACAACAGTACTTTT
TTTTTTTT). The resulting 3?NTR PCR products were BmtI (nt 9536 in the
HCV genome) ? SpeI (underlined in the oligonucleotides) cloned into a shuttle
vector consisting of pBluescript(?) (Stratagene) containing XhoI (nt 7185)-SpeI
fragment of pFK5.1. The BmtI-SpeI fragments generated by PCR were se-
quenced upon cloning. Next, the XhoI-SpeI fragment of the pBluescript(?)
shuttle vector, containing the new 3?NTR, was cloned into pFK5.1 digested with
XhoI-SpeI.
T7 PCR runoff transcription. In order to create a transcription runoff sites for
the generation of selectable replicon RNAs with various 3? ends, we used a T7
PCR runoff strategy using the pFK5.1 plasmid as a template for PCR amplifi-
cation. After heating at 94°C for 2 min, 5 ng of pFK5.1 was amplified by 30 cycles
(30 s at 94°C, 30 s at 58°C, and 8 min at 68°C) of PCR by using Expand Long
Template PCR System 3 (Roche Applied Science). Reaction mixtures (50 ?l)
contained 300 nM T7for primer (GCTAAGCTTCGTAATACGACTC) and 3?
FIG. 1. (A) Secondary structure of the 3?NTR and quasispecies therein derived from the serum of an HCV1b-infected patient. A total of 40
cDNA clones were sequenced: 29 cDNA clones corresponded to the WT sequence, and 11 individual cDNA clones contained single nucleotide
changes indicated by arrows, followed by the nucleotide substitution (red). On the right side of the panel, four independent clones lacked five
extreme 3?-end nucleotides, and two clones lacked 23 extreme 3?-end nucleotides. Note that the numbering starts at the last 3? nucleotide,
annotated with “?1,” and counts back. (B) The location of reported potential initiation sites is indicated by an arrow in SL1 (17, 28; the present
study). (C) Effect of 3?-end deletions on cell colony formation using selectable replicons. WT is the pFK5.1 (Con1) construct amplified using T7
primer and reverse primer corresponding to the 3? end (see the text for further details). Numbers below the plates refer to the CFU per microgram
of in vitro-transcribed replicon RNA.
VOL. 80, 2006REPAIR AND POLYADENYLATION OF HCV GENOME ENDS4337

Page 3

runoff reverse primer corresponding to the last nucleotide, wild type (9605-?AC
TTGATCTGCAGAGAGGCCAGTATCAGCACTC?-9573), ?23 (9582-?ATCA
GCACTCTCTGCAGTCAAGCGG?-9558), ?20 (9585-?AGTATCAGCACTCT
CTGCAGTCAAG?-9561), ?12 (9593-?GAGAGGCCAGTATCAGCACTCTC
TG?-9569), ?11 (9594-?AGAGAGGCCAGTATCAGCACTCTC?-9571), and ?5
(9600-?ATCTGCAGAGAGGCCAGTATCAGCAC?-9575).
Reactions typically yielded between 4 and 8 ?g of an 8-kb PCR product. After
PCR amplification, 10 U of DpnI restriction enzyme was added to the PCR,
followed by incubation for 1 h to digest the methylated parental pFK5.1 plasmid.
After digestion DpnI was heat inactivated for 20 min at 80°C, and the reaction
mixture was loaded onto a 0.7% agarose gel (0.5? TAE) and run for 1 h at 10
V/cm. The 8-kb PCR product was subsequently extracted by using the QIAEX II
agarose gel extraction protocol (QIAGEN). Eluted DNA was subsequently used
in a T7 in vitro transcription reaction.
In vitro transcription, electroporation, and selection of selectable replicon
cells. In vitro transcription, electroporation, and selection of G418-resistant cell
lines was done as described by Lohman et al. (24). The only adjustments were the
restriction sites used for runoff transcription (see Results).
RESULTS
Determination of 3?NTR quasispecies variants from an HCV
genotype 1b clinical isolate. We have determined the 3?-ter-
minal sequence of an HCV1b genotype derived from the se-
rum of a patient with chronic hepatitis (37) by ligation of a
synthetic oligonucleotide to the 3? end, followed by reverse
transcription-PCR (RT-PCR), cDNA cloning, and subsequent
sequencing analysis as described in Materials and Methods.
