Working memory deficits in transgenic rats overexpressing human adenosine A2A receptors in the brain.

Abstract

Adenosine receptors in the central nervous system have been implicated in the modulation of different behavioural patterns and cognitive functions although the specific role of A(2A) receptor (A(2A)R) subtype in learning and memory is still unclear. In the present work we establish a novel transgenic rat strain, TGR(NSEhA2A), overexpressing adenosine A(2A)Rs mainly in the cerebral cortex, the hippocampal formation, and the cerebellum. Thereafter, we explore the relevance of this A(2A)Rs overexpression for learning and memory function. Animals were behaviourally assessed in several learning and memory tasks (6-arms radial tunnel maze, T-maze, object recognition, and several Morris water maze paradigms) and other tests for spontaneous motor activity (open field, hexagonal tunnel maze) and anxiety (plus maze) as modification of these behaviours may interfere with the assessment of cognitive function. Neither motor performance and emotional/anxious-like behaviours were altered by overexpression of A(2A)Rs. TGR(NSEhA2A) showed normal hippocampal-dependent learning of spatial reference memory. However, they presented working memory deficits as detected by performance of constant errors in the blind arms of the 6 arm radial tunnel maze, reduced recognition of a novel object and a lack of learning improvement over four trials on the same day which was not observed over consecutive days in a repeated acquisition paradigm in the Morris water maze. Given the interdependence between adenosinic and dopaminergic function, the present results render the novel TGR(NSEhA2A) as a putative animal model for the working memory deficits and cognitive disruptions related to overstimulation of cortical A(2A)Rs or to dopaminergic prefrontal dysfunction as seen in schizophrenic or Parkinson's disease patients.

Full text

Page 1

This article was originally published in a journal published by
Elsevier, and the attached copy is provided by Elsevier for the
author’s benefit and for the benefit of the author’s institution, for
non-commercial research and educational use including without
limitation use in instruction at your institution, sending it to specific
colleagues that you know, and providing a copy to your institution’s
administrator.
All other uses, reproduction and distribution, including without
limitation commercial reprints, selling or licensing copies or access,
or posting on open internet sites, your personal or institution’s
website or repository, are prohibited. For exceptions, permission
may be sought for such use through Elsevier’s permissions site at:
http://www.elsevier.com/locate/permissionusematerial

Page 2

Author's personal copy
Neurobiology of Learning and Memory 87 (2007) 42–56
www.elsevier.com/locate/ynlme
1074-7427/$ - see front matter © 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.nlm.2006.05.004
Working memory deWcits in transgenic rats overexpressing
human adenosine A2A receptors in the brain
Lydia Giménez-Llorta, Serge N. SchiVmannb, Tanja Shmidtc, Laia Canelad, Lluïsa Camóne,
Monica Wassholmf, Meritxell Canalsf, Anton Terasmaaf, Albert Fernández-Teruela,
Adolf Tobeñaa, Elena Popovac, Sergi Ferrég, Luigi Agnatih, Francisco Ciruelad,
Emili Martíneze, Jörgen Scheel-Krugeri, Carmen Lluisd, Rafael Francod,
Kjell Fuxef,¤, Michael Baderc,¤
a Medical Psychology Unit, Department of Psychiatry and Forensic Medicine, School of Medicine, Institute of Neuroscience,
Autonomous University of Barcelona, Barcelona, Spain
b Laboratory of Neurophysiology CP601, Université Libre de Bruxelles, Brussels, Belgium
c Max-Delbrück-Center for Molecular Medicine (MDC), D-13125 Berlin-Buch, Germany
d Institute of Biomedical Investigations of Barcelona, CSIC, IDIBAPS, Barcelona, Catalonia, Spain
e Department of Biochemistry and Molecular Biology, University of Barcelona, Barcelona, Catalonia, Spain
f Department of Neuroscience, Karolinska Institute, Stockholm, Sweden
g Behavioural Neuroscience Branch, National Institutes of Health, National Institute on Drug Abuse, Baltimore, MD, USA
h Department of Biomedical Sciences, University of Modena, Modena, Italy
i Department of Behavioural Pharmacology, NeuroSearch A/S, Ballerup, Denmark
Received 29 March 2006; revised 23 May 2006; accepted 25 May 2006
Available online 7 July 2006
Abstract
Adenosine receptors in the central nervous system have been implicated in the modulation of diVerent behavioural patterns and cogni-
tive functions although the speciWc role of A2A receptor (A2AR) subtype in learning and memory is still unclear. In the present work we
establish a novel transgenic rat strain, TGR(NSEhA2A), overexpressing adenosine A2ARs mainly in the cerebral cortex, the hippocampal
formation, and the cerebellum. Thereafter, we explore the relevance of this A2ARs overexpression for learning and memory function. Ani-
mals were behaviourally assessed in several learning and memory tasks (6-arms radial tunnel maze, T-maze, object recognition, and sev-
eral Morris water maze paradigms) and other tests for spontaneous motor activity (open Weld, hexagonal tunnel maze) and anxiety (plus
maze) as modiWcation of these behaviours may interfere with the assessment of cognitive function. Neither motor performance and emo-
tional/anxious-like behaviours were altered by overexpression of A2ARs. TGR(NSEhA2A) showed normal hippocampal-dependent
learning of spatial reference memory. However, they presented working memory deWcits as detected by performance of constant errors in
the blind arms of the 6 arm radial tunnel maze, reduced recognition of a novel object and a lack of learning improvement over four trials
on the same day which was not observed over consecutive days in a repeated acquisition paradigm in the Morris water maze. Given the
interdependence between adenosinic and dopaminergic function, the present results render the novel TGR(NSEhA2A) as a putative ani-
mal model for the working memory deWcits and cognitive disruptions related to overstimulation of cortical A2ARs or to dopaminergic
prefrontal dysfunction as seen in schizophrenic or Parkinson’s disease patients.
© 2006 Elsevier Inc. All rights reserved.
Keywords: Adenosine receptors; Dopamine receptors; Transgenic rat; Memory; Prefrontal cortex; Heterodimerization
*Corresponding authors. Fax: +46 8 337941 (K. Fuxe), +49 30 9406 2110 (M. Bader).
E-mail addresses: Kjell.Fuxe@neuro.ki.se (K. Fuxe), mbader@mdc-berlin.de (M. Bader).

Page 3

Author's personal copy
human primates have also identiWed the prefrontal cortex
as a key node in the functional neural networks of work-
ing memory and its deWcits (Goldman-Rakic, 1994). In
rodents, experimentally induced models of prefrontal dys-
function including amphetamine sensitisation, subchronic
phencyclidine and neurodevelopmental insults exhibit
spatial and object working memory deWcits in delayed
response procedures or within-day learning in several
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
43
1. Introduction
Adenosine A2A receptors are thought to play a role in a
number of physiological responses and pathological condi-
tions (reviewed by Moreau & Huber, 1999; Popoli et al.,
2003). Their high expression in the striatum and antagonis-
tic interaction with dopamine receptors are consistent with
a key role for A2A receptors in motor activity control
(Ferré, Fuxe, von Euler, Johansson, & Fredholm, 1992,
1997; Fuxe, Ferré, Zoli, & Agnati, 1998). Previous work on
mice lacking A2A receptors (Chen et al., 1999; Ledent et al.,
1997) indicates an involvement of these receptors in neuro-
repair mechanisms, anxiety and aggressive behaviours. In
those mice, the lack of A2A receptors also resulted in
reduced startle habituation and prepulse inhibition (Wang,
Short, Ledent, Lawrence, & van den Buuse, 2003) which are
impairments in sensorimotor gating also seen in schizo-
phrenia (BraV et al., 1978) and after treatment of rats with
dopamine receptor agonists (Swerdlow et al., 1995). Phar-
macological studies have indicated that combined A1–A2A
receptor blockade exerts facilitative eVects on spatial mem-
ory performance in rats, and both receptor subtypes might
also be involved in hippocampal long-term potentiation
(Arai, Kessler, & Lynch, 1990; Kessey, Trommer, Over-
street, Ji, & Mogul, 1997; Rebola et al., 2003). Furthermore,
there is evidence for the involvement of A2A receptors in
striatal long-term potentiation (d’Alcantara, Ledent, Swil-
lens, & SchiVmann, 2001). However, the speciWc role of A2A
receptors in learning and memory is still unclear, with A1
receptors apparently having a more dominant role (Hauber
& Bareiss, 2001; Moreau & Huber, 1999; Suzuki et al.,
1993).
Short-term or ‘working’ memory is a cognitive process
relevant for keeping track of important information and
ideas that becomes critical for human reasoning and
judgement. Working memory depends on the integrity of
prefrontal function although hippocampus, inferior parie-
tal cortex, caudate nucleus and dorsomedial nucleus of
the thalamus are brain areas also known to play a rele-
vant role in its neural circuitry (reviewed by Castner,
Goldman-Rakic, & Williams, 2004). At the neuropsychi-
atric level, working memory is the core and most consis-
tently observed cognitive deWcit exhibited by patients with
schizophrenia (Park & Holzman, 1992). Prefrontal dys-
function linked to altered dopaminergic and glutamater-
gic transmission or to disruption of mesencephalocortical
pathways is also suggested to cause working memory deW-
cits in Parkinson’s disease patients (García-Munoz,
Young, & Groves, 1991). Studies in both human and sub-
kind of mazes (Morris water maze, T-maze, Y-maze,
Radial maze, etc), and social and object recognition tests.
where working memory can be distinguished from long-
term or ‘reference’ memory associated with day-to-day
learning (reviewed by Castner et al., 2004).
It is of substantial interest that stimulation of A2A recep-
tors, like dopamine D1 receptors, increases cAMP signal-
ling and neuronal excitability, especially in view of the fact
that not only reductions but also increases in D1 receptor-
mediated dopaminergic transmission lead to working mem-
ory deWcits (Goldman-Rakic, Muly, & Williams, 2000).
Therefore, in order to study the consequences of increased
central A2A receptor signalling, we established a novel
transgenic rat model TGR(NSEhA2A) overexpressing this
receptor. Preferential overexpression of A2A receptors was
located in some of these neuroanatomical substrates, where
also dysregulation of dopamine signalling is associated
with working memory impairments and schizophrenia.
Thereafter, we submitted the animals to a behavioural bat-
tery to ascertain motor activity, anxiety, and learning–
memory functions. The results revealed a marked neuronal
A2A overexpression especially in cortical regions that may
be critical for the working memory deWcits observed. In
view of the existence of A2A/D2 and A2A/mGlu5 heteromeric
complexes in the striatum (Canals et al., 2003; Ferré et al.,
2002; Fuxe et al., 2005; Hillion et al., 2002) also D2 and
mGlu5 proteins were analysed in immunoblotting experi-
ments on the striatum of the TGR(NSEhA2A) over-
expressing the A2A receptors to further understand the
neurobiological basis for the working memory deWcits
observed.
2. Methods and materials
2.1. Generation of transgenic animals
Transgenic rats for the overexpression of A2A receptors in the cen-
tral nervous system were generated by microinjection of a DNA con-
struct into the male pronucleus of Sprague–Dawley rat zygotes with
established methods (Popova, Krivokharchenko, Ganten, & Bader,
2002). The construct contained a full-length human A2A cDNA cloned
into an expression vector 3? of the 1.8 kb rat neuron-speciWc enolase
(NSE) promoter and 5? of an intron/polyadenylation cassette of SV40
virus (see Fig. 1A).
2.2. Genotyping of rats
Transgenic rats were identiWed by PCR (30 cycles, 54°C annealing
temperature) on their genomic DNA isolated from tail biopsies by the use
of the following transgene-speciWc primers: SV40ipa5: 5?-GAAGGAACC
TTACTTCTGTGG-3? and SV40ipa3: 5?-TCTTGTATAGCAGTGCAG
C-3? (see Fig. 1A).
2.3. RNase protection assay
Total RNA was isolated from rat tissues by TRIZOL reagent (Invitro-
gen) according to the manufacturer’s instructions. With this RNA, trans-
gene expression was measured by RNase protection assay (RPA) as
described previously (Silva et al., 2000) using a commercially available kit
(RPAII, Ambion) and a probe covering the 5?-terminal 125 nucleotides of
the transgenic mRNA (see Fig. 1A).

