Cloning of Atlantic halibut growth hormone receptor genes and quantitative gene expression during metamorphosis.

Abstract

To gain insight into the possible regulatory role of the growth hormone (GH)-insulin-like growth factor I (IGF-I) system in flatfish metamorphosis, body GHR gene expression as well as IGF-I protein content was quantified in larval Atlantic halibut throughout metamorphosis (developmental stages 5-10). The cDNA of the full-length GH receptor (hhGHR) was cloned from adult liver and characterized. The hhGHR shows common features of a GHR, including a (Y/F)GEFS motif in the extracellular domain, a single transmembrane region, and an intracellular domain containing a Box 1 and Box 2. Additionally, a truncated GHR (hhGHRtr), similar to turbot and Japanese flounder GHRtr, was cloned and sequenced. These sequences are highly similar to the full-length and truncated GHRs in turbot (89%/86%) and Japanese flounder (93%/91%) with lower identity with other fish type I GHR (81%) and type II GHRs (58%). A quantitative real-time RT-PCR assay was used to measure hhGHR and hhGHRtr mRNA content in normally and abnormally metamorphosed individuals at six developmental stages, from early pre-metamorphosis to post-metamorphosis, when the fish is considered a juvenile. The level of hhGHR gene expression was highest at pre-metamorphic stage 6 and at stage 8 at the onset of metamorphosis, and then decreased during metamorphic climax and post-metamorphosis. Expression of hhGHRtr reached highest levels at stage 6 and then decreased to post-metamorphosis. The ratio of expression between the full-length and the truncated GHR (hhGHR:hhGHRtr) varied among stages and was highest at the onset of metamorphosis and at metamorphic climax. A radioimmunoassay was used to measure halibut IGF-I body content throughout metamorphosis. IGF-I increases from early metamorphosis to the onset of metamorphosis and then decreases towards post-metamorphosis. In comparison between normally and abnormally metamorphosing larvae, IGF-I content, hhGHR and hhGHRtr mRNA levels were reduced in the abnormal fish. These data indicate that the GH-IGF-I system either has a regulatory role in metamorphosis, or is being affected as a consequence of the abnormal metamorphosis.

