Whole blood cytokine profiles in cats infected by feline coronavirus and healthy non-FCoV infected specific pathogen-free cats

Department of Veterinary Pathology, Hygiene and Public Health, University of Milan, Milano, Lombardy, Italy
Journal of Feline Medicine & Surgery (Impact Factor: 1.16). 01/2007; 8(6):389-99. DOI: 10.1016/j.jfms.2006.05.002
Source: PubMed


In this study, the cytokine profiles of clinically healthy cats naturally infected with feline coronavirus (FCoV), of cats with feline infectious peritonitis (FIP) and of specific pathogen-free (SPF) cats were investigated in whole blood using a traditional reverse-transcriptase polymerase chain reaction (RT-PCR) assay and a semi-quantitative method of analysis based on computerised quantification of positive bands. The low inter-assay coefficient of variation recorded demonstrated that this method is highly repeatable. Compared with SPF cats, cytokine production was upregulated in most of the samples from FCoV-positive non-symptomatic cats. The appearance of a case of FIP in the cattery was associated with an increased expression of cytokines, in particular there was an increased production of IL-1beta and IFN-gamma, suggesting that these cytokines might protect infected cats from the disease. This hypothesis was also supported by the low levels of IFN-gamma recorded in blood from cats with FIP.

3 Reads
  • Source
    • "The protective immunity to FIP is thought to result mainly from cell-mediated immunity (CMI), and changes in the expression of several cytokines have been observed in cats with either experimentally induced or naturally occurring FIP [2]. The expression of one of the cytokines studied, interferon-γ (IFN-γ), was consistently decreased in diseased animals, and this gene is thought to play a protective role in the pathogenesis of FIP, since it is a key cytokine in CMI [6,8,12-14]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Feline infectious peritonitis (FIP) is an immune-mediated, highly lethal disease caused by feline coronavirus (FCoV) infection. Currently, no protective vaccine or effective treatment for the disease is available. Studies have found that some cats survive the challenge of virulent FCoV isolates. Since cellular immunity is thought to be critical in preventing FIP and because diseased cats often show a significant decrease in interferon-gamma (IFN-gamma) production, we investigated whether single nucleotide polymorphisms (SNP) in the feline IFN-gamma gene (fIFNG) are associated with the outcome of infection. A total of 82 asymptomatic and 63 FIP cats were analyzed, and 16 SNP were identified in intron 1 of fIFNG. Among these SNP, the fFING + 428 T allele was shown to be a FIP-resistant allele (p = 0.03), and the heterozygous genotypes 01C/T and +408C/T were found to be FIP-susceptible factors (p = 0.004). Furthermore, an fIFNG + 428 resistant allele also showed a clear correlation with the plasma level of IFN-gamma in FIP cats. For the identification of these three FIP-related SNP, genotyping methods were established using amplification refractory mutation system PCR (ARMS-PCR) and restriction fragment length polymorphisms (RFLP), and the different genotypes could easily be identified without sequencing. The identification of additional FIP-related SNP will allow the selection of resistant cats and decrease the morbidity of the cat population to FIP.
    Veterinary Research 05/2014; 45(1):57. DOI:10.1186/1297-9716-45-57 · 2.82 Impact Factor
  • Source
    • "TNF-alpha mRNA response tends to favor Th2 immunity (humoral), while the IFN-gamma mRNA response favors Th1 immunity [62]. In FCoV-endemic cattery without a case of FIP the percentage of clinically healthy FCoV-positive cats expressing IFN-gamma is significantly high, suggesting that this cytokine, together with IL-1β, might protect infected cats from the disease [63]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Feline coronavirus (FCoV) is an enveloped single-stranded RNA virus, of the family Coronaviridae and the order Nidovirales. FCoV is an important pathogen of wild and domestic cats and can cause a mild or apparently symptomless enteric infection, especially in kittens. FCoV is also associated with a lethal, systemic disease known as feline infectious peritonitis (FIP). Although the precise cause of FIP pathogenesis remains unclear, some hypotheses have been suggested. In this review we present results from different FCoV studies and attempt to elucidate existing theories on the pathogenesis of FCoV infection.
    Advances in Virology 08/2011; 2011:109849. DOI:10.1155/2011/109849
  • Source
    • "Reverse GAAGGAGACAATTTGGCTTTGAA) designed in a previous study (Gelain et al., 2006). The optimized PCR protocol was the following: denaturation at 94 8C (45 s), annealing for 50 s at 59 8C for 38 cycles and extension at 72 8C (80 s) with a final extension step at 72 8C of 10 min. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Interferon gamma (IFN-γ) plays an important role in cell mediated responses against mutated feline coronavirus strains (FCoV) involved in the pathogenesis of feline infectious peritonitis (FIP). The aim of this study was to establish a combined in silico and in vitro approach to assess feline leukocyte production of IFN-γ in response to selected peptides of the nucleocapside protein (N) of FCoVs. To this aim, we designed, through a bioinformatic approach, 8 potentially immunogenic peptides from the protein N corresponding to sequences of residues 14, 182, 198 detected only in FCoVs from FIP cats (virulent strains), only in FCoVs from healthy cats (avirulent strains) and both in FIP and in healthy cats (mixed strains). The peptides or a sham solution were incubated with whole blood from 16 cats (7 healthy and 9 with chronic diseases other than FIP) and IFN-γ concentration was measured on plasma using an ELISA system. RT-PCR expression of IFN-γ mRNA was also evaluated after incubation of the peptides or a sham solution with whole blood from 4 clinically healthy cats. The mean plasma concentration of IFN-γ in samples incubated with peptides decreased and the expression of IFN-γmRNA did not change compared with the sham solution, except for some cats with chronic diseases (which probably have a "pre-activated" immune response). These cats responded to "avirulent" or "mixed" peptides by increasing the concentration of IFN-γ and the expression of IFN-γ mRNA. The combined approach employed in this study allowed us to identify potentially immunogenic peptides of FCoV N protein that can modulate the production of IFN-γ especially in cats with a "pre-activated" cell mediated response.
    Veterinary Microbiology 02/2011; 150(3-4):248-56. DOI:10.1016/j.vetmic.2011.02.004 · 2.51 Impact Factor
Show more