Page 4

Author's personal copy
brain sections (SchiVmann, Libert, Vassart, & Vanderhaeghen, 1991).
The rat A2A receptor oligonucleotide probe (CCGCTCCCCTGG
CAGGGGCTGGCTCTCCATCTGCTTCAGCTG) is complementary
to nucleotides 604–645 of the rat cDNA sequence (Fink et al., 1992).
Oligonucleotides were labelled with ?-35S dATP (DuPont-NEN, Bel-
gium) at their 3? end by terminal DNA deoxynucleotidylexotransferase
(Gibco, Belgium) and puriWed with a G50 column (Pharmacia, Belgium)
according to the manufacturer’s instructions. QuantiWcation was
performed using the public domain NIH image J 1.33 program
44
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
2.4. In situ hybridization
The in situ hybridization technique was adapted from previously
described methods (SchiVmann & Vanderhaeghen, 1993). The sections
mounted on RNAse free poly-L-lysine coated slides were Wxed in freshly
prepared 4% paraformaldehyde solution for 30 min and rinsed in 0.1M
PBS. All sections were dehydrated and dipped for 3 min in chloroform.
After air drying, the sections were incubated overnight at 42 °C with
0.35 £ 106cpm per section of 35S-labelled probes diluted in hybridiza-
tion buVer, which consisted of 50% formamide, 4£ SSC (1£ SSC:
0.15 M NaCl, and 0.015 M sodium citrate, pH 7.4), 1£ Denhardt’s solu-
tion (0.02% each of polyvinylpyrrolidone, bovine serum albumin,
Wcoll), 1% sarcosyl, 0.02 M sodium phosphate at pH 7.4, 10% dextran
sulfate, yeast tRNA at 500 ?g/ml, salmon sperm DNA at 100 ?g/ml, and
60 mM dithiothreitol. Compounds were provided by Sigma Chemicals
(Belgium). After hybridization, the sections were rinsed for 4 £ 15 min
in 1£ SSC at 55 °C, dehydrated and covered with HyperWlm-? max Wlm
(Amersham, Belgium) for two or three weeks. The oligonucleotide
probes were synthesized on an Applied Biosystems 381A DNA synthe-
sizer or Eurogentec (Belgium) with a GC to AT ratio between 45 and
65%. The human A2A receptor oligonucleotide probe (CAGCCCT
GGGAGTGGTTCTTGCCCTCCTTT-GGCTGACCGCA) is comple-
mentary to nucleotides 123–166 in a partial human cDNA sequence
(Libert et al., 1989) and has been previously successfully used on human
(National Institute of Health, USA) on digitalized images captured
from autoradiograms for areas displaying moderate to high expression
levels (striatum, frontal and prefrontal cerebral cortex, thalamus,
Ammon’s horn of the hippocampus, dentate gyrus, and cerebellum).
For each area, analysis was performed for 3 rats of each genotype (3
slices per area and animal) and optical density of the background was
subtracted.
2.5. Membrane preparation and radioligand binding
Tissue pieces were homogenized by sonication in 20 volumes of ice-
cold preparation buVer (PB, 20 mM Tris–HCl, 7 mM MgCl2, and 1 mM
EDTA, pH 7.4). Membranes were collected by centrifugation at 46,000g
for 20 min at 4 °C. The pellet was then resuspended in PB and centri-
fuged twice as before. The Wnal pellet was homogenized in incubation
buVer 1 (20 mM Tris–HCl, 100 mM NaCl, 7 mM MgCl2, 1 mM EDTA,
and 1 mM DTT, pH 7.4) containing an EDTA free protease inhibitor
cocktail (Roche Diagnostics GmbH, Mannheim, Germany) and the
obtained suspension was used directly for radioligand binding experi-
ments. The protein concentration of the samples was determined using
a BCA protein assay kit (Pierce Biotechnology, Rockford, IL) and
using BSA dilutions as a standard. Binding of the A2A antagonist radi-
oligand [3H]ZM241385 (17 Ci/mmol; Tocris) was performed in incuba-
tion buVer 2 (20 mM Tris, 100 mM NaCl, 5 mM MgCl2, and 1 mM
DTT, pH 7.5). Membranes were incubated with diVerent concentrations
of [3H]ZM241385 (0.02–10 nM) for 90 minutes at 30 °C in a total vol-
ume of 500 ?l. The reaction was terminated by rapid Wltration through
glass-Wber Wlters (GF/B, Whatman Int. Ltd., Maidstone, UK) and the
Wlters were washed three times with 5 ml of ice-cold buVer containing
20 mM Tris and 100 mM NaCl (pH 7.4). Non-speciWc binding was
deWned as the binding in presence of 10 ?M SCH58261,a potent and
selective A2A antagonist with 50-fold selectivity for A2A vs. A1 recep-
tors in the rat (Zocchi et al., 1996).
Fig. 1. Generation of the transgenic rats, TGR(NSEhA2A). (A) DNA construct used to generate transgenic rats. A full-length human A2A receptor
(hA2A) cDNA was cloned into an expression vector 3? of the 1.8kb rat NSE promoter and 5? of an intron/polyadenylation cassette of SV40 virus
(SV40intron/pA). The probe used for RPA is shown and the primers used for genotyping are marked by arrow heads. (B) Genotyping of transgenic rats.
PCR with the primers shown in (A) revealed the presence of the transgene in the genome of positive animals (+) but not in wild-type (WT) littermates (¡).
?: DNA marker ?X174/HaeIII. (C) RNase protection assay (RPA) detecting human A2A receptor (hA2A) mRNA only in brain and testis of transgenic
rats (TGR(NSEhA2A)) but not in other tissues or in wild-type Sprague–Dawley animals (WT). Y¡, yeast RNA without RNase treatment, Y+, yeast
RNA with RNase treatment.