Full text

Page 1

General and Comparative Endocrinology 151 (2007) 143–152
www.elsevier.com/locate/ygcen
0016-6480/$ - see front matter © 2006 Elsevier Inc. All rights reserved.
doi:10.1016/j.ygcen.2006.10.003
Cloning of Atlantic halibut growth hormone receptor genes
and quantitative gene expression during metamorphosis
Jon Hildahla,¤, Glen Sweeneyb, Malyka Galay-Burgosb, Ingibjörg Eir Einarsdóttira,
Björn Thrandur Björnssona
a Fish Endocrinology Laboratory, Department of Zoology/Zoophysiology, Göteborg University, Box 436, S-40530 Göteborg, Sweden
b CardiV School of Biosciences, CardiV University, Museum Avenue, PO Box 911, CardiV CF1 3US, United Kingdom
Received 20 April 2006; revised 6 October 2006; accepted 21 October 2006
Available online 1 December 2006
Abstract
To gain insight into the possible regulatory role of the growth hormone (GH)-insulin-like growth factor I (IGF-I) system in XatWsh
metamorphosis, body GHR gene expression as well as IGF-I protein content was quantiWed in larval Atlantic halibut throughout meta-
morphosis (developmental stages 5–10). The cDNA of the full-length GH receptor (hhGHR) was cloned from adult liver and character-
ized. The hhGHR shows common features of a GHR, including a (Y/F)GEFS motif in the extracellular domain, a single transmembrane
region, and an intracellular domain containing a Box 1 and Box 2. Additionally, a truncated GHR (hhGHRtr), similar to turbot and Jap-
anese Xounder GHRtr, was cloned and sequenced. These sequences are highly similar to the full-length and truncated GHRs in turbot
(89%/86%) and Japanese Xounder (93%/91%) with lower identity with other Wsh type I GHR (681%) and type II GHRs (658%). A
quantitative real-time RT-PCR assay was used to measure hhGHR and hhGHRtr mRNA content in normally and abnormally metamor-
phosed individuals at six developmental stages, from early pre-metamorphosis to post-metamorphosis, when the Wsh is considered a juve-
nile. The level of hhGHR gene expression was highest at pre-metamorphic stage 6 and at stage 8 at the onset of metamorphosis, and then
decreased during metamorphic climax and post-metamorphosis. Expression of hhGHRtr reached highest levels at stage 6 and then
decreased to post-metamorphosis. The ratio of expression between the full-length and the truncated GHR (hhGHR:hhGHRtr) varied
among stages and was highest at the onset of metamorphosis and at metamorphic climax. A radioimmunoassay was used to measure hal-
ibut IGF-I body content throughout metamorphosis. IGF-I increases from early metamorphosis to the onset of metamorphosis and then
decreases towards post-metamorphosis. In comparison between normally and abnormally metamorphosing larvae, IGF-I content,
hhGHR and hhGHRtr mRNA levels were reduced in the abnormal Wsh. These data indicate that the GH-IGF-I system either has a
regulatory role in metamorphosis, or is being aVected as a consequence of the abnormal metamorphosis.
© 2006 Elsevier Inc. All rights reserved.
Keywords: Atlantic halibut; Metamorphosis; Growth hormone; Growth hormone receptor; Insulin-like growth factor-I
1. Introduction
Growth hormone (GH) has multiple functions in Wsh, reg-
ulating skeletal and soft tissue growth and metabolism as
well as osmoregulation, reproduction and immune response
(see Reinecke et al., 2005). GH regulates physiological func-
tions either by acting directly on target tissue or by stimulat-
ing the hepatic production of insulin-like growth factor I
(IGF-I). IGF-I in turn stimulates tissue and skeletal growth
(see Kopchick and Andry, 2000). GH mediates its biological
eVects by binding to membrane receptors on target tissues,
initiating intracellular signaling pathways. GH receptor
(GHR) mRNA is expressed in many Wsh tissues, including
liver, muscle, fat, bone, kidney, brain, pancreas, spleen, gall
bladder, ovary, testis, esophagus, stomach, intestine, heart
and gills (Calduch-Giner et al., 2001; Fukada et al., 2004;
Kajimura et al., 2004; Lee et al., 2001; Nakao et al., 2004;
Tse et al., 2003; Very et al., 2005), further underlining the
*Corresponding author. Fax: +46 31 7733807.
E-mail address: jon.hildahl@zool.gu.se (J. Hildahl).

