Heterozygous CYP1B1 gene mutations in Spanish patients with primary open-angle glaucoma.

Abstract

To investigate CYP1B1 gene mutations in Spanish patients with ocular hypertension (OHT) or primary open angle glaucoma (POAG).
The two coding exons of CYP1B1 were screened for sequence alterations by direct PCR DNA sequencing in 37 and 82 unrelated Spanish subjects diagnosed with OHT and POAG, respectively. As a control we used a group of 93 subjects from whom OHT or glaucoma were ruled out.
We found three different predicted amino acid substitutions (Ala189Pro, Ala330Ser, and Ala443Gly) in three (8.1%) OHT subjects, and seven different mutations (Ser28Trp, Gly61Glu, Tyr81Asn, Gln144His, Arg145Trp, Glu229Lys, and Val409Phe) in nine (10.9%) glaucoma patients. These sequence variations showed higher frequencies in cases than in controls (as recently reported in French patients). They are predicted to produce a significant change in the amino acid sequence and affect conserved regions of the protein. All these missense mutations were found as heterozygots. In addition, four of them have been previously found in PCG and/or POAG patients, whereas the other six mutations (Ser28Trp, Gln144His, Arg145Trp, Ala189Pro, Ala330Ser, and Val409Phe) have not been previously described. Clinically, these mutations are associated with an age at diagnosis ranging from 12 to 58 years (mean 34.3 years) and from 48 to 77 years (mean 59.9 years) among OHT and glaucoma patients, respectively.
Heterozygous CYP1B1 mutations could confer increased susceptibility to the development of POAG in the Spanish population.

Full text

Page 1

Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
Received 16 March 2006 | Accepted 3 July 2006 | Published 11 July 2006
Glaucoma is a complex and genetically heterogeneous
disease characterized by the progressive apoptotic death of
retinal ganglion cells. This process originates excavation of
the optic nerve head, visual field loss, and eventually leads to
blindness [1]. Primary open-angle glaucoma (POAG) is the
most common form of glaucoma, featured by a juvenile or
adult (>40 years) onset, a gonioscopically open angle, and a
reduced outflow facility. Although mutations in genes such as
MYOC, OPTN, and WDR36 have been identified in some
POAG cases [2-5], the genetic defect remains unknown in
most patients.
Mutations in the CYP1B1 gene are the predominant cause
of primary congenital glaucoma (PCG) [6], a rare and severe
form of autosomal recessive glaucoma. This disease is pro-
duced by an anomalous development of the trabecular mesh-
work and anterior chamber angle, which increases resistance
to aqueous humor outflow and raises intraocular pressure
(IOP).
The human CYP1B1 gene encodes a member of the cyto-
chrome P450 superfamily, subfamily I, is located on chromo-
some 2p22-21, and is composed of three exons with the trans-
lated region beginning at the 5' end of the second exon. The
CYP1B1 protein is a membrane-bound monomeric mixed
function monooxygenase. It has been proposed that this cyto-
chrome participates in iridocorneal angle development [7], thus
alteration of CYP1B1 activity could impair the morphogen-
esis of the outflow angle, leading to IOP elevation and glau-
coma.
CYP1B1 mutations are also present in certain families
where PCG and POAG co-exist [8-10], and in sporadic cases
of POAG in different populations [11,12]. Recently the asso-
ciation of the common polymorphism N453S with optic disc
cupping and visual field alteration in patients with POAG has
been described [13]. Herein, we investigated the role of
CYP1B1 mutations in a population of unrelated Spanish indi-
viduals with either OHT or POAG. We found that CYP1B1
heterozygous mutations are increased in these two groups of
patients.
METHODS
Subjects: Eighty-two and 37 unrelated patients diagnosed with
POAG and OHT, respectively, were studied retrospectively
for CYP1B1 mutations. All the individuals were Spanish Cau-
casians recruited and regularly followed-up in the “Servicio
de Oftalmología, Complejo Hospitalario Universitario de
Albacete”, Spain. None of the subjects were immigrants. Four
families of CYP1B1 mutation carriers were also studied. The
criteria for a diagnosis of OHT were pressure greater than 21
©2006 Molecular Vision
Heterozygous CYP1B1 gene mutations in Spanish patients with
primary open-angle glaucoma
María-Pilar López-Garrido,1 Francisco Sánchez-Sánchez,1 Francisco López-Martínez,2 José-Daniel Aroca-
Aguilar,1 Cristina Blanco-Marchite,2 Miguel Coca-Prados,3 Julio Escribano1
1Área de Genética, Facultad de Medicina/Centro Regional de Investigaciones Biomédicas (CRIB), Universidad de Castilla-La
Mancha and 2Servicio de Oftalmología, Complejo Hospitalario Universitario de Albacete, Albacete, Spain; 3Department of Oph-
thalmology and Visual Science, Yale University School of Medicine, New Haven, CT
Purpose: To investigate CYP1B1 gene mutations in Spanish patients with ocular hypertension (OHT) or primary open
angle glaucoma (POAG).
Methods: The two coding exons of CYP1B1 were screened for sequence alterations by direct PCR DNA sequencing in 37
and 82 unrelated Spanish subjects diagnosed with OHT and POAG, respectively. As a control we used a group of 93
subjects from whom OHT or glaucoma were ruled out.
Results: We found three different predicted amino acid substitutions (Ala189Pro, Ala330Ser, and Ala443Gly) in three
(8.1%) OHT subjects, and seven different mutations (Ser28Trp, Gly61Glu, Tyr81Asn, Gln144His, Arg145Trp, Glu229Lys,
and Val409Phe) in nine (10.9%) glaucoma patients. These sequence variations showed higher frequencies in cases than in
controls (as recently reported in French patients). They are predicted to produce a significant change in the amino acid
sequence and affect conserved regions of the protein. All these missense mutations were found as heterozygots. In addi-
tion, four of them have been previously found in PCG and/or POAG patients, whereas the other six mutations (Ser28Trp,
Gln144His, Arg145Trp, Ala189Pro, Ala330Ser, and Val409Phe) have not been previously described. Clinically, these
mutations are associated with an age at diagnosis ranging from 12 to 58 years (mean 34.3 years) and from 48 to 77 years
(mean 59.9 years) among OHT and glaucoma patients, respectively.
Conclusions: Heterozygous CYP1B1 mutations could confer increased susceptibility to the development of POAG in the
Spanish population.
Correspondence to: Dr. Julio Escribano, Área de Genética, Facultad
de Medicina, Avda. de Almansa 14, 02006 Albacete, Spain; Phone:
+34 967 599200, ext. 2928; FAX: +34 902 204130; email:
julio.escribano@uclm.es
748