Page 5

Author's personal copy
(Rosin et al., 1998; Upstate, Lake Placid; see above) using the avidin-bio-
tin-peroxidase technique. BrieXy, endogenous peroxidase activity was
blocked with 0.3% H2O2 and 30% methanol in PBS and unspeciWc protein
binding sites were blocked with 3% normal goat serum in 0.01M PBS con-
taining 0.2% gelatin and 0.2% Triton X-100. Sections were then incubated
with a mouse monoclonal antibody against the A2A receptor (Upstate, 05-
717), diluted 1:600 with 1% goat serum and 0.1% Triton X-100 for 24 h at
4°C in a humidiWed chamber. Biotinylated goat anti-mouse IgG (1:200;
Vector Labs, USA), as the secondary antibody, was applied for 1h at
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
45
2.6. Radioligand binding and autoradiography
Adenosine A2A receptor binding autoradiography was performed as
previously described (Ledent et al., 1997) using a single concentration of
the radioligand. The gelatine-coated slides, stored at ¡20°C until use, were
brought to room temperature 30 min before the experiments. The sections
were incubated for 90min at room temperature in a buVer containing
50 mM Tris–HCl, pH 7.4, 10mM MgCl2, 2.5UI/ml adenosine deaminase
(ADA; Roche, Belgium),and 10nM of the prototypical A2A agonist
[3H]CGS21680 (47.0Ci/mmol; Dupont NEN, Belgium) with 140-fold
selectivity for A2A vs. A1 receptors (Hutchison et al., 1989; Jarvis et al.,
1989). Non-speciWc binding of the 3H-labelled ligand was assessed by the
addition of 1?M CGS21680. Slides were washed four times for 5min in
ice-cold 50mM Tris–HCl, pH 7.4 buVer, dipped in ice-cold distilled water,
dried under a stream of cold air, and exposed to 3H-HyperWlm (Amer-
sham, Belgium) for 6 weeks.
2.7. Western blot and immunohistochemistry
2.7.1. Western blotting
Prefrontal cortex (rostral to Bregma 2.7mm), dorsal (mainly frontopa-
rietal) cortex or striatum from both hemispheres from three wild-type rats
and three transgenic rats were homogenized in 10 volumes of Tris–HCl
(50mM, pH 7.4) with a protease inhibitor cocktail (Sigma–Aldrich, CO,
St. Louis, MS) and centrifuged at 109,000g for 45min at 4 °C to remove
debris. The pellet was washed once more as described above and resus-
pended in the same buVer solution for protein determination by BCA
(Pierce Biotechnology, Rockford, IL). Proteins were solubilized in 2£ urea
buVer (urea 8M, SDS 2%, DTT 200mM) and incubated at 37°C for 2h.
Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS/PAGE)
was performed using 10% or 6.5% (only for detection of mGlu5) polyacryl-
amide gels. Proteins were immunoblotted to PVDF membranes (Immobi-
lon-P; Millipore) using a semidry transfer system and developed with the
enhanced SuperSignal chemiluminescence detection kit (Pierce Biotech-
nology). Receptors were detected with the following primary antibodies:
rabbit anti-adenosine A1 receptor (1:1000; ABR, Golden, CO), mouse
anti-A2A receptor (1:1000; UpState, Lake Placid, NY) rabbit anti-gluta-
mate mGlu5 receptor (0.5?g/mL; UpState), rat anti-dopamine D1 receptor
(1:500; Sigma–Aldrich, CO), rabbit anti-dopamine D2 receptor (1?g/mL;
Chemicon, Temecula, CA) and mouse anti-?-tubulin (1:6000; Sigma–
Aldrich, CO) and the following horseradish peroxidase secondary anti-
bodies: goat anti-rat IgG, goat anti-rabbit IgG (1:60000; Pierce Biotech-
nology) and rabbit anti-mouse IgG (1:2000; Dako A/S, Denmark). The
speciWcity of the monoclonal anti-A2AR antibody has been previously
described (Rosin, Robeva, Woodard, Guyenet, & Linden, 1998). Among
other species and as indicated by the supplier (Upstate catalogue number
05-717), the antibody recognizes human and rat A2AR. In the absence of
the primary D1 antibody and at 1:60000 dilution of the goat anti-rat IgG
secondary antibody we do not observe any band in the immunoblotting.
2.7.2. Immunohistochemistry
At the end of the behavioural experiments, wild-type or
TGR(NSEhA2A) were deeply anaesthetized with sodium pentobarbital
and perfused transcardially with heparinized 0.9% saline followed by 4%
paraformaldehyde (w/v) in 0.01M phosphate buVer saline (PBS), pH 7.4.
The brains were removed, postWxed in the same Wxative at 4°C and, after a
dehydration process, embedded in paraYn. Coronal sections (5?m)
through prefrontal cortex and striatum at several rostro-caudal levels were
cut and processed with monoclonal antibodies against A2A receptors
room temperature followed by avidin–biotin–horseradish peroxidase com-
plex (1:100; Vectastain Elite ABC kit, Vector Labs.). Peroxidase labelling
was visualized with a solution of 3,3?-diaminobenzidine containing 0.03%
H2O2. In each experiment, a tissue section was also processed in parallel
without the primary antibody as a control for non-speciWc staining.
2.8. Behavioural testing
Adult male TGR(NSEhA2A) (nD11) and WT rats (nD14, the Spra-
gue–Dawley strain used to generate the transgenic rats) were maintained
in groups of two or three (Macrolon, 57£ 35£ 19cm) under standard lab-
oratory conditions (food and water ad lib, 22§2°C, 60§ 10% relative
humidity, 12h light/dark cycles beginning at 7:00h). The animals were
subjected to a series of tests used to screen for behavioural abnormalities
in mutant rodents (Giménez-Llort et al., 2002) assessing spontaneous
motor activity, learning and memory and anxiety. Behaviour was evalu-
ated by both direct observation and a video-computerized tracking system
(SMART, Panlab S.A., Barcelona, Spain) by two independent observers
unaware of the animal’s genotype. Animals were weighed before each test.
A few animals of each group [two TGR(NSEhA2A) and one WT rat] were
not assessed in the tunnel maze tests because their body size was not suit-
able. The experiments were performed from 10:00 to 13:00h under dim
white light and in accordance with the Spanish legislation on “Protection
of Animals Used for Experimental and Other ScientiWc Purposes” and the
European Communities Council Directive (86/609/EEC) on this subject.
2.8.1. Hexagonal tunnel maze
The tunnel maze (extension 1.4m, tunnels 8cm wide and 9cm high) con-
sisted of two concentrical long angled alleys interconnected to a central area
(Bättig, 1983; Fitzgerald, Berres, & Schaeppi, 1988). Forty-two infrared pho-
tocell units were uniformly distributed throughout the tunnels and interfaced
to an IBM XT computer to measure the locomotor activity (total number of
photobeams interrupted). Animals were introduced into the maze by a ceiling
door at the centre and 5min later the trial was automatically terminated.
2.8.2. 6-arm radial tunnel maze test
Barriers in the hexagonal tunnel maze conWgured a 6-arm radial maze.
Each arm lead to a T-shaped choice-point with a blind alley on the right and
a long angled alley on the left. Entries into each of the 6 radial arms and to
the short, blind alley were measured during 5min by means of the infrared
photocell units described above. This procedure (Bättig, 1983; Fitzgerald
et al., 1988) was repeated during 3 consecutive days. From each session, the
following behavioural parameters were obtained from individual animals:
total number of photobeams interrupted (locomotor activity); the number of
diVerent arms explored; the number of short, blind alleys explored; the num-
ber of re-entries (repetitions) into arms before all six arms had been visited;
the number of re-entries (repetitions) into short, blind alleys already explored.
2.8.3. T-maze test
The apparatus was an enclosed T-maze (woodwork; walls: 30 cm
high; starting box: 20 £ 15 cm; stem: 20 £ 15 cm; arms: 30 £ 15 cm). The
rats were given three sessions, one per day with three trials each. Each
trial involved one forced choice and one free choice. with a 15 s intratrial
interval and a 75–90 s intertrial interval. In the forced choice, only one of
the arms according to a random order and contrabalanced in each
group, was accessible. The rat was placed in the starting box and 15 s
later it was allowed to explore the maze. After spending 30 s in the arm,
the rat was put back into the starting box. Fifteen seconds later, the rat
was again allowed to explore the maze in a free choice trial where both
arms were accessible. The arm chosen by the rats during the free choice
was recorded. The olfactory trails were removed by cleaning the surface
of the maze during the intratrial and intertrial intervals. This task
(Olton, Becker, & Handelmann, 1979; Squire, 1969) was based on the
spontaneous tendency of rats to explore places; no reinforcer was used.
2.8.4. Open-Weld test
Rats were placed in a corner of the open-Weld apparatus (wood-work
white box, 32£32£ 30cm) divided into 25 equal sectors. Exploratory

Page 6

Author's personal copy
maze facing one of the open arms. The number of entries (all four paws)
into, the time spent, and the distance covered in each arm were recorded
for 5min.
46
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
behaviour was measured as the number of crossings and rearings for a
5min recording period.
2.8.5. Object recognition test
The animals were assessed twice (1 week apart) for their ability to rec-
ognize a familiar object (S, sample) from a new one (N). Each of these ses-
sions consisted of a “sample trial” followed by a “test trial.” In the sample
trial, the animals were placed in the open-Weld (a known environment) and
let explore (nose directed to the object not less than 2cm) two identical
objects, S1 and S2 (rectangular aluminium cans, 15£ 12£ 5cm), equally
spaced in the Xoor of the apparatus until they reached the criteria of explo-
ration of both for 20s. The time required to reach the criteria was named
“time 1.” One minute later, animals were reintroduced in the apparatus for
5min (test trial) where two diVerent non-explored objects were located: an
identical copy of the sample objects (S3) and a completely new object (N,
cylindrical aluminium can, 15£10cm, diameter 10cm). Preference for the
new object was measured by means of the index TN¡TS/TN+TS (Ennac-
eur & Delacour, 1988; Willig et al., 1987) where TS and TN are the time
spent exploring “S3” and “N”, respectively.
2.8.6. Morris water maze tests
The tests (Morris, 1984) consisted of three sessions of place learning
for reference memory (days 1–3), one session of cue learning (day 4) and 3
sessions of “repeated acquisition paradigm” (Whishaw, 1985) for working
memory (days 5–7). The circular pool (diameter: 140cm, height: 60cm)
was Wlled to a depth of 29cm with 24°C water and rendered opaque with
milk. In all the tasks, four trials were administered per day. The rats were
gently lowered into the water with the head facing the wall from one ran-
domly selected cardinal starting point and allowed to swim until they
located the platform (16cm diameter, 28cm height). Several external cues
were visible from the pool. Rats failing to Wnd the platform within 60s
were placed on it for 20s, the same period as the successful animals. The
distance travelled by the animal during the tests was measured with the
video-computerized tracking system which also enabled the calculation of
the average swimming speed. Learning improvement over four trials of the
same day was measured by the index “trial n/trial n¡1” deWned as the
ratio of distance covered on trial “n” divided by the distance covered on
trial “n¡ 1” of a same day. In the similar way, the index ‘trial 1 /trial n’ for
performances between the Wrst and each of the following trials on the same
day was also considered.
In the Place learning task the platform was submerged 2cm in a Wxed
position (north-west quadrant and 18cm away from the wall) and the four
trials administered per day were spaced 15min apart. In the cue learning
the platform was placed in the east, 18cm away from the wall and was ele-
vated 1cm above the water level with its position indicated by a visible Xag
(10cm high, 5£ 8cm black and white striped panel) and two black panels
preventing subjects using most of the extra-maze cues. The ‘repeated acqui-
sition paradigm’ for working memory (Whishaw, 1985) consisted of 4 con-
secutive trials per day during 3 consecutive days. The animals were placed
at the same starting point in all the 4 consecutive trials of one session and
allowed to swim until they located the platform submerged in a Wxed posi-
tion which was randomly changed every day. Fixed room cues were con-
stantly visible of all these from the pool.
2.8.7. Elevated plus maze test
The plus-maze (woodwork) consisted of two enclosed arms (EA,
50£ 10£40cm) and two open arms (OA, 50£10 cm) forming a square
cross with an open 10£10 cm square centrepiece, the whole being set
50cm above the ground. The animal was placed in the centre of the plus-
2.9. Statistics
Results are expressed as means§ SEM. DiVerences between genotypes,
within days and genotype£ day interaction eVects in the 6-arms radial
tunnel maze, the T-maze and the Morris water maze were analysed by
two-way ANOVA. SpeciWc diVerences between the two genotypes were
analysed with Student’s t-test comparisons, and diVerences between two
sessions of the same test with paired t-test. In all cases, statistical signiW-
cance was considered at P<0.05. All radioligand binding data were ana-
lysed using GraphPad Prism 3.0 (GraphPad, San Diego, CA, USA).
Statistical analysis was performed using a nonparametric one way
ANOVA followed by Newman–Keuls multiple comparison tests.
3. Results
3.1. Generation of transgenic rats
The DNA construct containing the human A2A cDNA
under the control of the 1.8kb rat (NSE) promoter
(Fig. 1A) (Forss-Petter et al., 1990) was Wrst tested in a neu-
roglioma cell line for functionality and shown to express
A2A mRNA (data not shown). Then it was used to generate
transgenic rats by microinjection into the male pronucleus
of Sprague–Dawley rat zygotes (Popova et al., 2002).
Transgene speciWc PCR conWrmed the successful integra-
tion of the construct into the genomic DNA of the resulting
rat strain, TGR(NSEhA2A) (Fig. 1B).
3.2. Transgene expression in TGR(NSEhA2A)
RNase protection assay (RPA). Transgene expression
was analysed by RPA in TGR(NSEhA2A) rats (Fig. 1C).
Transgenic A2A receptor mRNA was only detected in brain
and testis of the transgenic rats but in no other organ tested
proving the speciWcity of the promoter.
In situ hybridization. Radiolabelled oligonucleotide
probes speciWc for the human and rat A2A receptor cDNA
were used for in situ hybridization on adjacent brain sec-
tions. As shown in the Fig. 2, human A2A receptor mRNA
was detected in the cerebral cortex, the hippocampal for-
mation (hippocampus and dentate gyrus), the cerebellum,
and certain thalamic nuclei and, at a lower level in the brain
stem. However, only a very low level of human A2A recep-
tor mRNA expression was detected in the striatum. As also
seen in Fig. 2, there is a certain cross hybridization of the
rat probe to the human A2A receptor mRNA conWrming a
clear-cut overproduction of A2A receptor mRNA in these
extrastriatal brain regions.
3.2.1. Western blot
Despite the fact that human mRNA was hardly detected
in striatum, the level of striatal A2A receptor immunoreac-
tivity detected by Western blot was signiWcantly increased
in TGR(NSEhA2A) (Fig. 3A). Immunoblots also indicated
that the level of A2A receptor expression in both frontopari-
etal and prefrontal cortex of transgenic animals was signiW-
cantly and substantially higher than that found in WT
animals, which showed a very low level of receptor expres-
sion in these regions (Fig. 3A). As seen in this Wgure there is
a marked increase in A2A receptor monomers and dimers in
the frontoparietal cortex and the prefrontal cortex of the
TGR(NSEhA2A) vs. WT rats. In the transgenic animals, it
seems that the formation of A2A receptor dimers is