Page 2

144
J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
pluripotency of GH. A second form of the GHR with a trun-
cated intracellular domain is found in two XatWsh species,
turbot (Scophthalmus maximus, Calduch-Giner et al., 2001)
and Japanese Xounder (Paralichtys olivaceus, Nakao et al.,
2004), as well as in some mammalian species, including
human, rabbit, rat and mouse (see Edens and Talamantes,
1998). This receptor has been suggested to act as a domi-
nant–negative inhibitor of the full-length receptor and to
increase levels of GH binding protein (Calduch-Giner et al.,
2001). GHRs have been sequenced in over 20 teleost species,
but knowledge of the physiological signiWcance of GHR gene
expression during Wsh development is limited.
FlatWsh metamorphosis is a dynamic process involving
tissue remodeling and diVerentiation in addition to a vari-
ety of biochemical and physiological alterations mediated
by diVerential gene expression and endocrine regulation.
Thyroid hormones, cortisol, prolactin and sex steroids have
been shown to inXuence metamorphosis in the Japanese
Xounder (see de Jesus et al., 1993; Yamano and Miwa,
1998), but little is known about the potential physiological
role(s) of the GH-IGF-I system in this process. Although
ovine GH does not aVect in vitro or in vivo Wn ray shorten-
ing in Japanese Xounder metamorphosis, pituitary GH
mRNA increases throughout metamorphosis (de Jesus
et al., 1994). GH is sometimes indicated to act as a juvenile
hormone or antimetamorphic in amphibian metamorpho-
sis (Shintani et al., 2002; Takada and Kasai, 2003), but the
data are inconclusive (Bern et al., 1967; Huang and Brown,
2000; Wright et al., 1994). GH-containing somatotrophs are
found from an early premetamorphic stage in Atlantic hali-
but (Einarsdóttir et al., 2006a), and the pituitary GH con-
tent increases in proportion to size in metamorphosing
larvae (Einarsdóttir et al., 2006b) This, together with the
multifunctional role of GH in Wsh, which is to a high degree
closely linked to growth and developmental processes such
as salmon smoltiWcation (see Björnsson, 1997), makes it
likely that the GH-IGF-I system plays a physiological role
during Atlantic halibut metamorphosis.
Small larval size precludes studies of circulating hor-
mone in Wsh. Therefore, although GH is present in the pitu-
itary gland of larval halibut from early pre-metamorphic
stages (Einarsdóttir et al., 2006a and Einarsdóttir et al.,
2006b), it is unknown if the pituitary GH is being secreted
into the circulation during larval development and meta-
morphosis. In addition to hormone secretion, a critical pre-
requisite for the functionality of any endocrine system is
the presence of receptors in target tissues.
While the question of GH secretion cannot be
resolved, the aim of this study was to examine if GH
receptors are present in tissues, and thus to clarify if GH
could exert endocrine control during halibut metamor-
phosis. As a component of the GH-IGF-I system, IGF-I
production is down-stream from GH activation of its
receptor. Thus, assessment of IGF-I could give addi-
tional information about the activity of the GH-IGF-I
system during metamorphosis. To reach these aims, a
quantitative measure of GHR expression in halibut was
established by cloning both the full-length and the
truncated GHR forms. Their expression, as well as body
IGF-I protein content, was studied throughout the
metamorphic process.
Further, it was hypothesized that if the GH-IGF-I sys-
tem is of importance for the halibut metamorphic process,
GHR expression and IGF-I content will diVer between lar-
vae going through normal metamorphosis and larvae going
through abnormal/incomplete metamorphosis. To reach
this aim, each sampled larva was photographed, staged
according to Saele et al., 2004, and classiWed as normal or
abnormal.
2. Materials and methods
2.1. Tissue and larval sampling
The Atlantic halibut used in this study were obtained from Fiskey Ltd.,
a commercial halibut producer in Iceland. Liver used for mRNA extrac-
tion and GHR cloning was sampled from adult Wsh raised at the on-
growth site at Thorlakshöfn and stored in RNAlater (Ambion, Austin,
TX, USA) until RNA was isolated. Larvae for quantitative real time RT-
PCR analysis and IGF-I tissue content measurements were sampled from
industrial start-feeding tanks at the hatchery at Hjalteyri at diVerent stages
from Wrst feeding through metamorphosis. The larvae were sedated in
Metacain (Argent Laboratories, Redman, WA, USA) and staged accord-
ing to a staging scheme developed for Atlantic halibut (Saele et al., 2004).
Larvae sampled for PCR analysis were placed directly in RNAlater until
RNA was isolated. Larvae which were assigned for IGF-I radioimmuno-
assay (RIA) analysis were quickly frozen on dry ice and stored at ¡80°C
until analysis. Larvae from stages 8–10 were assessed for metamorphic
development. Larvae were considered abnormal when eye migration was
delayed or incomplete in relation to the staging scheme.
2.2. RNA isolation
Total RNA was isolated from 30mg of adult halibut liver using the
RNeasy spin column kit (Qiagen, Valencia, CA, USA), according to prod-
uct speciWcations. DNase treatment removed residual genomic DNA.
Agarose MOPS-gel electrophoresis determined the presence and quality of
RNA. Quantity and purity of RNA was assessed by the absorbance at 260
and 280nm and 260:280 ratios were 1.8–2.1.
2.3. Reverse transcription reaction
Two separate rapid ampliWcation of cDNA ends (RACE) cDNA pop-
ulations were synthesized; 5?-RACE-Ready cDNA and 3?-RACE-Ready
cDNA. The two 10 ?l reactions used 1?g total RNA, plus 1?l 5?CDS
primer and 1?l SMART II A oligo (5?-RACE-Ready cDNA) and 3?CDS
primer A and 1?l sterile water (3?-RACE-Ready cDNA). Both samples
were incubated 2 min at 70°C and cooled 2min on ice. Following the ini-
tial incubation, 2?l of 5£ Wrst-strand buVer, 1?l DTT (20mM), 1?l dNTP
mix (10mM) and 1?l PowerScript Reverse Transcriptase (Clonetech, Palo
Alto, CA, USA) were added and incubated 1.5 hr at 42°C. First-strand
products were diluted with 100?l Tricine–EDTA buVer and incubated for
7min at 72°C. The reactions were prepared in 200?l PCR tubes on ice and
performed in a hot-lid Eppendorf Mastercycler Grandient 5331 thermocy-
cler (Hamburg, Germany).
RNA was prepared from Wve individual larvae at stages 5, 6, 7, 8, 9 and
10. PowerScript™ reverse transcriptase (Clontech) was used to synthesize
cDNA for quantitative real-time RT-PCR analysis of larval GHR mRNA
expression according to product speciWcations. BrieXy, 1?g of total RNA
from each larva was combined with 1?l random primers (50ng/?l), 1?l
dNTPs (10mM) and sterile water to 12.5?l. The mixture was incubated for
Wve minutes at 65°C and then chilled on ice. Next, 4?l 5£ buVer, 2?l 0.1M