Page 2

©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
mmHg on two or more occasions in the absence of a field
defect and open angles on gonioscopy, with no history of angle
closure and absence of any ocular disease contributing to the
elevation of pressure. All the following conditions were re-
quired to diagnose POAG: exclusion of secondary causes (e.g.,
trauma, uveitis, steroid-induced- or neovascular glaucoma);
open anterior chamber angle (grade III-IV gonioscopy); IOP
higher than 21 mmHg in the absence of medication, charac-
teristic optic disc changes (e.g., vertical cup-to-disc ratio higher
than 0.3); and an alteration of the visual field, tested by auto-
mated perimetry (with Humphrey’s perimeter). The global
indices such as mean deviation (MD) and pattern standard
deviation (PSD) of the baseline visual fields were analyzed
for all cases. Some patient’s partners who did not have glau-
coma were also included in the study as control subjects (42.8%
of controls). Other unrelated controls were recruited from pa-
tients who attended the clinic for conditions other than glau-
coma, including cataracts, floaters, refractive errors, and itchy
eyes. All study subjects underwent a complete ocular exami-
nation. The study protocol was approved by the Ethics Com-
mittee for Human Research of the Albacete University Hospi-
tal, and followed the tenets of the Declaration of Helsinki.
Informed consents were obtained from all the study subjects.
Patients were classified as having early (MD better than -
6 dB), moderate (MD between -6 and -12 dB), or severe (MD
worse than -12 dB) visual field alteration, according to the
classification by Hodapp et al. [14]. Medical treatment included
primarily topical beta-blockers and prostaglandin.
Mutation screening: Genomic DNA was extracted from
the peripheral leukocytes of all subjects with the Perfect gDNA
Blood Mini kit (Eppendorf, Madrid, Spain) according to the
manufacturer’s protocol. The translated genomic regions of
the CYP1B1 gene (exons II and III) were PCR amplified in
three different fragments using primers shown in Table 1. The
exon I and the promoter region of CYP1B1 (-1 to -867) were
also amplified in all carriers of CYP1B1 mutations, using
intronic primers designed to allow analysis of splicing con-
sensus sequences (Table 1). PCRs were performed in a 50 µl
volume containing 50-100 ng of genomic DNA, 20 pmol of
forward and reverse primers, 2 mM MgCl2, 200 µM of each
dNTP, and 1 U of Taq DNA polymerase (Biotools, Madrid,
Spain). Dimethylsulfoxide (10%) was added to reactions per-
formed with primer sets 1 and 2. Thermocycling included an
initial denaturation step at 94 °C for 4 min, followed by 35
cycles of denaturation, annealing and extension (Table 1). A
final cycle was performed at 72 °C for 7 min. Terminator cycle
sequencing was carried out using the BigDye® (version 3.1)
kit (Applied Biosystems, Foster City, CA) and the products of
sequencing reactions were analyzed in an automated capillary
DNA sequencer (ABI Prism 3100-Avant genetic analyzer,
Applied Biosystems, Foster City, CA).
Statistical analysis: Significance of the difference in sex
and mutation proportions between patients and control sub-
jects was determined by χ2 test when all expected values were
5 or more, and Fisher’s exact test was used when expected
values were less than 5. Significance of difference in age, IOPs
and C/D ratios among the different groups of subjects was
determined by the t-test. Data were statistically treated by us-
ing SigmaStat 2.0 software (SPSS Inc., Chicago, IL).
RESULTS
Phenotype of patients: A total of 119 unrelated cases were
investigated, comprised of 37 persons diagnosed with OHT
and 82 with POAG. The control group included 93 individu-
als from whom glaucoma was ruled out. Table 2 shows the
main clinical features of these subjects. The three groups were
homogeneous with respect to age, gender, and iridocorneal
angle. The two groups of patients were under medical treat-
ment to reduce IOP, therefore their IOP mean values were
below 21 mmHg. The mean intraocular pressure and C/D ra-
tios in both eyes of OHT and POAG patients were signifi-
cantly higher than in controls (Table 2). The visual field status
among POAG patients was severe in 18 (10.9%) eyes, moder-
ate in 43 (26.21%) eyes, early in 83 (50.6%) eyes, normal in
14 (8.5%) eyes, and in six eyes (3.6%) from six different pa-
tients the visual field could not be determined. The normal
eyes were from 14 patients (17%) who showed monolateral
visual field alterations. No visual field damage was detected
in OHT patients.
Identification of CYP1B1 mutations and genotype-phe-
notype correlation: Genomic DNA from each individual in-
cluded in the study was screened for mutations in the two cod-
ing exons of the CYP1B1 gene by direct PCR sequencing. As
a first approach, sequence variations were classified as dis-
ease-causing mutations when they met any of the following
criteria: (1) presence of a predicted amino acid substitution
altering the physicochemical or structural properties of the
CYP1B1 polypeptide chain in at least one OHT or glaucoma
patient, and an absence of the change in the control group,
and/or (2) previous report of the sequence variation being in-
volved in glaucoma.
Our analysis revealed 10 different heterozygous muta-
tions among the two groups of patients (Table 3). These muta-
tions were detected in three (8.1%) OHT and nine (10.9%)
POAG cases.
Location of the predicted amino acid changes in the cod-
ing region of the gene is shown in Figure 1. The existence of
additional mutations in exon 1, in the promoter region of
CYP1B1 (-1 to -867), and in the coding regions of MYOC and
OPTN of these patients were ruled out by direct PCR sequenc-
ing (data not shown). Mutations Gly61Glu, Tyr81Asn,
Glu229Lys, and Ala443Gly were previously reported in glau-
coma cases, as will be discussed later. As far as we know, our
study is the first to identify the remaining six mutations. Mu-
tations Ala189Pro, Ala330Ser, and Ala443Gly were identified
in three OHT individuals, whose ages at diagnosis were 12,
58, and 33 years, respectively (mean, 34.3 years), and showed
bilateral elevated IOP values, ranging from 16 to 20 mmHg
with medical treatment (Table 3). Since this is a retrospective
study IOP values without treatment were not always avail-
able. The correct control of IOP required more than one drug
in two of these patients (6 and 99) who additionally showed
cup:disc ratios higher than 0.5, after at least 12 and four years
of evolution, respectively (Table 3). Patient 99 had elevated
749

