Article

Whole blood cytokine profiles in cats infected by feline coronavirus and healthy non-FCoV infected specific pathogen-free cats

Department of Veterinary Pathology, Hygiene and Public Health, University of Milan, Milano, Lombardy, Italy
Journal of Feline Medicine & Surgery (Impact Factor: 1.22). 01/2007; 8(6):389-99. DOI: 10.1016/j.jfms.2006.05.002
Source: PubMed

ABSTRACT In this study, the cytokine profiles of clinically healthy cats naturally infected with feline coronavirus (FCoV), of cats with feline infectious peritonitis (FIP) and of specific pathogen-free (SPF) cats were investigated in whole blood using a traditional reverse-transcriptase polymerase chain reaction (RT-PCR) assay and a semi-quantitative method of analysis based on computerised quantification of positive bands. The low inter-assay coefficient of variation recorded demonstrated that this method is highly repeatable. Compared with SPF cats, cytokine production was upregulated in most of the samples from FCoV-positive non-symptomatic cats. The appearance of a case of FIP in the cattery was associated with an increased expression of cytokines, in particular there was an increased production of IL-1beta and IFN-gamma, suggesting that these cytokines might protect infected cats from the disease. This hypothesis was also supported by the low levels of IFN-gamma recorded in blood from cats with FIP.

0 Followers
 · 
43 Views
  • Source
    • "Reverse GAAGGAGACAATTTGGCTTTGAA) designed in a previous study (Gelain et al., 2006). The optimized PCR protocol was the following: denaturation at 94 8C (45 s), annealing for 50 s at 59 8C for 38 cycles and extension at 72 8C (80 s) with a final extension step at 72 8C of 10 min. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Interferon gamma (IFN-γ) plays an important role in cell mediated responses against mutated feline coronavirus strains (FCoV) involved in the pathogenesis of feline infectious peritonitis (FIP). The aim of this study was to establish a combined in silico and in vitro approach to assess feline leukocyte production of IFN-γ in response to selected peptides of the nucleocapside protein (N) of FCoVs. To this aim, we designed, through a bioinformatic approach, 8 potentially immunogenic peptides from the protein N corresponding to sequences of residues 14, 182, 198 detected only in FCoVs from FIP cats (virulent strains), only in FCoVs from healthy cats (avirulent strains) and both in FIP and in healthy cats (mixed strains). The peptides or a sham solution were incubated with whole blood from 16 cats (7 healthy and 9 with chronic diseases other than FIP) and IFN-γ concentration was measured on plasma using an ELISA system. RT-PCR expression of IFN-γ mRNA was also evaluated after incubation of the peptides or a sham solution with whole blood from 4 clinically healthy cats. The mean plasma concentration of IFN-γ in samples incubated with peptides decreased and the expression of IFN-γmRNA did not change compared with the sham solution, except for some cats with chronic diseases (which probably have a "pre-activated" immune response). These cats responded to "avirulent" or "mixed" peptides by increasing the concentration of IFN-γ and the expression of IFN-γ mRNA. The combined approach employed in this study allowed us to identify potentially immunogenic peptides of FCoV N protein that can modulate the production of IFN-γ especially in cats with a "pre-activated" cell mediated response.
    Veterinary Microbiology 02/2011; 150(3-4):248-56. DOI:10.1016/j.vetmic.2011.02.004 · 2.73 Impact Factor
  • Source
    [Show abstract] [Hide abstract]
    ABSTRACT: Feline infectious peritonitis (FIP) is a feline viral disease with high mortality. There is no cure or any effective vaccine available today. Many questions are yet to be answered about this disease and the immune response in affected cats. The aim of the study is to evaluate two different techniques for the study of cytokine profiles in cats vaccinated with a vaccine concept against FIPV. More information about the immune response in these cats could give valuable information to better understand the pathogenesis of the disease and the development of an effective vaccine. With quantitative real-time PCR and antigen ELISA has the levels of the cytokines IFN-γ and IL-10 been studied in blood from SPF cats immunised with an ISCOM vaccine against FIPV and then challenged. The levels of IFN-γ and IL-10 were too low in the serum samples to be able to analyze with the ELISA used. With real-time PCR, which is a very sensitive method, all the cats in the trial expressed IFN-γ and IL-10 at one or more samplings. No apparent difference was seen between the vaccinated and control cats. Commercial ELISA can have a too high lowest detection level than what’s useful when analyzing cytokines in samples from cats that have not developed FIP. For further analyzes of cytokines in very low concentrations a more sensitive method is needed, where proximity ligation assay is one possible alternative.
  • [Show abstract] [Hide abstract]
    ABSTRACT: This paper proposes a method of processing using compensation for MTI data of randomly pulsed phase signals. Theoretical analysis and two compensation functions are given and discussed. We also present the basic method of the algorithm. An experiment using simulation is given. It is shown that the theory is correct