Page 3

J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
145
DTT, 1?l RNAsin and 0.5?l superscript II reverse transcriptase were added
to each sample and incubated for 10min at 25°C, followed by 50min at
42°C. Finally the reaction was stopped by incubating for 10min at 70°C.
2.4. GHR ampliWcation by PCR
All primers used for PCR are listed in Table 1. Degenerate primers
were designed from conserved nucleotide sequences from GHRs available
in the GenBank database: GHRA (5?-CTTGGRGCNCTCAGRGTCTT
YTA-3?) and GHRB (5?-TCTGCNGAWGGMGGGGGMKCCCA-3?)
from extracellular domain sequence and, GHRD (5?-ATTAAAGGMAT
CRAYCCAGANCT-3?) and GHRE
GGNTC-3?) located in the intracellular domains, Box 1 and Box 2, respec-
tively. PCR ampliWcation generated two partial sequences. These
sequences were used to design primers for use in SMART RACE PCR to
obtain the 5? and 3?-end sequences. 5?-end sequence was generated by
RACE PCR using GHR3 (5?-GGGGACACTCTTTCCATTCGCTGGT
TGG-3?). Cycling parameters were carried out according to the SMART
RACE (Clontech) protocol for Touchdown PCR using a hot-lid thermal
cycler, Eppendorf Mastercycler Grandient 5331 (5 cycles of 5s at 94°C,
2min at 72 °C; 5 cycles of 5s at 94°C, 10s at 70°C, 2min at 72°C; 25
cycles of 5s at 94°C, 10s at 68°C, 2min at 72°C). In addition, a two-step
protocol for Advantage 2 polymerase mix (Clontech) was used to obtain
the overlapping sequence between forward primer GHR2 (5?-GGT
CAACTGGGATCCCCCGCCATC-3?)and reverse primer GHR1 (5?-CG
TCCAGCTTGCCCTTCTTCAACAGATC-3?). The PCR cycles con-
sisted of 1 min at 95°C; 35 cycles of 15s at 95°C, 1min at 68°C; 1min at
68 °C. Multiple bands were produced by 3?-RACE PCR so a gene speciWc
primer was designed from homologous turbot and Japanese Xounder
GHR nucleotide sequences. This PCR used forward primer, GHR5 (5?-G
CGGCCTGTCCACCTATGCACCAGA-3?) and GHR6 (5?-GGACTTC
CTAGTTAATCAACCTTGCAC-3?) (5 cycles of 94°C, 2min at 72°C; 5
cycles of 5s at 94°C, 10s at 70°C, 2min at 72°C; 25 cycles of 5s at 94°C,
10 s at 69°C, 1min at 72 °C). In addition two truncated forms of the recep-
tor (hhGHRtr) were identiWed by PCR with forward primer, GHR4 (5?-A
TATTGTACGTCCAGACCCACCAGTGTCTC-3?) and reverse primer,
GSP7 (5?-ACAGCCGTGCCAATATATCACTGGAGTC-3?) (5 cycles of
5s at 94°C, 2min at 72 °C; 5 cycles of 5s at 94°C, 10s at 70°C, 2min at
72 °C; 25 cycles of 5s at 94°C, 10s at 68°C, 1min at 72°C). PCR products
were gel puriWed, ligated into pGEM®-T Easy Vector (Promega, Madison,
WI, USA) and subcloned in JM109 High EYciency Competent Esche-
(5?-ATRAACTCCACCCAY
richia coli grown on selective agar plates. After incubation of colonies,
plasmid vectors were puriWed using the MiniPrep kit (Qiagen) and
sequenced by MWG Biotech (Ebersberg, Germany). Sequences were
conWrmed by blast searches on GenBank.
2.5. Quantitative real time RT-PCR
Primers and TaqMan probes were designed for the Atlantic halibut full-
length growth hormone receptor (hhGHR), hhGHRtr and hh18s ribosomal
RNA using Primer Express software (Applied Biosystems, Foster City, CA,
USA). The BioRad iCycler (Hercules, CA, USA) with a 96-well adapter was