This procedure was performed in duplicate on separate serum
RNA extractions, and 20 cDNA clones were analyzed from
each sample. When the consensus sequence of the 40 clones
was compared to the 3?NTR of other HCV type 1 genomes
characterized, no differences were found outside the poly(U/
UC) stretch. In 11 individual cDNA clones, single nucleotide
changes were observed differing from the consensus (Fig. 1A).
Most of these mutations (8 of 11) were within the predicted
single-stranded regions of the 3?NTR. Of the remaining three
mutations, one variant, A-53, abolished a predicted base pair,
while the other two still retained base pairing to the adjacent
residue (C-1 and A-46, Fig. 1A). RNA synthesis of HCV has
been shown to initiate de novo from the terminal U nucleotide
(?1) of SL1, but also a C residue at the ultimate position could
direct correct RNA synthesis (4, 18).
Replication of truncated 3? ends in selectable HCV repli-
cons. In addition to single nucleotide changes, four cDNA
clones were obtained that were 5 nt shorter at the extreme 3?
end and two clones that lacked 23 nt at the 3? end (Fig. 1A). It
has been reported that in vitro minus-strand RNA synthesis
can initiate internally either within the single-stranded loop of
SL1 at position ?21 (28) or within the stem of SL1 at position
?12 or ?13 (18). These internal initiation products, and the
shorter 3? termini that we observe, all have in common that
they end with a pyrimidine base (Fig. 1B). This is consistent
with observations that HCV RdRp preferentially initiates op-
posite uridine and cytidine residues and can use either ATP or
GTP for de novo initiation of RNA synthesis (23, 25). Because
the ?12, ?13, and ?21 internal initiation products resulted
from in vitro replication assays and the ?23 and ?5 variants
we found in serum could be aberrant replication products, we
tested these shorter variants in selectable HCV replicons,
which enable the study of HCV RNA replication in cell culture
(24). Since it was impossible to introduce correct restriction
sites to create unique transcription runoff sites for the gener-
ation of selectable replicon RNAs, we used a T7 PCR runoff
strategy using the HCV1b con1 replicon construct (pFK-
I389neo5.1) (21). In short, a PCR amplification product was
generated by using this replicon plasmid as a template, starting
with a forward oligonucleotide primer complementary to the
T7 transcription promoter and ending with an oligonucleotide
reverse primer opposite to the last nucleotide of the truncated
3?NTR. After PCR amplification, the template DNA was re-
moved with DpnI endonuclease, which specifically digests
methylated DNA. The unmethylated ?8-kb PCR product was
subsequently purified by agarose gel electrophoresis and gel
extraction. This purified PCR product was then used for T7 in
vitro transcription reactions, producing selectable replicon
RNAs with 3? ends corresponding to the runoff site determined
by the reverse primer. Human hepatoma Huh-7 cells were then
electroporated with the different in vitro-synthesized RNAs
and incubated for 3 weeks in the presence of 0.5 mg of
G418/ml in the growth medium. Subgenomic RNAs missing
23, 20, 12, or 11 nucleotides at the 3? end were unable to
generate Geneticin-resistant colonies (Fig. 1C). However, col-
onies were observed for the 5-nt truncated RNAs, suggesting
that this shorter variant could replicate (Fig. 1C). Despite the
use of a high-fidelity polymerase during PCR amplification,
extra unwanted mutations might have been introduced by the
polymerase during production of the PCR template that con-
sequently suppressed the actual efficiency of replication.
Therefore, the same truncation was created by introducing a
unique EcoRV restriction site at this position (GATATC) to
linearize the plasmid, circumventing the need for PCR ampli-
fication for this particular mutant. In vitro transcribed sub-
genomic RNA from the resulting plasmid (pFK5.1?5) was
generated, and introduced into Huh-7 cells (Fig. 1C). Similar
numbers of selectable colonies were obtained compared to the
T7 PCR-runoff generated transcript (?5 PCR, Fig. 1C), show-
ing that possible errors introduced during PCR amplification
had little effect on colony formation.
Repair of truncated 3? ends in selectable HCV replicons.
The surprising ability of the ?5 replicon to form a small num-
ber of selectable colonies suggests that RNA replicated at low
efficiency or that mutations have arisen to compensate for the
defect. To address the latter possibility, we expanded two in-
dependent pFK5.1?5 replicon colonies and isolated total
RNA, and the 3? ends of replicon RNA were cloned and
sequenced (Fig. 2). Interestingly, most replicons recovered
from these pFK5.1?5 colonies (27 of 40, Fig. 2) had regained
the missing 5 nt and thus restored base pairing in SL1 (Fig. 2).