Page 7

Author's personal copy
in the density of A2A receptor antagonist binding sites in
the prefrontal cortex was detected in TGR(NSEhA2A)
while very few A2A receptors were found in WT rats in this
area (Fig. 5B). No changes in the KD values of A2A receptor
antagonist binding sites were found in
TGR(NSEhA2A) vs. the WT rats (Fig. 5B, legend). In the
striatum only a small but signiWcant increase in the density
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
47
favoured since they were not found in the striatum of con-
trol rats. Alternatively the A2A antibody may not recognize
the rat A2A receptor dimers but this seems less likely.
3.2.2. Immunohistochemistry
The localization of A2A receptor in prefrontal cortex and
striatum of WT and TGR(NSEhA2A) was further studied
by means of immunohistochemistry. The localization of
A2A receptor observed in striatum and prefrontal areas of
WT animals is in agreement with that described by Rosin
et al. (1998). Prominent labeling was observed in the neuro-
pil of the caudate-putamen
TGR(NSEhA2A) but the intensity of labeling was similar
(Fig. 4). In contrast, TGR(NSEhA2A) showed strong label-
ling of many pyramidal and non-pyramidal nerve cell
bodies in some areas of prefrontal cortex, mainly cingulate
cortex, and medial and lateral orbital cortex and also in the
hippocampal formation, where the labelling in WT animals
was weak (Fig. 4). No staining was found after the omission
of the primary A2A receptor antibody.
in both WT and
3.3. A2A receptor binding in TGR(NSEhA2A)
Biochemical radioligand binding. Using an A2A receptor
antagonist radioligand ([3H]ZM241385) a clear-cut increase
the
of A2A receptors was found in the TGR(NSEhA2A) with
no change in the KD values of the A2A receptor antagonist
binding sites (Fig. 5A, legend).
3.3.1. Receptor autoradiography
Using the A2A receptor agonist radioligand [3H]CGS
21680 and a single point analysis, a higher speciWc binding
was observed in extrastriatal areas such as the cerebral cor-
tex, the cerebellum and
TGR(NSEhA2A) vs. WT rats (Fig. 2F–G).
the thalamus in the
3.4. Expression of adenosine A1, dopamine D1 and D2
glutamate mGlu5 receptors
Detection of adenosine A1, dopamine D1, and D2, and
glutamate mGlu5 receptors in samples from cortex (fronto-
parietal or prefrontal) and striatum was performed by
immunoblotting. The expression of these receptors did not
change in the cerebral cortex of TGR(NSEhA2A) when
compared to the levels found in WT animals (Fig. 3B). In
striatum however D2 and mGlu5 receptors were signiW-
cantly less abundant in TGR(NSEhA2A) (Fig. 3B). The
expression of A1 and D1 receptors did not signiWcantly
change in the striatum of transgenic animals with respect to
wild-type rats.
3.5. Behavioural testing of TGR(NSEA2A)
Table 1 summarizes the results of behavioural assess-
ment of TGR(NSEA2A) and the WT group. Both groups
of animals displayed similar spontaneous activity scores in
the two modalities of the tunnel mazes (total activity counts
Fig. 2. Localisation of human A2A receptor mRNA expression and [3H]CGS21680 binding. In situ hybridization autoradiograms using probes comple-
mentary to the human A2A receptor cDNA (A and B) or to the rat A2A receptor cDNA (D and E) and quantiWcation (C) show human A2A receptor
mRNA expression in several brain areas including the cerebral cortex, the hippocampus and the cerebellum of TGR(NSEhA2A) (B and E) as compared
to wild-type rats (A and D). [3H]CGS21680 binding autoradiograms in control (F) and transgenic (G and H) rats show a substantial increase in binding
density in these extrastriatal regions (total (F and G) and non-speciWc (H) binding).

Page 8

Author's personal copy
the number of visits to these alleys [Fig. 6A, day eVect:
F(2,40)D6.25,
F(2,40)D6.44, P<.01] and the re-entries into them
[Fig. 6B, day eVect: F(2,40)D4.76, P<.05; genotype£day
eVect: F(2,40)D5.58, P<.01] with TGR(NSEhA2A) mak-
ing more visits and errors on the Wrst and second days than
the other group (Student’s t-test, P<.05).
48
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
in the hexagonal maze and in the 6-arms radial maze) as
well as in the open-Weld test (crossings and rearings). Anxi-
ety-like behaviour measured in the plus maze was similar in
both groups of rats with also equal number of entries in
both arms.
Upon initial testing in the 6-arms radial tunnel maze, no
genotype diVerences were found in their ability to explore
all the 6 arms, in the latency to explore and in the number
of reentries. In both groups of rats repeated testing resulted
in a decrease of latency and reentries to explored arms over
the sessions of the test revealed by a “day” eVect
[F(2,40)D9.07, P<.001 and F(2,40)D5.19, P<.01, respec-
tively]. ‘Day’ and ‘genotype£day’ interaction eVects were
found in the performances in the short-blind arms, both in
P<.01; genotype£day eVect:
In the T-maze, the same number of correct choices was
made by animals of both genotypes and a ‘day’ eVect
[F(2,46)D5.90, P<.01] showed an improvement over the
sessions in both groups of rats.
When assessed in the object recognition test equal
exploratory behaviour was shown during the sample trial
as both groups of rats required the same time to reach crite-
ria (time 1). In the test trials, the ability to recognize the
new object as compared to the sample (index) was lower in
TGR(NSEhA2A) than in WT rats (Student’s t-test,
P<.05).
Analyses of swimming speed over the diVerent sessions
and paradigms in the Morris water maze indicated no
diVerences between genotypes. On the Wrst task for spatial
reference memory, the two groups of rats showed similar
acquisition patterns with distances (averaged for the four
trials of each session) decreasing at the same rates over the
three sessions of the task (Fig. 7A, ‘day’ eVect:
F(2,46)D2.46 P<.001). Additionally, both groups of rats
displayed a maximum eYciency to reach the platform in the
single cue learning task (Fig. 7A). On the following days
Fig. 3. Western blot for A2A, A1, D1, D2, and mGlu5 receptors. Expression pattern of (A) A2A and (B) D1, D2, A1, and mGlu5 receptors in striatal, cortex
and prefrontal cortex membranes of wild-type (WT) and TGR(NSEhA2A) (A2A) rats. Tissue membranes were analysed by Western blot as indicated in
Section 2. In A, 20?g of protein were applied in each lane and blots were treated with mouse anti-?-tubulin to conWrm equal loading of protein. In B, 15?g
(mGlu5), 20?g (A1 and D2), and 40?g (D1) of protein were applied in each lane and blots were also treated with mouse anti-?-tubulin (data not shown)
conWrming equal loading. The position of the molecular mass markers in kDa are indicated on the left. A representative image and the quantiWcation (bar
charts) corresponding to the average data of four independent experiments are shown in the lower panels. The intensity of the immunoreactive bands was
measured by densitometric scanning and the results are presented as % of the immunoreactivity detected in striatum of wild-type rats (means§SEM).
*P<0.05, **P<0.01 compared with wild-type of the same speciWc tissue.
A2Areceptor
D2receptor
D1receptor
PrefrontalStriatum
WT A2A
Cortex
WT A2A
WT A2A
80
A2Amonomer
MW
(kDa)
100
40
120
A2Adimer
50
Tubulin
Prefrontal Striatum
WT A2A
Cortex
WT A2A
WT A2A
80
D2dimer
MW
(kDa)
60
50
40
D2monomer
100
PrefrontalStriatum
WT A2A
Cortex
WT A2A
WT A2A
100
D1
MW
(kDa)
80
60
50
Multimeric
form
0%
0%
20%
20%
40%
40%
60%
60%
80%
80%
100%
100%
*
*
WTS A2AS WTC A2AC WTPF A2APF
WTS A2AS WTC A2AC WTPF A2APF
% of WT striatum
% of WT striatum
0%
20%
40%
60%
80%
100%
WTS A2AS WTC A2AC WTPF A2APF
% of WT striatum
0%
0%
20%
20%
40%
40%
60%
60%
80%
80%
100%
100%
120%
120%
140%
140%
160%
160%
****
**
**
WTS A2AS WTC A2AC WTPF A2APF WTS A2AS WTC A2AC WTPF A2APF
% of WT striatum% of WT striatum
A1receptor
mGlu5receptor
StriatumCortex
Prefrontal Striatum
WT A2A
Cortex
WT A2A
WT A2A
35
A1monomer
MW
(kDa)
75
30
A1dimer
Prefrontal
WT A2A
WT A2A
WT A2A
MW
(kDa)
160
mGluR5monomer
Multimeric form
0%
20%
40%
60%
80%
100%
120%
140%
160%
180%
WTS A2AS WTC A2AC WTPF A2APF
% of WT striatum
0%
20%
40%
60%
80%
100%
*
WTS A2AS WTC A2AC WTPF A2APF
% of WT striatum
AB