used for all quantitative real-time RT-PCR reactions. Optimizations of
primer and probe concentrations were determined using a 100fg concentra-
tion of plasmid DNA for each gene. Forward and reverse primers were Wrst
varied relative to each other at 50nM, 300nM and 900nM. The threshold
value at which all samples had greater Xuorescence than background and
increased exponentially was manually determined for each run. The sample
with the lowest threshold cycle (Ct), the point at which the individual sample
crosses the threshold line, and highest expression at the lowest primer concen-
trations was determined optimal. Probe concentrations, 50–250nM, were
then tested with the optimal primer concentrations. Standard cycling parame-
ters suggested for 96-well plate format were used for all reaction (2min at
50°C, 10min at 95°C, followed by 45 cycles of 15s at 95°C, 30s at 55°C, 30s
at 72°C). Sample plates were prepared with triplicate 25?l samples in 96-well
plates. On each plate, a nucleotide free sample was run to control that there
was no nucleotide contamination in the reaction components. In addition a
10-fold serial dilution (100pg–1fg) of miniprep for each gene was run on
each plate to generate a standard curve for quantiWcation and to determine
reaction eYciency. Following each run two samples were run on a 2% 1X
TAE gel to verify the amplicon were of the expected length. Samples were
normalized for a 18s ribosomal RNA sample plate prepared from the same
cDNA diluted 10,000£. Data from the quantitative PCR runs were collected
with BioRad iCycler iQ Optical System software. The mean starting quantity
for each sample was normalized for the mean starting quantity of 18s RNA.
2.6. IGF-I measurements
Frozen larvae were decapitated and heads and bodies in each group
weighed and homogenized separately on ice with a manual glass/glass
homogenizer. Larvae were pooled to make up Wve samples for each stage.
Table 1
Primer and probe sequences used for all PCRs
GeneTypeSequence
GHRA forward
GHRB reverse
GHRD forward
GHRE reverse
GHR1 reverse
GHR2 forward
GHR3 reverse
GHR4 forward
GHR5 forward
GHR6 reverse
GHR7 reverse
GHR1Q forward
GHR2Q reverse
GHRtr1Q forward
GHRtr2Q reverse
GHRQ
GHRtrQ
18s1Q forward
18s2Q reverse
18sQ
UPM
Degenerate
Degenerate
Degenerate
Degenerate
Gene speciWc
Gene speciWc
Gene speciWc
Gene speciWc
Gene speciWc
Gene speciWc
Gene speciWc
QPCR
QPCR
QPCR
QPCR
TaqMan Probe
TaqMan Probe
QPCR
QPCR
TaqMan Probe
RACE Universal long
Short
5? CTTGGRGCNCTCAGRGTCTTYTA
5? TCTGCNGAWGGMGGGGGMKCCCA
5? ATTAAAGGMATCRAYCCAGANCT
5? ATRAACTCCACCCAYGGNTC
5? CGTCCAGCTTGCCCTTCTTCAACAGATC
5? GGTCAACTGGGATCCCCCGCCATC
5? GGGGACACTCTTTCCATTCGCTGGTTGG
5? ATATTGTACGTCCAGACCCACCAGTGTCTC
5? GCGGCCTGTCCACCTATGCACCAGA
5? GGACTTCCTAGTTAATCAACCTTGCAC
5? ACAGCCGTGCCAATATATCACTGGAGTC
5? TGGCCTGCCCCAACAC
5? TCATCAGGGAAGCCAATGG
5? GAACATTAGGCCACGCAATCA
5? TGTTGACGAGCAGCATTTGG
5? CAGCCACCACATGAACACCGGATG
5? CCCACCCACACCCACCATCCCT
5? GCATGCCGGAGTCTCGTT
5? TGCATGGCCGTTCTTAGTTG
5? TTATCGGAATTAACCAGACAAATCGCTCCA
5? CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
5? CTAATACCACTCACTATAGGGC