Restoration of these 5 nt indicates the existence of a repair
pathway for truncated genomes in HCV selectable replicons.
Compared to the wild type (WT) (pFK5.1) sequence, a U base
instead of a C residue was found at position ?5 in the two
replicon colonies analyzed. Other cDNA clones retrieved
showed truncated 3? ends (sequences 1 to 8) or contained extra
sequences (sequences 9 to 13, Fig. 2). Most shorter genomes
(varying from 2 to 32 bases shorter) contained several U res-
idues at their 3? recessed ends. Of the genomes with an ex-
tended 3? end, three contained an extremely long poly(A) tail
(57, 65, and 120 A’s, respectively) linked to the correct 3? end
with a short linker sequence (underlined in Fig. 2). How these
U and A residues are added to the 3? end is unclear, but these
sequences must be added either by the viral polymerase (non-
4338
VAN LEEUWEN ET AL.J. VIROL.

Page 4

templated terminal transferase activity) or by the cellular cy-
toplasmic polyadenylation machinery (see Discussion).
Effects of a 3? terminal poly(A) tail on replicon cell colony
formation. The fact that HCV replicon RNAs with truncated
and extended 3? ends exist in selectable replicons colonies (Fig.
2) suggests that they are either replication competent or com-
plemented in trans by the restored WT replicons present in the
same cell. To determine whether the HCV replicons benefit
from the poly(A) tails gained in the repair process and to
confirm that the replicons with a poly(A) tail are actively rep-
licated, we tested two of these longer genomes in the selectable
replicon system (pFK5.1_pA57 and pFK5.1_pA65; Fig. 3).
Since a reverse oligo(dT) primer would not have the opportu-
nity to bind to the extreme end of a long A stretch, the use of
the T7 PCR runoff strategy to create in vitro transcripts with a
long poly(A) tail was not possible. Therefore, we introduced
one mutation or added two nucleotides for the pFK5.1_pA57
and pFK5.1_pA65 constructs, respectively, in order to create a
ScaI restriction runoff site (AGTACT) (Table 1). Upon trans-
fection of Huh-7 cells, both poly(A)-containing replicons
formed selectable colonies, albeit with somewhat lower effi-
ciency compared to the parental replicon (pFK5.1C-5U, Fig.
3). To determine further whether these replicon RNAs still
contained their A-tail, two independent colonies were again
expanded from each replicon. When the 3? ends from these
poly(A) replicon colonies were analyzed by RT-PCR and gel
electrophoresis, two different-length PCR products could be
observed for three of the four colonies: one corresponding to
the length of the parental 3? end and one approximately 50 bp
larger (Fig. 4). One replicon colony showed only a single band
corresponding to the parental 3? end, suggesting that the poly(A)
tail was lost (Fig. 4, pFK5.1_pA65 colony 1). As expected, both
the pFK5.1 and the pFK5.1C-5U replicons only showed one band
corresponding to the WT 3? end. When cDNA clones of these
colonies were sequenced, a surprising high sequence vari-
ability was observed (Table 1). The poly(A) stretch was
shown to vary in length from 26 to 69 A residues and was
thus, in some cases, longer than the original poly(A) tail. In
a few clones, the poly(A) structure is interrupted by a single
G residue (clones 57.19 and 57.24). Furthermore, the linker
sequence connecting the 3?NTR and poly(A) tail appeared
to be hypervariable in sequence and length. Only in a small
number of clones the original linker sequence was retrieved
(clones 57.2 to 57.5). Most newly formed linker domains
appear GU-rich and varied in length by 5 to 16 nt. Consis-
tent with the results of the RT-PCR analysis (Fig. 4), no
poly(A) tail was observed for pFK5.1_pA65 colony 1 (Table 1),
whereas for the other colonies only a small amount of the
cDNA clones had lost their A-tails. Of these, several contained
one to three extra U’s at their 3? ends (e.g., clones 57.32 and
57.33). These extra U’s were also observed when cDNA clones
derived from the WT 3?-end replicon colony were sequenced
FIG. 2. Terminal repair of a 5-nt 3?-truncated HCVcon1 replicon. The secondary structure of 3?-SL1 cDNA clones derived from two separate
replicon colonies selected from the pFK5.1?5 plate (Fig. 1C) is shown. A total of 40 clones were sequenced (20 per colony). Arrows followed by
the nucleotide substitution depict mutations found. Shown in red are nucleotides different from the consensus 3?-SL1 (pFK5.1). Underlined
sequences indicate the linkers connecting the 3? end and the poly(A) tail. Clone numbers are indicated under each sequence, and the annotations
in superscript (1 or 2) indicate the colony number where it was found.