Page 9

Author's personal copy
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
49
5–7, when animals where assessed in a series of place tasks
for working memory, the averaged performance of control
rats to Wnd the new platform positions on each of these
days was as good as that achieved on the previous place
task (Paired t-test, day 5, 6, or 7 vs. day 3: All t’s<¡.90,
dfD10, n.s.). In contrast, TGR(NSEhA2A) showed worse
performance on days 5 and 7 when compared to the level
achieved on day 3 (Fig. 7A, Paired t-test, day 5 vs. day 3:
tD¡3.96, dfD10, P<.01; day 7 vs. day 3: tD¡3.51,
dfD10, P<.01).
Each ‘repeated acquisition paradigm’ was realized in a very
short interval of time (averaged maximum about 3min), since
latencies to reach the platform were short and the four trials
were consecutively administered (i.e., means§SEM latencies
day 1, control rats: trial 1, 26.07§4.26; trial 2, 15.50§3.22;
trial 3, 14.29§2.97; and trial 4, 13.93§2.37; transgenic rats:
trial 1, 24.91§7.04; trial 2, 20.55§4.97; trial 3, 16.27§5.38;
and trial 4, 22.36§5.93). When ‘genotype’ and ‘trial’ factors
where analysed on each of the three repeated acquisition par-
adigms for working memory only a ‘trial’ eVect on the dis-
tance travelled to reach the platform could be found on day 7
[Fig. 7B, F(3,69)D5.77, P<.001]. No diVerences were found
in the comparisons between each consecutive trial (index trial
n/trial n¡1) on each day. The comparisons of the Wrst and
each of the following trials (index trial 2/trial 1, trial 3/trial 1,
or trial 4/trial 1) were also considered. When the index trial
4/ trial 1 during the three days was analysed it revealed a
‘genotype£day’ eVect [Fig. 7B, F(2,46)D4.86; P<0.05] as
the fourth trial was worse than expected for the
TGR(NSEhA2A) animals on day 5 (post hoc analysis, index
trial 4/ trial 1, P<0.05).
Fig. 4. Immunohistochemistry for A2A receptors. A2A receptor immunoreactivity in nerve cell bodies and neuropil in the diVerent areas of the rat prefron-
tal cortex (PFCx; coronal section, Bregma 4.2mm) and caudate-putamen (C-Pu; coronal section, Bregma 0.2mm) in wild-type (SD) and TGR(NSEhA2A)
(A2A) rats. Fr, frontal cortex, area 2; Cg, cingulate cortex; MO, medial orbital cortex; VLO, ventrolateral orbital cortex; LO, lateral orbital cortex; AI,
agranular insular cortex (Paxinos & Watson, 1986). Bars: PFCx areasD40 ?m, C-Pu D 150?m.
Fig. 5. Radioligand binding. Saturation binding analysis of adenosine A2A
receptor antagonist [3H]ZM-241385
TGR(NSEhA2A) (A2A) rats in the striatum (A) and the prefrontal cortex
(B). Results represent the means§ SEM of the Bmax of four independent
experiments. *P<0.05 by Student-t-test. The KD values of the A2A recep-
tor did not vary from control to transgenic rats, being 0.83§ 0.3 and
0.87§ 0.2nM in the striatum, 3.03§ 0.2, and 2.20§ 1nM in the prefrontal
cortex (means §SEM).
in wild-type (SD) and

Page 10

Author's personal copy
novel transgenic rat strain with overexpression of A2A
receptors mainly in the cerebral cortex including the hippo-
campal formation, and the cerebellum which exhibits work-
ing memory deWcits. It must be noted that the homology in
amino acids between hA2A and rA2A receptors is about
84–85%. Receptors are functionally similar since they are
activated by endogenous adenosine with a similar although
not identical aYnity and their coupling to a main G protein
50
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
4. Discussion
In the present work, we establish TGR(NSEhA2A), a
(Gs) is identical. Although this does not exclude the exis-
tence of subtle diVerences that have been suggested by
slightly diVerent potencies of some selective A2A ligands on
these two receptors, altogether, this strongly supports that
overexpressing human A2A receptor is of functional signiW-
cance in the rat.
Since the areas with A2A receptor overexpression are
known to play a relevant role in the neural circuitry for
working memory (see introduction) special interest was
paid to behavioural screening of putative cognitive deWcits
of TGR(NSEhA2A) in learning and memory paradigms.
Table 1
Behavioral assessment of TGR(NSEhA2A)
G D GxD: genotype, day and genotype£ day interaction eVects, P<.05, respectively (MANOVA or Student’s t-test, see Section 2).
Age (weeks)Wild-type (means§SEM)TGR(NSEhA2A) (means§ SEM)Statistics
GDG £D
A. Hexagonal tunnel maze
Total activity counts
4–5 w
nD 12
274.75§12.68
nD 12
nD 10
293.10§15.78
nD 10
n.s.
——
B. 6 Arms radial tunnel maze
Total activity counts
Day 1
Day 2
Day 3
Number of explored arms
Day 1
Day 2
Day 3
Latency to explore the 6 arms (s)
Day 1
Day 2
Day 3
Reentries to explored arms
Day 1
Day 2
Day 3
4–5w
n.s.n.s.n.s.
204.42§12.14
219.33§10.14
237.25§16.57
232.80§13.10
237.20§15.45
228.30§10.48
n.s.n.s.n.s.
5.33§0.40
6.00§0.00
5.83§0.17
5.90§0.10
6.00§0.00
6.00§0.00
n.s*
n.s.
216.08§19.63
143.50§18.98
119.92§25.73
200.40§19.97
156.90§18.39
134.80§20.40
n.s.
*
n.s.
5.98§1.00
3.78§1.07
3.05§1.00
See Fig. 6A
See Fig. 6B
6.18§1.03
4.06§0.74
3.31§0.75
Number of blind arms
Reentries to blind arms
n.s.
n.s.
¤
¤
¤
¤
C. T-maze
Number of correct choices
Day 1
Day 2
Day 3
5–6 w
nD 14
nD 11
n.s.
*
n.s.
2.42§0.20
2.71§0.13
2.86§0.10
nD 14
133.47§7.19
26.13§2.66
nD 14
163.9§16.31
15.50§1.46
22.54§2.21
0.18§0.04
nD 14
See Fig. 7A
See Fig. 7A
See Fig. 7A and B
2.27§0.24
2.73§0.14
2.91§0.09
nD 11
135.80§6.50
19.90§1.79
nD 11
158.00§9.22
19.10§1.38
21.47§1.71
0.05§0.04
D. Open-Weld
Total number of crossings
Total number of rearings
6–7 w
n.s.
——
E. Object recognition test
Time 1
TS (time sample object)(s)
TN (time new object)(s)
Index (TN¡ TS)/(TN+TS)
F. Morris water maze
Place task for spatial learning (days 1-3)
Cue learning (day 4)
Place task for working memory (days 5–7)
6–7 w
n.s.
n.s.
n.s.
*
—
—
—
—
—
—
—
—
7–8 w
n.s.
n.s.
n.s.
*
—
¤
n.s.
—
¤
G. Elevated plus maze
Latency to enter into the open arms
Number of entries into the open arms
Number of entries into the enclosed arms
% time in open arms TOA/(TOA+TEA)£ 100
8–9 w
nD 14
61.43§27.35
3.36§0.51
10.07§0.87
15.48§2.91
nD 11
56.27§27.12
2.73§0.49
9.18§0.50
11.72§3.07
n.s.
n.s.
n.s.
n.s.
—
—
—
—
—
—
—
—

Page 11

Author's personal copy
tial one, the object recognition test (Ennaceur & Delacour,
1988; Willig et al., 1987). Other tests for spontaneous motor
activity and anxiety were included as modiWcation of these
behaviours may interfere in the assessment of cognitive
function.
The major result obtained in these transgenic rats was
the discovery of working memory deWcits as measured in
the 6-arms radial tunnel maze when blind arms perfor-
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
51
Thus, the battery of tests was designed to assess spatial ref-
erence memory and working memory. In particular, four
tests for working memory were used: three spatial ones, 6-
arms radial tunnel maze (Bättig, 1983; Fitzgerald et al.,
1988), spontaneous alternation in a T-maze (Olton et al.,
1979; Squire, 1969) and the ‘repeated acquisition paradigm’
in the Morris water maze (Whishaw, 1985) and a non-spa-
mance was analysed; in the object recognition test with
reduced recognition of the novel object; and in the
‘repeated acquisition paradigm’ on the Morris water maze
Fig. 6. Learning and memory in a 6-arms radial tunnel maze repeated test
(days 1–3). Results are means §SEM. (A) Number of explored blind
alleys. (B) Number of re-entries into already explored blind alleys. Wild-
type (WT) group,
nD12;
ANOVA,‘day’ eVect: aP<0.01, bP<.05; ‘genotype£day’ interaction
eVects: cP<.01 (see Section 3). Student’s t-test, *P<.05 versus the WT
group.
TGR(NSEhA2A),
nD10. Two-way
Fig. 7. Learning and memory in several tasks in the Morris water maze.
Results are means§ SEM. (A) Mean distance to reach the platform in the
four trials per session during the place task for spatial learning (days 1–3),
the cue learning (day 4) and the ‘repeated acquisition paradigm’ for work-
ing memory (days 5–7). (B) Upper panel: distance to reach the platform in
each of the four consecutive trials per session during the place task for
working memory (days 5–7). Lower panel: Index “trial 4/trial 1”: ratio of
distance (cm) covered on trial 4 divided by the distance (cm) covered on
trial 1, on the same day in this working memory task. Wild-type (WT)
group, nD 12; TGR(NSEhA2A), nD 10. Two-way ANOVA, ‘day’ eVect:
aP<0.001; ‘trial’ eVect: bP<.001; ‘genotype £day’ interaction eVects:
cP<0.05 (see Results). Student’s t-test: *P<.05 versus the WT group;
Paired t-test: #P<0.05 versus day 3 of the same group.