Page 3

IOP and altered C/D ratios, indicating that he is at risk of de-
veloping POAG.
Mutations Ser28Trp, Gly61Glu, Tyr81Asn, Gln144His,
Arg145Trp, Glu229Lys, and Val409Phe were identified in
POAG patients who, in general, required two or three drugs
for appropriate control of IOP. In addition, patient 128, who
carried mutation Val409Phe, showed the most severe pheno-
type identified in this study, characterized by intense bilateral
visual field alteration, a high cup:disc ratio (0.8), and resis-
tance to medical treatment of IOP, necessitating surgery (Table
3). Interestingly, the mean IOP value with medical treatment
among POAG patients who carried CYP1B1 mutations
(18.8±2.2 mm Hg) was higher than among noncarriers
(17.2±3.3 mmHg; p=0.047). No differences in C/D ratios were
found between these two POAG groups (Table 3). The most
prevalent mutation found in this study was Tyr81Asn. It was
detected in three POAG patients (patients 5, 11, and 115; Table
3). In addition, this mutation was identified in two subjects
(patients 63 and 84) who presented no visual field alterations
but showed C/D ratios out of the normal range, with normal
optic disc sizes, at ages of 42 and 44 years (Table 3). They
were classified as glaucoma suspects. We also found an indi-
vidual with no visual defects (66 years old) carrying the novel
variation Pro52Leu (Table 3).
Evaluation of mutated positions by multiple sequence
alignment: Cytochrome P450s possess a well conserved ter-
tiary structure. Therefore, to locate mutations in the different
structural domains of the family, we compared the amino acid
sequences of some mammalian CYP1B1 enzymes and two
well characterized members of the CYP1A subfamily
(CYP1A1 and CYP1A2; Figure 2).
Mutations previously reported in glaucoma were posi-
tioned three amino acids downstream from the hinge region
(Gly61Glu); in the A helix, which could form the substrate
access channel (Tyr81Asn); in the substrate recognition site 2
(SRS-2; Glu229Lys), and in the meander involved in heme-
thiolate ligand binding (Ala443Gly; Figure 2). On the other
hand, the novel mutations were located in the transmembrane
©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
TABLE 1.
Annealing
Primer sequence (5'->3') temperature/
Primer ---------------------------------------------------- time Extension
set Region Forward Reverse (°C/s) time (s)
------ -------- --------------------------- ---------------------- ------------ ---------
1 Exon II TCTCCAGAGAGTCAGCTCCG GGGTCGTCGTGGCTGTAG 57/ 5 45
2 Exon II ATGGCTTTCGGCCACTACT CGATCTTGGTTTTGAGGGGTG 57/ 5 45
3 Exon III AATAAGAATTTTGCTCACTTGCTTTTC AGCAGCACAAAAGAGGAACTGG 61/20 40
4 Promoter ATGACTGGAGCCGACTTTCC GCAAAGTCGAGGTTTCCTCACA 58/20 50
5 Exon I CCTCCTTCTACCCAGTCCTTAAAA TAAAGTACCTACCACGCCACCC 57/20 20
Oligonucleotide primers used for amplification of the CYP1B1 gene
TABLE 2.
OHT POAG
OHT POAG Control versus versus
Variable (n=37) (n=82) (n=93) control control
------------- --------- --------- --------- ------- -------
Age in years 56.0±11.7 62.7±11.0 59.6±12.3 0.130 0.085
(mean±SD)
Female (%) 18 (48.6) 37 (45.2) 53 (57.0) 0.334 0.095
Male (%) 19 (51.4) 45 (54.8) 40 (43.0)
IOP (mean±SD;
mmHg)
OD: 17.7± 3.9 17.5± 3.3 15.2± 3.0 <0.001 <0.001
OS: 17.9± 4.5 17.0± 3.1 15.2± 3.1 <0.001 <0.001
Iridocorneal 3.9 3.9 3.9 - -
angle (mean)
C/D (mean±SD)
OD: 0.3± 0.2 0.4± 0.2 0.2± 0.2 0.006 <0.001
OS: 0.3± 0.2 0.4± 0.2 0.2± 0.2 0.008 <0.001
Clinical characteristics of participants in the study. Since this is a retrospective study, intraocular pressure (IOP) values before medical treat-
ment were not always available. The variable “Age in years” indicates the age at the time of the study. In the table, SD indicates standard
deviation; and C/D indicates cup-disc ratio of optic nerve.
750