Page 4

146
J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
Number of larvae in each pooled sample were 25–28 larvae for stages 5
and 6, 13–14 larvae for stage 7, 9–10 larvae for stage 8, 4–5 larvae for stage
9 and 3–4 larvae for stage 10.The pooled bodies of the Atlantic halibut lar-
vae were homogenized in 1.5ml 0.02M PBS, 0.15M NaCl, 0.01M NaN3,
0.5% BSA, 0.05% Triton-X, 1mM PMSF, pH 7.5. The homogenate was
incubated for 1h, and then centrifuged at 16,200g for 1h. IGF-I was mea-
sured in the supernatant. IGF-I was measured in bodies only, as the liver is
assumed to be the main tissue source. Conversely, GH was measured in the
heads only, as the pituitary is assumed to be the main tissue source. The
GH data is published separately (Einarsdóttir et al., 2006b).
IGF-I was measured according to a four-day protocol validated for
several teleost species, including halibut (Moriyama et al., 1994). Salmon
recombinant IGF-I (GroPep Ltd., Adelaide, Australia) was used for label
and standards. Antibodies produced in rabbit against recombinant salmon
IGF-I were kindly donated by S. Moriyama (Kitasato University, Japan).
The RIA protocol has low and reproducible intra-assay and inter-assay
variation. Serial dilutions of halibut larval extracts give full parallelism
with salmon IGF-I standard dilution series (Fig. 1), conWrming the validity
of the RIA protocol for work on halibut tissue extracts. SpeciWc binding
was >20%, non-speciWc binding was <2%, and ED50 was 4–5 ng ml¡1.
Results are presented as IGF-I (ng) per larva.
2.7. Statistical analysis
DiVerences in GHR mRNA and IGF-I protein content per stage in nor-
mal individuals from stage 5–10 was determined by one-way analysis of vari-
ance (ANOVA). If an overall diVerence was found, a Tukey post-hoc test was
applied to further determine group diVerences. For stages 8, 9 and 10, where
two phenotypes are present, normal and abnormal larvae, data was analyzed
by two-way ANOVA. DiVerences were considered signiWcant at P<0.05.
SPSS Software (Chicago, IL, USA) was used for statistical testing.
3. Results
3.1. Cloning and sequencing of hhGHR and hhGHRtr cDNA
The hhGHR cDNA (NCBI Accession no. DQ062814)
consist of 2022 base pairs (bp) with an open reading frame
of 1902bp which encode for 634 amino acid (aa) residues
(Fig. 2). The deduced amino acid sequence is composed of a
24aa signal peptide, a 252aa extracellular domain, a 24aa
single transmembrane region, and a 357aa intracellular
domain. Alignment using the ClustalW Multiple Sequence
Alignment program revealed 93% and 87% nucleotide iden-
tity with the GHR coding region in two Pleuronectiformes
Wsh, Japanese Xounder (Nakao et al., 2004) and turbot
(Calduch-Giner et al., 2001), respectively. Further, in a
sequence comparison among teleost species, the hhGHR
amino acid sequence is most similar to Japanese Xounder
(90%) and turbot (80%). Other Wsh and vertebrates share
lower nucleotide identities and amino acid similarities with
hhGHR (Table 2). The hhGHR has characteristic con-
served motifs of the GHR, including extracellular cysteine
residues, potential N-glycosylation sites, a FGEFS motif in
the extracellular domain, Box 1 and Box 2 regions and
tyrosine residues in the intracellular domain (see Kopchick
and Andry, 2000).
A short transcript of hhGHR was also cloned, contain-
ing a truncated intracellular domain. This alternative form
(hhGHRtr1, DQ062815) is similar to truncated forms
found in turbot (Calduch-Giner et al., 2001) and Japanese
Xounder (Nakao et al., 2004). It is composed of an extracel-
lular domain, a transmembrane region, as well as 27aa
intracellularly and 50 divergent amino acids before a stop
codon is reached (Fig. 2). The hhGHRtr1 shares 91% nucle-
otide identity and 85% amino acid similarity with the Japa-
nese Xounder truncated GHR (Nakao et al., 2004) and 86%
nucleotide identity and 77% amino acid similarity with tur-
bot truncated GHR (Calduch-Giner et al., 2001) (Table 2).
The deduced amino acid sequence includes Box 1 but not
Box 2. In addition, an alternatively-spliced GHR variant
with 132bp extracellular insert (hhGHRtr2) was cloned
and sequenced.
3.2. Quantitative GHR expression
There was no signal in the nucleotide free samples on all
plates. The eYciency on each plate was determine by the
slope and ranged from 3.5 and 3.7. All amplicons were of
the expected size.
In normally metamorphosed individuals, there were no
signiWcant changes (one-way ANOVA; p>0.05) in hhGHR
mRNA levels (Fig. 3A), although there was a decreasing
trend from the start of metamorphosis (stage 8) to post-
metamorphosis (stage 10), when the individuals are consid-
ered to be juveniles. In comparison with normal larvae,
abnormal larvae had signiWcantly (two-way ANOVA;
p<0.001) lower levels of hhGHR mRNA, and no stage by
phenotype interaction was found (p>0.05).
Levels of hhGHRtr mRNA (Fig. 3B) changed signiW-
cantly during metamorphosis of normally developing lar-
vae (one-way ANOVA; p<0.05), and post-hoc testing
revealed a signiWcant decrease from early pre-metamorpho-
sis (stage 6) to the metamorphic stages 9 (Tukey HSD;
pD0.04) and 10 (pD0.02). In abnormally metamorphosed
Fig. 1. Logit-log graph of the exponential phase of an IGF-I standard
curve (Wlled circles) and serial dilution of halibut tissue extract (open cir-
cles) showing parallel displacement of iodinated recombinant salmon
IGF-I by cold salmon recombinant IGF-I (the standard curve) and by
halibut tissue extract.