Page 12

Author's personal copy
(Kesner & Rolls, 2001), was normal in TGR(NSEhA2A) as
several measures (latency, re-entries into explored arms)
including number and re-entries into blind arms decreased
with repeated testing while total activity counts and num-
ber of explored arms were maintained constant over the
sessions. In contrast, in the choice between the long-angled
arms and blind alleys, considered to provide a measure of
within-session working memory similar to that of standard
52
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
test with performance deWcit in the 4th trial vs. 1st trial
comparisons. Certain spatial long-term reference memory
deWcits involving deWcits in a slower learning process were
also observed in the 6-arms radial maze or in the acquisi-
tion of a diVerent task in the Morris water maze when the
platform was located in a new position. These memory deW-
cits were correlated with evidence of increased A2A mRNA
levels and A2A receptor protein levels as well as of increased
A2A receptor binding function especially in regions of the
cerebral cortex.
Spontaneous motor activity, measured by total activity
counts in the two modalities of the tunnel maze and by
means of crossing and rearings in the open-Weld test, was
not modiWed in TGR(NSEhA2A). Similar exploratory
behaviours were also exhibited in the sample trial of the
object recognition tests when the ‘time 1’ to reach the crite-
ria was analysed or in the number of entries in the plus
maze test. Also, motor abilities to navigate (swim speeds)
were equal in the Morris water maze. No genotype diVer-
ences were also found in the emotional/anxious-like behav-
iour recorded in the plus maze test nor in motivation and
sensory motor performance assessed in the cue-learning
task. These are important results since performance of ani-
mals in learning and memory tasks may be modiWed by
genotype diVerences in such behavioural features and since
the overexpression of A2A receptors in areas such as the
striatum could have an eVect on such measures or, for
instance, indirect actions of adenosine on attention and
wakefulness could contribute to diVerences in learning and
memory. In this sense, reproducing the main features of rat
burrows in the wild provide a more ethological context
than other devices when assessing locomotor activity,
exploratory behaviour and learning and memory, namely
those with interference of motivation or emotionality by
using food-deprivation or punishment (Bättig, 1983).
In the 6-arms radial tunnel maze the number of
re-entries into previously explored arms are considered
equivalent to the retracing errors in more conventional 8-
or 16-arms mazes (Fitzgerald et al., 1988). During successive
sessions the rats are known to increase their exploratory
eYciency as measured by a lower probability of re-entering
a sector of the maze until all sectors are visited, with a
reduced time needed to visit all sectors without increasing
locomotor activity. These decreases have been proposed as
measures of long-term memory formation because there is
a successive decrease over repetitive trials (Fitzgerald et al.,
1988; Sarter & Steckler, 1989; Welzl, Alessandri, Oettinger,
& Bättig, 1988). In our study, between-sessions (long-term)
spatial reference memory, mainly dependent on hippocampus
T-maze (Fitzgerald et al., 1988), the TGR(NSEhA2A)
showed a high number of blind arm entries while a single
experience (on average less than twice) was suYcient for
wild-type rats to realize that the alley on the right was short
and blind. Moreover, only a few wild-type animals re-
entered an explored blind arm while TGR(NSEhA2A)
repeated the same choice several times. The repeated testing
oVered TGR(NSEhA2A) a chance to learn about this fact
and they slowly achieved the exploratory eYciency shown
by wild-type rats already from the Wrst day. In other studies
where lesions induce a transient increase of the number of
blind arm entries the results are also discussed in terms of
orientation impairments or even thigmotaxia (Sarter &
Steckler, 1989).
Interestingly, our transgenic animals did not diVer from
controls in the T-maze. In other animal models for working
memory, such as the subchronic phencyclidine model, it has
been shown that deWcits produced in this test (Jentsch et al.,
1999) fail to be reproduced in the radial arm maze (Li, Cul-
len, Anwyl, & Rowan, 2003). In our 6-arms radial maze test
the T-intersections oVer a free-choice while in the T-maze
the Wrst trial is always a forced choice and the test trial is a
free choice. Measured eVects may also depend on to which
extent tasks purported to assess working memory involve
episodic memory and recruit hippocampal function as well
(reviewed by Castner et al., 2004). In this respect, it is inter-
esting to note that, as before, the analysis of performance in
the T-maze over three consecutive days provided evidence
that other forms of memory consolidation (i.e., long-term
memory) were more or less preserved resulting in an
improvement although achieved more slowly than in wild-
type rats.
In the Morris water maze, the acquisition of the place
task for spatial reference memory, which is mainly depen-
dent on hippocampus, was as good in TGR(NSEhA2A) as
in wild-type rats with similar within-session performance
and a fast improvement with repeated testing over three
sessions. The ‘repeated acquisition paradigms’ with four tri-
als consecutively administered were realized very fast and
each session was completed within 2 or 3min. However,
when the performance was analysed, the 4th trial was
shown to be worse than expected in TGR(NSEhA2A) sug-
gesting deWcits in this working memory task. On the other
hand, in this test, animals daily confronted with an unex-
pected modiWcation of the platform position needed a cer-
tain level of learning plasticity to inhibit the trend to look
for previous platform positions while searching its new one.
Here, the wild-type rats made it with an average distance on
day 5, 6, or 7 similar to that achieved at the end of the pre-
vious place task whereas TGR(NSEhA2A) spent twice that
time to reach the platform on days 5 and 7. In a similar
place-alternation task, an essential role of posterior cingu-
late areas in the use of topographical information has been
demonstrated (Sutherland, Whishaw, & Kolb, 1988) proba-
bly by transmitting and elaborating information passing
between the hippocampal system and neocortical associa-
tion areas.

Page 13

Author's personal copy
A2A receptor homodimers versus heteromers, with the con-
sequent reduced expression of D2 and mGlu5 receptors.
Oligomerization of the 5th transmembrane domain of the
A2A receptor may play a role in the A2A dimerization and
are highly resistant to temperature and chemical denatur-
ation (Thevenin et al., 2005). GPCR heteromerization is an
important event that has pharmacological consequences.
We have provided a mechanistic framework to explain
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
53
Finally,
TGR(NSEhA2A) were not only restricted to some spatial
learning tasks studied in the mazes. These animals also
exhibited lower ability than wild-type rats to recognize a
new object in a non-spatial learning task assessing working
memory even when the acquisition of the task, the sponta-
neous exploratory behaviour measured by ‘time 1’ during
the sample trial, was not modiWed.
It seems possible that the deWcits in working memory
observed in the TGR(NSEhA2A) are mainly caused by the
neuronal overexpression of A2A receptors in the cortical
regions and specially the prefrontal cortex. Other receptors
putatively involved in working memory, dopamine D1,
dopamine D2, adenosine A1, and mGlu5 receptors were not
diVerentially expressed in the cortex of transgenic versus
wild-type rats (Fig. 3B). It is true however, that working
memory deWcits are associated with a disturbed network
activity involving not only prefrontal cortex but also parie-
tal cortex, hippocampus, basal ganglia, and thalamus (see
e.g., Levy, Friedman, Davachi, & Goldman-Rakic, 1997,
reviewed by Castner et al., 2004) and therefore, the neuro-
nal A2A receptor overexpression demonstrated also in these
brain regions could be of relevance for the observed deWcits
in working memory. With respect to striatum, the increase
in striatal A2A receptor density was weak and the presence
of the human A2A mRNA level could hardly be demon-
strated in this region. However, this striatal A2A receptor
overexpression may have contributed to the signiWcant
downregulation of D2 and mGlu5 receptors in this region
(Fig. 3B), which may be involved in mediating the observed
alterations in working memory (see Miyoshi et al., 2002).
The selective D2 and mGlu5 receptor downregulation, with-
out changes in A1 or D1 receptor expression, is most proba-
bly related to the selective ability of A2A receptors to form
heteromeric complexes with D2 and mGlu5 receptors
(Canals et al., 2003; Ciruela et al., 2004; Ferré et al., 2002;
Hillion et al., 2002). It has recently been demonstrated that
A2A receptors form homodimers, which may represent the
functional form of the A2A receptors expressed in the
plasma membrane (Canals et al., 2004; Kamiya, Saitoh,
Yoshioka, & Nakata, 2003; Thevenin, Roberts, Lazarova,
& Robinson, 2005). In the TGR(NSEhA2A) it seems that
the formation of A2A receptor dimers is favoured since they
were not found in the striatum of WT rats. Alternatively
the A2A antibody may not recognize the rat A2A receptor
dimers but this seems less likely. Both A2A receptor homo-
mers and heteromers are preformed before traYcking to
the plasma membrane (Canals et al., 2003, 2004) and over-
expression of A2A receptors seems to favor the formation of
working memory deWcits shown by
GPCR operation by means of the “two-state dimer model”,
a very useful tool for understanding the pharmacology of
many receptor homo-heterodimers (Franco et al., 2005,
2006).
It is known that A2A receptors are positively coupled to
adenylate cyclase and increase cAMP accumulation and
protein kinase A activity (Kull et al., 1999) leading to
increased neuronal excitability as seen from increased
GABA release in the ventral striatopallidal GABA path-
way after A2A receptor agonist treatment (Ferré, O’Connor,
Snaprud, Ungerstedt, & Fuxe, 1994) and A2A receptor ago-
nist-induced increases in the striatal glutamate release from
corticostriatal glutamate terminals (Popoli et al., 2003;
Quarta et al., 2004). Therefore, enhanced A2A receptor-
mediated transmission in the cortex cerebri may lead to a
dysbalance in the activity of pyramidal glutamate nerve
cells and non-pyramidal GABA nerve cells depending on
the degree of A2A receptor overexpression in pyramidal vs.
non-pyramidal nerve cells in the cortex cerebri, which may
cause the deWcits in the working memory described in the
present paper. A2A receptors are functionally very similar to
D1 receptors, since their activation increases cAMP and
neuronal excitability. The role of D1 receptors in the cortex
and in working memory has been thoroughly studied. It is
well known that both an increased and a reduced D1 recep-
tor-mediated transmission will lead to a deWcit in working
memory performance (Goldman-Rakic et al., 2000). This
supports the role of cortical A2A receptor overexpression in
the memory deWcits found in the present study. The A2A
overexpression in the hippocampus may not be of relevance
since learning of a spatial reference memory tasks (i.e., the
Wrst place task in the Morris water maze) and other forms
of memory dependent on hippocampal function (i.e.,
improvement by repeated testing) were not aVected in the
TGR(NSEhA2A) in spite of the A2A mRNA and protein
overexpression found in this region with in situ hybridiza-
tion and immunohistochemistry, respectively. For this rea-
son Western blot of A2A receptors in the hippocampal
formation was not performed.
The present model oVers an advantage over traditional
pharmacology/local injection studies with A2A agonists.
Thus, the A2A agonist CGS 21680 in cortical regions binds
also to a site diVerent from A2A receptors (Johansson &
Fredholm, 1989), which has complicated previous observa-
tions that e.g., CGS 21680 injected into the posterior cinn-
gulate cortex impairs memory retrieval for an inhibitory
avoidance task (Pereira et al., 2005). The results obtained in
the present transgenic model with rats overexpressing
human A2A receptors and showing working memory deW-
cits complement these previous studies. They indicate that
cortical A2A receptors in WT animals even if present in low
densities in the cerebral cortex (Johansson, Georgiev, Par-
kinson, & Fredholm, 1993) may in fact be involved in caus-
ing the deWcits found in memory processes after
intracortical A2A agonist injections.
In conclusion, we have established TGR(NSEhA2A) a
novel transgenic rat strain overexpressing adenosine A2A