Page 4

anchor region (Ser28Trp), the hinge region (Pro52Leu), helix
C (Gln144His and Arg145Trp), β3-1-sheet (Ala189Pro), I helix
(Ala330Ser), and β2-1-sheet (Val409Phe; Figure 2).
All mutations affected conserved amino acid residues and
altered the predicted physicochemical properties of the
polypeptide chain, as follows. The amino acid residue Ser28
is conserved in the three mammalian CYP1B1 proteins ana-
lyzed (Figure 2), and its substitution for the bulky and nonpo-
lar side chain of Trp, could alter the hydrophobicity of the
transmembrane domain. Curiously, the predicted amino acid
change Pro52Leu was found in a normal subject who was 66
years old at the time of the study. This amino acid residue
matches the second Pro of the conserved sequence Pro-Pro-
Gly-Pro (Figure 2) and therefore the nonconservative substi-
tution bears the potential to affect the function of the protein.
It has been reported that substitutions of the first and last Pro
of this sequence for Ala diminish enzyme activity of cyto-
chrome P450 2C2, but mutations of the second Pro have little
effect on the enzyme activity [15]. Whether this is a disease-
causing mutation with incomplete penetrance or just a rare
variant remains to be investigated.
©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
Figure 1. Gene structure of CYP1B1 and
location of identified glaucoma muta-
tions. The three exons are represented by
boxes, and the conserved structural do-
mains encoded by them are depicted by
different patterns and colors as explained
in the legend. Novel mutations are indi-
cated by bold face type. All mutations are
defined in terms of the one-letter code.
TABLE 3.
Age at
Amino Age at time of IOP C/D Treatment
Nucleotide acid Subject diagnosis study (mmHg; VFA Ratio (number
change change number Phenotype (years) (years) OD/OS) (OD/OS) (OD/OS) of drugs)
---------- ------ ------- --------- --------- ------- ------ ---------- ------- ---------
c.936G>C A189P* 99 OHT 12 24 20/20 N/N 0.9/0.8 3
c.1359G>T A330S* 6 OHT 58 62 18/18 N/N 0.5/0.8 2
c.1699C>G A443G 114 OHT 33 38 16/20 N/N 0.2/0.2 1
c.454C>G S28W* 62 POAG 59 65 20/20 E/N 0.7/0.7 2
c.553G>A G61E 89 POAG 65 67 17/17 E/E 0.3/0.3 1
c.612T>A Y81N 5 POAG 77 80 22/22 M/M 0.7/0.7 2
c.612T>A Y81N 11 POAG 49 54 17/17 E/E ND/ND 1
c.612T>A Y81N 115 POAG 58 61 22/20 E/M 0.5/0.3 2
c.803G>T Q144H* 80 POAG 58 67 18/16 ND/M ND/ND 3
c.804C>T R145W* 80 POAG 58 67 18/16 ND/M ND/ND 3
c.1056G>A E229K 107 POAG 66 80 18/18 E/N 0.5/0.4 1
c.1056G>A E229K 127 POAG 48 52 20/21 E/E 0.7/0.7 1
c.1596G>T V409F* 128 POAG 61 67 20/14 S/S 0.8/0.8 2+surgery
c.612T>A Y81N 63 POAG SUS - 42 12/12 N/N 0.6/0.6 0
c.612T>A Y81N 84 POAG SUS - 44 13/13 N/N 0.5/0.6 0
c.526C>T P52L* 86 Normal - 66 16/15 N/N ND/ND 0
CYP1B1 genotype-phenotype correlations in patients with OHT, POAG, and control subjects. All mutations are heterozygous. The CYP1B1
GenBank accession number is NM_000104. The IOP values are with medical treatment. Since this is a retrospective study, IOP values before
treatment were not always available. The asterisk indicates novel mutations. In the table, POAG SUS indicates POAG suspect; IOP indicates
intraocular pressure; OD indicates right eye; OS indicates left eye; VFA indicates visual field alteration; C/D indicates cup-disc ratio of optic
nerve; N indicates normal; E indicates early; M indicates moderate; S indicates severe; and ND indicates not determined due to oblique
insertion of the optic nerve head.
751