VOL. 80, 2006REPAIR AND POLYADENYLATION OF HCV GENOME ENDS 4339

Page 5

(pFK5.1C-5U, Table 1), and it is, therefore, unlikely that these
added U’s are remnants of the linker.
DISCUSSION
Repair of viral 3?-truncated products generated during RNA
replication could be crucial for the production of infectious
progeny. The 3? truncations of the viral RNA may arise due to
viral imperfection either by internal initiation or premature
termination of replication of the viral RdRp (18, 28). Also, in
a hostile cellular environment exoribonucleolytic trimming of
the 3? termini could occur by the action of RNases. Several
viruses have developed a strategy in which truncated products
can be repaired in order to maintain functional full-length viral
genomes (see references 3, 27, and 29). In the present study we
describe an HCV genome variant that has a truncation of 5 nt
at the 3? end and demonstrate repair of this deletion in select-
able HCV replicons. This novel finding strongly suggests that
HCV possesses a 3?-end repair mechanism.
Based on in vitro RNA transcription studies, a model for
3?-end repair of the HCV terminus was suggested by Oh et al.
(28). Because the 3? stem-loop 1 has internal complementary
sequences (see Fig. 1A), it was proposed that missing nucleo-
tides might be added to the 3? end of this self-priming hairpin.
The recovered SL1 3? ends we observe, however, all contain
two G-U base pairs (UAAGU, see Fig. 2) in the restored RNA
hairpin, whereas copy back of the recessed stem-loop by the
RNA polymerase would produce complementary G-C base
pairs (CAAGC), making the model of Oh et al. unlikely for the
observed repair in our system.
Another possibility for 3?-end repair could be effectuated
by abortive synthesis of internally initiated RNA molecules,
which subsequently realign to the recessed 3? ends to prime
minus-strand synthesis. Such a repair mechanism was sug-
gested for turnip crinkle carmovirus, a positive-strand RNA
virus (27). Whether this mechanism is used in repair of HCV
3? ends is unknown. One genome terminus we found in the
poly(A)65 HCV replicon colony 1 contained an overlapping
repeat of the last 9 nt of 3? end (Table 1, clone 65.1, UUA
AGUUUA), a finding suggestive of an abortive product
reinitiating at the 3? end.
A third route for repair of 3?-terminal deletions may be the
ability of the RdRp to add nontemplated nucleotides to the 3?
end of its genome. In this model the terminal transferase
activity, which is either an intrinsic property of NS5b or a
cellular enzyme binding to NS5b (1, 23, 30, 30, 30, 32, 38),
would elongate defective 3? ends, which should then allow
sufficient replication for further evolution in the direction of
fitter genomes, containing the original 3? end (30, 38). The
identity of the nontemplated nucleotides added at the 3? end
by the polymerase may be determined by the genome 3?-ter-
minal structure and/or sequence (30, 38). For the shorter ge-
nomes remaining after repair, mostly U-stretches were added
to the genome termini (Fig. 2, clones 1 to 7), while the longer
genomes present contained extra A’s (clones 8 to 13). Not only
recessed termini contained extra U’s; WT 3? ends also occa-
sionally obtained one or two additional U residues (see Table
1 and reference 40). Interestingly, in vitro replication experi-
ments by Oh et al. showed that the addition of single-stranded
U’s to the 3? end of the X-template generated RNA products
that initiated RNA synthesis from the 3? end most single-
stranded nucleotide (28). Furthermore, binding assays showed
FIG. 3. Colony formation of selectable replicons carrying a poly(A) tail. The top images show the secondary structures of 3? SL1 structures
including the poly(A) tail; the bottom images show colonies formed using replicons containing poly(A) tails (pFK5.1_pA57 and pFK5.1_pA65) and
the WT 3? end (pFK5.1C-5U). The numbers below the plates refer to the CFU per microgram of in vitro-transcribed replicon RNA.
4340
VAN LEEUWEN ET AL. J. VIROL.