Page 14

Author's personal copy
Prestimulus eVects on human startle reXex in normals and schizo-
phrenics. Psychophysiology, 15, 339–343.
Canals, M., Marcellino, D., Fanelli, F., Ciruela, F., de Benedetti, P., Gold-
berg, S. R., et al. (2003). Adenosine A2A-dopamine D2 receptor-recep-
tor heteromerization: qualitative and quantitative assessment by
Xuorescence and bioluminescence energy transfer. Journal of Biological
Chemistry, 278, 46741–46749.
Canals, M., Burgueno, J., Marcellino, D., Cabello, N., Canela, E. I., Mallol,
J., et al. (2004). Homodimerization of adenosine A2A receptors: quali-
54
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
receptors mainly in cortical regions of the brain associated
with a selective failure of working memory performance.
The failure of working memory performance is a key deWcit
in cognitive malfunction related to prefrontal cortex anom-
alies (Goldberg & Weinberger, 1988; Kolb & Whishaw,
1983; Weinberger, Berman, & Zec, 1986). Therefore, rats
overexpressing adenosine A2A receptors could provide an
useful animal model for some of the cognitive disruptions
related to altered adenosine/dopamine interactions at the
level of prefrontal cortex, in view of the existence of antago-
nistic A2A/D2 receptor interactions in the brain (Fuxe et al.,
2005) and speciWc stimulation of D2 receptors may improve
learning and memory in schizophrenia (Tamminga &
Carlsson, 2002) and is involved in modulating working
memory processes (Wang, Vijayraghavan, & Goldman-
Rakic, 2004). Finally, it has been shown that cyclic AMP-
mediated signaling components are increased in the pre-
frontal cortex of depressed suicide victims (Odagaki et al.,
2001). Memory disturbances are known to exist in depres-
sion (see Antikainen et al., 2001) and an A2A upregulation
in the prefrontal cortex may therefore contribute to such
memory dysfunctions in depression based on the present
Wndings.
Acknowledgments
Thanks to Gloria Blázquez and Laetitia Cuvelier for
technical assistance. This work was supported by an EC
grant (QLG3-CT-2001-01056), the Swedish Research
Council, Programa Ramon y Cajal and Fundació Marató-
TV3 núm. 014110, grants from Ministerio de Ciencia y Tec-
nología SAF2002-03293 to R.F., Grant 02/056-00 from
Fundacio la Caixa for R.F., Grants 01/012710 from Fun-
dació Marató TV3 for R.F., and grants of the Fonds
National de la Recherche ScientiWque (SNS), Queen Elisa-
beth Medical Foundation (SNS), Van Buuren Foundation
(SNS), and Action de Recherche Concertée (SNS).
References
Antikainen, R., Hanninen, T., Honkalampi, K., Hintikka, J., Koivumaa-
Honkanen, H., Tanskanen, A., et al. (2001). Mood improvement
reduces memory complaints in depressed patients. European Archives
in Psychiatry and Clinical Neuroscience, 251, 6–11.
Arai, A., Kessler, M., & Lynch, G. (1990). The eVects of adenosine on the
development long-term potentiation. Neuroscience Letters, 119, 41–44.
Bättig, K. (1983). Spontaneous tunnel maze locomotion in rats. In G.
Zbinden, V. Cuomo, G. Racagni, & B. Weiss (Eds.), Application of
behavioural pharmacology in toxicology (pp. 15–26). New York: Raven
Press.
BraV, D., Stone, C., Callaway, E., Geyer, M., Glick, I., & Bali, L. (1978).
tative and quantitative assessment by Xuorescence and biolumines-
cence energy transfer. Journal of Neurochemistry, 88, 726–734.
Castner, S. A., Goldman-Rakic, P. S., & Williams, G. V. (2004). Animal
models of working memory: insights for targeting cognitive dysfunc-
tion in schizophrenia. Psychopharmacology, 174, 111–125.
Chen, J. F., Huang, Z., Ma, J., Zhu, J., Moratalla, R., Standaert, D., et al.
(1999). A(2A) adenosine receptor deWciency attenuates brain injury
induced by transient focal ischemia in mice. Journal of Neuroscience,
19, 9192–9200.
Ciruela, F., Burgueno, J., Casado, V. V., Canals, M., Marcellino, D., Gold-
berg, S. R., et al. (2004). Combining mass spectrometry and pull-down
techniques for the study of receptor heteromerization. Direct epitope–
epitope electrostatic interactions between adenosine A(2A) and dopa-
mine D(2) receptors. Analytical Chemistry, 76, 5354–5363.
d’Alcantara, P., Ledent, C., Swillens, S., & SchiVmann, S. N. (2001). Inacti-
vation of adenosine A2A receptor impairs long term potentiation in
the accumbens nucleus without altering basal synaptic transmission.
Neuroscience, 107, 455–464.
Ennaceur, A., & Delacour, J. (1988). A new one-trial test for neurobiologi-
cal studies of memory in rats. 1, Behavioural data. Behavioural Brain
Research, 31, 47–59.
Ferré, S., Fuxe, K., von Euler, G., Johansson, B., & Fredholm, B. B. (1992).
Adenosine–dopamine interactions in the brain. Neuroscience, 51, 501–
512.
Ferré, S., O’Connor, W. T., Snaprud, P., Ungerstedt, U., & Fuxe, K. (1994).
Antagonistic interaction between adenosine A2A receptors and dopa-
mine D2 receptors in the ventral striopallidal system. Implications for
the treatment of schizophrenia. Neuroscience, 63, 765–773.
Ferré, S., Fredholm, B. B., Morelli, M., Popoli, P., & Fuxe, K. (1997). Aden-
osine–dopamine receptor–receptor interactions as an integrative mech-
anism in the basal ganglia. Trends in Neurosciences, 20, 482–487.
Ferré, S., Karcz-Kubicha, M., Hope, B. T., Popoli, P., Burgueno, J., Gut-
ierrez, M. A., Casado, V., Fuxe, K., Goldberg, S. R., Lluis, C., Franco,
R., & Ciruela, F. (2002). Synergistic interaction between adenosine
A2A and glutamate mGlu5 receptors: implications for striatal neuro-
nal function. Proceedings of the National Academy of Science of USA,
99, 11940–11945.
Fink, J. S., Weaver, D. R., Rivkees, S. A., Peterfreund, R. A., Pollack, A. E.,
Adler, E. M., et al. (1992). Molecular cloning of the rat A2 adenosine
receptor: selective co-expression with D2 dopamine receptors in rat
striatum. Molecular Brain Research, 14, 186–195.
Fitzgerald, R. E., Berres, M., & Schaeppi, U. (1988). Validation of a radial
maze test for assessment of learning and memory in rats. Toxicology,
49, 425–432.
Forss-Petter, S., Danielson, P. E., Catsicas, S., Battenberg, E., Price, J.,
Nerenberg, M., & SutcliVe, J. G. (1990). Transgenic mice expressing ?-
galactosidase in mature neurons under neuron-speciWc enolase pro-
moter control. Neuron, 5, 187–197.
Franco, R., Casado, V., Mallol, J., Ferre, S., Fuxe, K., Cortes, A., et al.
(2005). Dimer-based model for heptaspanning membrane receptors.
Trends in Biochemical Sciences, 30, 360–366.
Franco, R., Casado, V., Mallol, J., Ferrada, C., Ferre, S., Fuxe, K., et al.
(2006). The “two state dimer receptor model”. A general model for
receptor dimers. Molecular Pharmacology, 69, 1905–1912.
Fuxe, K., Ferré, S., Zoli, M., & Agnati, L. F. (1998). Integrated events in
central dopamine transmission as analyzed at multiple levels. Evidence
for intramembrane adenosine A2A/dopamine D2 and adenosine A1/
dopamine D1 receptor interactions in the basal ganglia. Brain Research
Reviews, 26, 258–273.
Fuxe, K., Ferre, S., Canals, M., Torvinen, M., Terasmaa, A., Marcellino,
D., et al. (2005). Adenosine A2A and dopamine D2 heteromeric recep-
tor complexes and their function. Journal of Molecular Neuroscience,
26, 209–219.
García-Munoz, M., Young, S. J., & Groves, P. M. (1991). Terminal excit-
ability of the corticostriatal pathway. 1. Regulation by dopamine
receptor stimulation. Brain Research, 551, 195–206.
Giménez-Llort, L., Fernández-Teruel, A., Escorihuela, R. M., Fredholm, B.
B., Tobeña, A., Pekín, M., et al. (2002). Mice lacking the adenosine A1