Page 5

©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
Figure 2. Multiple amino acid sequence alignment of CYP1B1, CYP1A1, and CYP1A2 from different species. Sequence alignment was
generated by ClustalW. Residues affected by mutations are indicated by arrows. Different structural domains of the cytochrome P450 super-
family are boxed. Pro-Pro-Gly-Pro, Pro-X-Arg/His, and X-G motives are indicated by black, white, and red rectangles below the sequences,
respectively. The invariant cysteine residue in the heme-binding region is denoted by an arrowhead. Asterisks represent amino acid positions
at which all query sequences are identical. Amino acid positions at which all analyzed sequences have amino acids that are chemically similar
are denoted by colons (:). One dot denotes amino acid positions with weak chemical similarity. Novel mutations are indicated by bold face
type.
Figure 3. Pedigrees of two cases diagnosed with POAG and 1 case diagnosed with OHT. The genotypes, ages (years) at the time of the study,
IOP (mmHg OD/OS), and C/D ratios (OD/OS) are indicated below the symbols. The arrows show the probands. Black and red symbols
indicate POAG and OHT phenotypes, respectively.
752

Page 6

The two novel contiguous sequence variations, Gln144His
and Arg145Trp, were found in the same patient. We were un-
able to determine whether they were placed on the same or in
different chromosomes. The amino acid residue 144 was ei-
ther Gln or Arg in the polypeptide chains of the aligned cyto-
chrome P450 molecules, while the adjacent Arg145 residue
remained conserved (Figure 2). A comparison of amino acid
residue 144 in different species showed a His residue in some
of them (data not shown), indicating that the Gln144His sub-
stitution does not impair enzyme activity. Therefore, we con-
sidered that this substitution could represent a rare normal
variant of the protein, although this point requires additional
verification. In contrast, mutation Arg145Trp, holds the po-
tential to impair the active site, since the side chain of this
conserved Arg is involved in heme propionate coordination
[16].
Mutation Ala189Pro could disrupt the structure of the β3-
1 sheet, whereas Ala330Ser could impair the activity of
CYP1B1 since it affects a conserved amino acid potentially
involved in the catalytic mechanism of the enzyme [17] (Fig-
ure 2). A different pathogenic mutation affecting amino acid
330 (Ala330Phe) has been reported in PCG patients [18,19].
Finally, mutation Val409Phe affects a conserved aliphatic resi-
due and introduces a large and aromatic amino acid in the
mutant protein (Figure 3).
Rate of CYP1B1 mutations: As all the nonconservative
mutations are presumably injurious to the function of the pro-
tein, we compared the total frequency of these mutations be-
tween cases and controls. A similar approach has previously
been followed to analyze the association of MYOC and
CYP1B1 mutations with POAG [3,12]. The CYP1B1 muta-
tion rate is significantly increased in POAG patients (10.9%
in POAG compared to 1% in controls; Fisher’s exact test,
p=0.011). The two glaucoma suspects were not included in
this calculation. A similar result was obtained comparing the
percentage of CYP1B1 heterozygotes found in this study with
the expected frequency for heterozygotes in the Spanish popu-
lation (approximately 1%), which was estimated based on the
prevalence of PCG in Spain (2.85 10-5) [20], and assuming
that the population is in Hardy-Weinberg equilibrium [12].
This is in accordance with a previous report in French pa-
tients [12], and also supports the role of the identified muta-
tions in the development of POAG. In any event, larger groups
of patients should be studied to confirm these data.
POAG in families with CYP1B1 mutations: To test for
cosegregation of POAG with CYP1B1 mutations we were able
to study families of 2 POAG and 1 OHT cases (Figure 3).
POAG patient 5 had two daughters heterozygous for the
Tyr81Asn mutation (II:1 and II:3), who showed IOPs higher
than those of their non carrier brother (II:2). In addition, the
oldest Tyr81Asn carrier (II:1), had C/D ratios out of the nor-
mal range. The optic excavation of sibling II:2 was consid-
ered physiologic, since it was associated with a large optic
disc and a normal visual field.
POAG patient 89 had a 41-year-old son carrying the mu-
tation Gly61Glu as a heterozygote (II:1), who was diagnosed
with bilateral OHT and required medical treatment. Although
his visual fields and optic discs were normal, he was consid-
ered a glaucoma suspect. His noncarrier siblings (II:2 and II:3)
had normal IOPs.
OHT patient 6 had two daughters who were dizygotic
twins (II:2 and II:3). One of them (II:3) was heterozygous for
the novel mutation Ala330Ser, and presented higher IOPs and
optic nerve excavations than her noncarrier twin. Sibling II:1
was also a heterozygous carrier with normal IOP. However he
presented disc excavations out of the normal range, associ-
ated with the normal size of the optic discs.
Patient 127’s family was also studied. The mutant allele
was absent in his offspring (data not shown), but he reported
that his mother had glaucoma. Although she could not be ex-
amined, we considered that this data also indicate the patho-
genicity of mutation E229K.
DISCUSSION
Studies in different populations are required to clearly sup-
port the role of candidate genes in complex diseases, such as
POAG. We herein show for the first time an increased propor-
tion of heterozygous CYP1B1 mutations in Spanish POAG
(10.9%) and OHT (8.1%) cases. Previous population studies
have also found carriers of heterozygous CYP1B1 mutations
in POAG patients from France (4.6%, n=236) [12] and Canada
(5%, n=60) [11]. French cases showed a median age of 40
years at diagnosis (range 13-52). In our study this age was
59.9 years (range 48-77). This discrepancy could be due to
differences in either the etiology of the disease or in the man-
agement of patients. The median age at diagnosis in the Cana-
dian study was 23.6 years (range 8-36), reflecting that it was
performed with early-onset glaucoma patients. Three reasons
prompted us to analyze the presence of CYP1B1 mutations
among OHT subjects: (1) elevated IOP is one of the major
risk factors for the development of glaucomatous visual loss
[21]; (2) it is the main clinically treatable factor; and (3) high
IOP was used as a criterion for diagnosis of POAG. Therefore
in all these patients OHT likely was the first stage of the dis-
ease. Since the three OHT subjects who carried CYP1B1 mu-
tations were under medical prophylactic treatment with ocu-
lar drops, and two were younger than 40 years, we considered
that they were glaucoma suspects who would develop the dis-
ease without the proper treatment. Overall these data suggest
the role of CYP1B1 mutations in IOP-raising.
Four of the reported mutations (Gly61Glu, Tyr81Asn,
Glu229Lys, and Ala443Gly) have been found previously in
patients with POAG and/or PCG. One of the interesting find-
ings of this study was that all mutations were present in het-
erozygosis. Heterozygous CYP1B1 mutations have been pre-
viously reported both in early-onset and primary congenital
glaucoma. For instance, mutation Gly61Glu cosegregates with
PCG in different populations [9,22-26] and it has been identi-
fied in heterozygous subjects with early-onset POAG from
Morocco [9]. In addition, mutation Tyr81Asn was previously
reported in heterozygous early-onset POAG patients from
France [12]. It is interesting that this mutation is the most preva-
lent one in our study and that it has been previously reported
only in two unrelated heterozygous French Caucasian patients
©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
753

Page 7

diagnosed with POAG [12]. Whether Tyr81Asn is specifically
associated to POAG either as a major genetic factor or as a
modifier variant remains to be investigated. In the same way,
the amino acid change Glu229Lys has been observed in In-
dian and French PCG cases in heterozygosis [10,25,26] as well
as in compound heterozygotes [24,27]. Some French patients
with POAG are also heterozygous for this mutation [12]. Fi-
nally, mutation Ala443Gly has been described in heterozygo-
sis in one PCG patient from Brazil [28], and in POAG pa-
tients from France [12]. Introduction of these mutations in
our population by recent migrations is unlikely since all ana-
lyzed individuals were native Spanish, living in Spain for at
least four generations.
The identification of 10 different CYP1B1 mutations in
the two groups of patients shows the allelic heterogeneity of
this gene. Different pathogenic alleles of MYOC and OPTN
genes have also been described in POAG. We evaluated the
effect of CYP1B1 gene variations on the predicted protein se-
quence. Mutations considered pathogenic in this study origi-
nated nonconservative amino acid changes and affected con-
served residues located in structural domains of the protein,
holding the potential to reduce the enzyme activity by mecha-
nisms such as the following: (1) incorrect insertion of the pro-
tein in the ER membrane (Ser28Trp); (2) alteration of folding
and protein stability (Gly61Glu, Ala189Pro, and Val409Phe);
(3) modification of substrate binding (Tyr81Asn and
Glu229Lys); and (4) impairment of the active center
(Arg145Trp, Ala330Ser, and Ala443Gly).
In an effort to confirm the pathogenicity of these muta-
tions, we were able to analyze the cosegregation of four of
them (Gly61Glu, Tyr81Asn, Glu229Lys, and Ala330Ser) with
POAG in three families or OHT in one family, respectively.
Our conclusions were limited by the fact that most of the fam-
ily members examined were younger than 40 years old. How-
ever, we detected some heterozygous carriers who showed
phenotypic features suspicious of glaucoma, further suggest-
ing the role of these sequence changes in the disease.
Although the results presented in this study provide the
first evidence for the association of CYP1B1 mutations with
POAG in the Spanish population, the size of the samples does
not allow a final conclusion. Further investigations are required
to confirm these findings.
To explain our findings, we have hypothesized that at least
certain CYP1B1 mutations could determine the onset of the
glaucoma phenotype. In this regard, it is well established that
homozygous mutations cause congenital glaucoma. Heterozy-
gous mutations might originate a milder glaucoma phenotype
characterized by an adult onset. This can be due to
haploinsufficiency and/or to the influence of modifier genes.
In this regard, it could be possible that the overall enzymatic
activity of these heterozygotes is reduced below a “normal”
threshold, increasing the susceptibility to POAG. Concerning
modifier genes, we have ruled out the presence of mutations
in coding regions of MYOC and OPTN genes of heterozygous
patients (unpublished data). In addition, mutations in the pro-
moter region and exon I of CYP1B1 were not detected. De-
tailed analysis of the genotype, biochemical, and clinical phe-
notypes, of the different CYP1B1 pathogenic mutations, as
well as search of other modifier genes and population analy-
sis of larger number of individuals are required to unravel the
role of this gene in POAG.
The proportion of POAG patients with CYP1B1 muta-
tions (10.9%) in our sample is around three times higher than
that of carriers of MYOC mutations (data not shown), high-
lighting the role of CYP1B1 in POAG. Further studies with
larger samples and different populations are required to pre-
cisely define the role of CYP1B1 sequence variations in POAG.
During revision of this manuscript, a paper entitled “Pri-
mary role of CYP1B1 in Indian juvenile-onset POAG patients”
by Acharya et al. [29] appeared in Molecular Vision. They
screened CYP1B1 mutations in 200 unrelated POAG patients
comprising 156 sporadic and 44 familial cases. It was found
that eight patients (4.0%) carried heterozygous mutations in
CYP1B1 and one patient (0.5%) was homozygous. Six of the
heterozygous patients were sporadic glaucoma cases and two
had a history of the disease in their families. One of these
mutations is the same as we identified in Spanish patients
(E229K). Overall the results of this paper further support the
role of heterozygous CYP1B1 mutations in POAG.
ACKNOWLEDGEMENTS
We thank Dr. Juan López-Moya, Chairman of the “Servicio
de Oftalmología, Complejo Hospitalario Universitario de
Albacete” and Dr. Ricardo Fraile-Fresno for supporting this
project. We also thank Mrs. Ana María Alonso and Mrs.
Carmen Cifuentes for technical assistance, and the nurses of
the “Servicio de Oftalmología” for extracting blood samples.
We wish to cordially thank patients, their relatives, and con-
trol subjects for their cooperation in the study. Supported in
part by research grants PI052494, SAF2002-03086, 02021-
00, and PAI-02-049 from the “Fondo de Investigaciones
Sanitarias”, “Ministerio de Ciencia y Tecnología”,
“Consejeríade Sanidad” and “Consejeria de Ciencia y
Tecnología de la Junta de Comunidades de Castilla-La
Mancha”, respectively (to JE); and by NIH grant EY04873
and a Research to Prevent Blindness Lew Waserman Merit
Award (to MC-P). María-Pilar López-Garrido and J. Daniel
Aroca-Aguilar are recipients of fellowships from the
“Consejería de Sanidad de la Junta de Comunidades de
Castilla-La Mancha”.
REFERENCES
1. Quigley HA, Nickells RW, Kerrigan LA, Pease ME, Thibault DJ,
Zack DJ. Retinal ganglion cell death in experimental glaucoma
and after axotomy occurs by apoptosis. Invest Ophthalmol Vis
Sci 1995; 36:774-86.
2. Stone EM, Fingert JH, Alward WL, Nguyen TD, Polansky JR,
Sunden SL, Nishimura D, Clark AF, Nystuen A, Nichols BE,
Mackey DA, Ritch R, Kalenak JW, Craven ER, Sheffield VC.
Identification of a gene that causes primary open angle glau-
coma. Science 1997; 275:668-70.
3. Fingert JH, Heon E, Liebmann JM, Yamamoto T, Craig JE, Rait J,
Kawase K, Hoh ST, Buys YM, Dickinson J, Hockey RR, Will-
iams-Lyn D, Trope G, Kitazawa Y, Ritch R, Mackey DA, Alward
WL, Sheffield VC, Stone EM. Analysis of myocilin mutations
©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
754