Page 15

Author's personal copy
Levy, R., Friedman, H. R., Davachi, L., & Goldman-Rakic, P. S. (1997).
DiVerential activation of the caudate nucleus in primates performing
spatial and nonspatial working memory tasks. Journal of Neuroscience,
17, 3870–3882.
Li, S., Cullen, W. K., Anwyl, R., & Rowan, M. J. (2003). Dopamine-depen-
dent facilitation of LTP induction in hippocampal CA1 by exposure to
spatial novelty. Nature Neuroscience, 6, 526–531.
Libert, F., Parmentier, M., Lefort, A., Dinsart, C., Van Sande, J., Maen-
haut, C., et al. (1989). Selective ampliWcation and cloning of four new
L. Giménez-Llort et al. / Neurobiology of Learning and Memory 87 (2007) 42–56
55
receptor are anxious and aggressive, but are normal learners with
reduced muscle strength and survival rate. European Journal of Neuro-
science, 16, 547–550.
Goldberg, T. E., & Weinberger, D. R. (1988). Probing prefrontal function
in schizophrenia with neuropsychological paradigms. Schizophrenia
Bulletin, 14, 179–183.
Goldman-Rakic, P. S. (1994). Working memory dysfunction in schizo-
phrenia. Journal of Neuropsychiatric Clinical Neuroscience, 6, 348–357.
Goldman-Rakic, P. S., Muly, E. C., III, & Williams, G. V. (2000). D1 recep-
tors in prefrontal cells and circuits. Brain Research Reviews, 31, 295–
301.
Hauber, W., & Bareiss, A. (2001). Facilitative eVects of an adenosine A1/
A2 receptor blockade on spatial memory performance of rats: selective
enhancement of reference memory retention during the light period.
Behavioural Brain Research, 118, 43–52.
Hillion, J., Canals, M., Torvinen, M., Casado, V., Scott, R., Terasmaa, A.,
et al. (2002). Coaggregation., cointernalization., and codesensitization
of adenosine A2A receptors and dopamine D2 receptors. Journal of Bio-
logical Chemistry, 277, 18091–18097.
Hutchison, A. J., Webb, R. L., Oei, H. H., Ghai, G. R., Zimmerman, M. B.,
& Williams, M. (1989). CGS 21680C, an A2 selective adenosine recep-
tor agonist with preferential hypotensive activity. Journal of Pharma-
cology and Experimental Therapeutics, 251, 47–55.
Kamiya, T., Saitoh, O., Yoshioka, K., & Nakata, H. (2003). Oligomeriza-
tion of adenosine A2A and dopamine D2 receptors in living cells. Bio-
chemical and Biophysical Research Communications, 306, 544–549.
Jarvis, M. F., Schulz, R., Hutchison, A. J., Do, U. H., Sills, M. A., & Wil-
liams, M. (1989). [3H]CGS 21680, a selective A2 adenosine receptor
agonist directly labels A2 receptors in rat brain. Journal of Pharmacol-
ogy and Experimental Therapeutics, 251, 888–893.
Jentsch, J. D., Taylor, J. R., Redmon, D. E., Jr., Elsworth, J. D., Youngren,
K. D., & Roth, R. H. (1999). Dopamine D4 receptor antagonist reversal
of subchronic phencyclidine-induced object retrieval/detour deWcits in
monkeys. Psychopharmacology, 142, 78–84.
Johansson, B., & Fredholm, B. B. (1989). Further characterization of the
binding of the adenosine receptor agonist [3H]CGS 21680 in rat brain
using autoradiography. Neuropharmacology, 34, 393–403.
Johansson, B., Georgiev, V., Parkinson, F. E., & Fredholm, B. B. (1993).
The binding of the adenosine A2 receptor selective agonist [3H]CGS
21680 to rat cortex diVers from its binding to rat striatum. European
Journal of Pharmacology, 247, 103–110.
Kesner, R. P., & Rolls, E. T. (2001). Role of long-term synaptic modiWca-
tion in short-term memory. Hippocampus, 11, 240–250.
Kessey, K., Trommer, B. L., Overstreet, L. S., Ji, T., & Mogul, D. J. (1997).
A role for adenosine A2 receptors in the induction of long-term poten-
tiation in the CA1 region of rat hippocampus. Brain Research, 756,
184–190.
Kolb, B., & Whishaw, I. Q. (1983). Performance of schizophrenic patients
on tests sensitive to left or right frontal, temporal, or parietal function
in neurological patients. Journal of Nervous and Mental Disorders, 171,
435–443.
Kull, B., Arslan, G., Nilsson, C., Owman, C., Lorenzen, A., Schwabe, U., et
al. (1999). DiVerences in the order of potency for agonists but not
antagonists at human and rat adenosine A2A receptors. Biochemical
Pharmacology, 57, 65–67.
Ledent, C., Vaugeois, J-M., SchiVmann, S. N., Pedrazzini, T., El Yacoubi,
M., Vanderhaeghe, J-J., et al. (1997). Aggressiveness., hypoalgesia and
high blood pressure in mice lacking the adenosine A2a receptor.
Nature, 388, 674–678.
members of the G protein-coupled receptor family. Science, 244, 569–
572.
Miyoshi, E., Wietzikoski, S., Camplessei, M., Silveira, R., Takahashi, R. N.,
& Da Cunha, C. (2002). Impaired learning in a spatial working mem-
ory version and in a cued version of the water maze in rats with MPTP-
induced mesencephalic dopaminergic lesions. Brain Research Bulletin,
58, 41–47.
Moreau, J-L., & Huber, G. (1999). Central adenosine A2A receptors: an
overview. Brain Research Reviews, 31, 65–82.
Morris, R. (1984). Developments of a water-maze procedure for studying
spatial learning in the rat. Journal of Neuroscience Methods, 11, 47–60.
Odagaki, Y., Garcia-Sevilla, J. A., Huguelet, P., La Harpe, R., Koyama, T.,
& Guimon, J. (2001). Cyclic AMP-mediated signaling components are
upregulated in the prefrontal cortex of depressed suicide victims. Brain
Research, 898, 224–231.
Olton, D. S., Becker, J. T., & Handelmann, G. E. (1979). Hippocampus,
space, and memory. Behavioural Brain Science, 2, 313–365.
Park, S., & Holzman, P. S. (1992). Schizophrenics show spatial working
memory deWcits. Archives of General Psychiatry, 49, 975–982.
Paxinos, G., & Watson, C. (1986). The rat brain in stereotaxic coordinates
(second ed.). San Diego: Academic Press.
Pereira, G. S., Rossato, J. I., Sarkis, J. J., Cammarota, M., Bonan, C. D., &
Izquierdo, I. (2005). Activation of adenosine receptors in the posterior
cingulate cortex impairs memory retrieval in the rat. Neurobiology of
Learing and Memory, 83, 217–223.
Popoli, P., Frank, C., Tebano, M. T., Potenza, R. L., Pintor, A., Domenici,
M. R., et al. (2003). Modulation of glutamate release and excitotoxicity
by adenosine A2A receptors. Neurology, 61, S69–S77.
Popova, E., Krivokharchenko, A., Ganten, D., & Bader, M. (2002). Com-
parison between PMSG and FSH induced superovulation for the gen-
eration of transgenic rats. Molecular Reproduction and Development,
63, 177–182.
Quarta, D., Borycz, J., Solinas, M., Patkar, K., Hockemeyer, J., Ciruela, F.,
et al. (2004). Adenosine receptor-mediated modulation of dopamine
release in the nucleus accumbens depends on glutamate neurotransmis-
sion and N-methyl-D-aspartate receptor stimulation. Journal of Neuro-
chemistry, 91, 873–880.
Rebola, N., Sebastiao, A. M., de Mendonca, A., Oliveira, C. R., Ribeiro, J.
A., & Cunha, R. A. (2003). Enhanced adenosine A2A receptor facilita-
tion of synaptic transmission in the hippocampus of aged rats. Journal
of Neurophysiology, 90, 1295–1303.
Rosin, D. L., Robeva, A., Woodard, R. L., Guyenet, P. G., & Linden, J.
(1998). Immunohistochemical localization of adenosine A2A receptors
in the rat central nervous system. Journal of Comparative Neurology,
401, 163–186.
Sarter, M., & Steckler, T. (1989). Spontaneous exploration of a 6-arm
radial tunnel maze by basal forebrain lesioned rats: eVects of the ben-
zodiazepine receptor antagonist ?-carboline ZK 93 426. Psychophar-
macology, 98, 193–202.
SchiVmann, S. N., Libert, F., Vassart, G., & Vanderhaeghen, J.-J. (1991).
Distribution of adenosine A2 receptor mRNA in the human brain.
Neuroscience Letters, 130, 177–181.
SchiVmann, S. N., & Vanderhaeghen, J.-J. (1993). Adenosine A2 receptors
regulate the gene expression of striatopallidal and striatonigral neu-
rons. Journal of Neuroscience, 13, 1080–1087.
Silva, J.-A., Jr., Araujo, R. C., Baltatu, O., Oliveira, S. M., Tschöpe, C.,
Fink, E., et al. (2000). Reduced cardiac hypertrophy and altered blood
pressure control in transgenic rats with the human tissue kallikrein
gene. FASEB Journal, 14, 1858–1860.
Squire, L. R. (1969). EVects of pre-trial and post-trial administration of
cholinergic and anticholinergic drugs on spontaneous alternation.
Journal of Comparative Physiology and Psychology, 74, 41–45.
Sutherland, R. J., Whishaw, I. Q., & Kolb, B. (1988). Contributions of cin-
gulate cortex to two forms of spatial learning and memory. Journal of
Neuroscience, 8, 1863–1872.
Suzuki, F., Shimada, J., Shiozaki, S., Ichikawa, S., Ishii, A., Nakamura, J.,
et al. (1993). Adenosine A1 antagonists. 3. Structure–activity relation-
ships on amelioration against scopolamine- or N6-((R)-phenylisopro-