Page 8

in 1703 glaucoma patients from five different populations. Hum
Mol Genet 1999; 8:899-905.
4. Rezaie T, Child A, Hitchings R, Brice G, Miller L, Coca-Prados
M, Heon E, Krupin T, Ritch R, Kreutzer D, Crick RP, Sarfarazi
M. Adult-onset primary open-angle glaucoma caused by muta-
tions in optineurin. Science 2002; 295:1077-9.
5. Monemi S, Spaeth G, DaSilva A, Popinchalk S, Ilitchev E,
Liebmann J, Ritch R, Heon E, Crick RP, Child A, Sarfarazi M.
Identification of a novel adult-onset primary open-angle glau-
coma (POAG) gene on 5q22.1. Hum Mol Genet 2005; 14:725-
33.
6. Stoilov I, Akarsu AN, Sarfarazi M. Identification of three different
truncating mutations in cytochrome P4501B1 (CYP1B1) as the
principal cause of primary congenital glaucoma (Buphthalmos)
in families linked to the GLC3A locus on chromosome 2p21.
Hum Mol Genet 1997; 6:641-7.
7. Libby RT, Smith RS, Savinova OV, Zabaleta A, Martin JE,
Gonzalez FJ, John SW. Modification of ocular defects in mouse
developmental glaucoma models by tyrosinase. Science 2003;
299:1578-81.
8. Martin SN, Sutherland J, Levin AV, Klose R, Priston M, Heon E.
Molecular characterisation of congenital glaucoma in a consan-
guineous Canadian community: a step towards preventing glau-
coma related blindness. J Med Genet 2000; 37:422-7.
9. Belmouden A, Melki R, Hamdani M, Zaghloul K, Amraoui A,
Nadifi S, Akhayat O, Garchon HJ. A novel frameshift founder
mutation in the cytochrome P450 1B1 (CYP1B1) gene is asso-
ciated with primary congenital glaucoma in Morocco. Clin Genet
2002; 62:334-9.
10. Colomb E, Kaplan J, Garchon HJ. Novel cytochrome P450 1B1
(CYP1B1) mutations in patients with primary congenital glau-
coma in France. Hum Mutat 2003; 22:496.
11. Vincent AL, Billingsley G, Buys Y, Levin AV, Priston M, Trope
G, Williams-Lyn D, Heon E. Digenic inheritance of early-onset
glaucoma: CYP1B1, a potential modifier gene. Am J Hum Genet
2002; 70:448-60.
12. Melki R, Colomb E, Lefort N, Brezin AP, Garchon HJ. CYP1B1
mutations in French patients with early-onset primary open-angle
glaucoma. J Med Genet 2004; 41:647-51.
13. Melki R, Lefort N, Brezin AP, Garchon HJ. Association of a com-
mon coding polymorphism (N453S) of the cytochrome P450
1B1 (CYP1B1) gene with optic disc cupping and visual field
alteration in French patients with primary open-angle glaucoma.
Mol Vis 2005; 11:1012-7.
14. Hodapp E, Parrish RK, Anderson DR. Clinical decisions in glau-
coma. St. Louis: Mosby; 1993.
15. Chen CD, Kemper B. Different structural requirements at spe-
cific proline residue positions in the conserved proline-rich re-
gion of cytochrome P450 2C2. J Biol Chem 1996; 271:28607-
11.
16. Williams PA, Cosme J, Vinkovic DM, Ward A, Angove HC, Day
PJ, Vonrhein C, Tickle IJ, Jhoti H. Crystal structures of human
cytochrome P450 3A4 bound to metyrapone and progesterone.
Science 2004; 305:683-6.
17. Truan G, Peterson JA. Thr268 in substrate binding and catalysis
in P450BM-3. Arch Biochem Biophys 1998; 349:53-64.
18. Mashima Y, Suzuki Y, Sergeev Y, Ohtake Y, Tanino T, Kimura I,
Miyata H, Aihara M, Tanihara H, Inatani M, Azuma N, Iwata T,
Araie M. Novel cytochrome P4501B1 (CYP1B1) gene muta-
tions in Japanese patients with primary congenital glaucoma.
Invest Ophthalmol Vis Sci 2001; 42:2211-6. Erratum in: Invest
Ophthalmol Vis Sci 2001; 42:2775.
19. Ohtake Y, Tanino T, Suzuki Y, Miyata H, Taomoto M, Azuma N,
Tanihara H, Araie M, Mashima Y. Phenotype of cytochrome
P4501B1 gene (CYP1B1) mutations in Japanese patients with
primary congenital glaucoma. Br J Ophthalmol 2003; 87:302-
4.
20. Bermejo E, Martinez-Frias ML. Congenital eye malformations:
clinical-epidemiological analysis of 1,124,654 consecutive births
in Spain. Am J Med Genet 1998; 75:497-504.
21. Kass MA, Heuer DK, Higginbotham EJ, Johnson CA, Keltner
JL, Miller JP, Parrish RK 2nd, Wilson MR, Gordon MO. The
Ocular Hypertension Treatment Study: a randomized trial de-
termines that topical ocular hypotensive medication delays or
prevents the onset of primary open-angle glaucoma. Arch
Ophthalmol 2002; 120:701-13; discussion 829-30.
22. Stoilov I, Akarsu AN, Alozie I, Child A, Barsoum-Homsy M,
Turacli ME, Or M, Lewis RA, Ozdemir N, Brice G, Aktan SG,
Chevrette L, Coca-Prados M, Sarfarazi M. Sequence analysis
and homology modeling suggest that primary congenital glau-
coma on 2p21 results from mutations disrupting either the hinge
region or the conserved core structures of cytochrome P4501B1.
Am J Hum Genet 1998; 62:573-84.
23. Bejjani BA, Lewis RA, Tomey KF, Anderson KL, Dueker DK,
Jabak M, Astle WF, Otterud B, Leppert M, Lupski JR. Muta-
tions in CYP1B1, the gene for cytochrome P4501B1, are the
predominant cause of primary congenital glaucoma in Saudi
Arabia. Am J Hum Genet 1998; 62:325-33.
24. Panicker SG, Reddy AB, Mandal AK, Ahmed N, Nagarajaram
HA, Hasnain SE, Balasubramanian D. Identification of novel
mutations causing familial primary congenital glaucoma in In-
dian pedigrees. Invest Ophthalmol Vis Sci 2002; 43:1358-66.
25. Reddy AB, Kaur K, Mandal AK, Panicker SG, Thomas R, Hasnain
SE, Balasubramanian D, Chakrabarti S. Mutation spectrum of
the CYP1B1 gene in Indian primary congenital glaucoma pa-
tients. Mol Vis 2004; 10:696-702.
26. Panicker SG, Mandal AK, Reddy AB, Gothwal VK, Hasnain SE.
Correlations of genotype with phenotype in Indian patients with
primary congenital glaucoma. Invest Ophthalmol Vis Sci 2004;
45:1149-56.
27. Michels-Rautenstrauss KG, Mardin CY, Zenker M, Jordan N,
Gusek-Schneider GC, Rautenstrauss BW. Primary congenital
glaucoma: three case reports on novel mutations and combina-
tions of mutations in the GLC3A (CYP1B1) gene. J Glaucoma
2001; 10:354-7.
28. Stoilov IR, Costa VP, Vasconcellos JP, Melo MB, Betinjane AJ,
Carani JC, Oltrogge EV, Sarfarazi M. Molecular genetics of
primary congenital glaucoma in Brazil. Invest Ophthalmol Vis
Sci 2002; 43:1820-7.
29. Acharya M, Mookherjee S, Bhattacharjee A, Bandyopadhyay AK,
Daulat Thakur SK, Bhaduri G, Sen A, Ray K. Primary role of
CYP1B1 in Indian juvenile-onset POAG patients. Mol Vis 2006;
12:399-404.
©2006 Molecular Vision
Molecular Vision 2006; 12:748-55 <http://www.molvis.org/molvis/v12/a84/>
755
The print version of this article was created on 11 Jul 2006. This reflects all typographical corrections and errata to the article through that date.
Details of any changes may be found in the online version of the article. α