Page 5

J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
147
Fig. 2. Nucleotide and deduced amino acid sequences of hhGHR, hhGHRtr1 and hhGHRtr2. The putative regions are: signal peptide (underlined), con-
served extracellular cysteine residues (boxed), potential N-glycosylation sites (dashed underline), the (Y/F)GEFS motif (dashed boxed), single transmem-
brane domain (double underline), Box 1 and Box 2 (shaded box), intracellular tyrosine residues (circled) and stop codon (*). Sequence following the
truncated split is boxed and the alternatively spliced insert is boxed and shaded.

Page 6

148
J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
larvae, levels of hhGHRtr mRNA levels were lower than in
normal individuals (two-way ANOVA; p<0.001) and there
was no signiWcant interaction between stage and phenotype
(p>0.05). In the normal larvae, the ratio of hhGHR to
hhGHRtr decreased at stage 6 and 7 and then increased at
stage 8 and 9 (Table 3). Abnormal larvae had lower ratios
than normal larvae at the same stage (Table 3).
3.3. IGF-I tissue levels
Mean IGF-I contents of normal larvae increased from
stage 5 to 7 and then decreased from stage 8 to 10 (one-way
ANOVA followed by TUKEY, Fig. 3C). Abnormal larvae
had overall signiWcantly lower body IGF-I contents (two-
way ANOVA; p<0.001) than normal larvae (Fig. 3C). A
signiWcant stage by phenotype interaction (two-way
ANOVA; p<0.001) indicates that the diVerence in IGF-I
content is present at stage 8, but not at stages 9 and 10.
4. Discussion
The present study describes the cloning and sequencing
of three variants of an Atlantic halibut class I cytokine
receptor mRNA. These sequences share high nucleotide
identity with teleost full-length and truncated GHRs, with
highest similarity to the closely related pleuronectiformes
species, turbot and Japanese Xounder. The available
sequence (Jiao et al., 2006) and physiological data (Lee
et al., 2001; Tse et al., 2003; Kajimura et al., 2004; Jiao et al.,
2006) lead to the decision to refer to the cloned Atlantic
halibut full-length receptors as type I hhGHR and the trun-
cated receptor as hhGHRtr, due to their close nucleotide
Table 2
Comparison of the hhGHR and hhGHRtr nucleotide sequences and deduced amino acid sequences with Wsh and other vertebrate GHRs and somatolactin
receptors (SLRs)
Accession numbers are for the NCBI sequence database. Comparisons were performed with ClustalW alignment program.
SpeciesAccession No.Nucleotide identity (%)Amino acid similarity (%)
Full length GHR
Japanese Xounder
Turbot
Gilthead sea bream Type I
Gilthead sea bream Type II
Black sea bream Type I
Black sea bream Type II
Mozambique Tilapia
Nile Tilapia Type I
Nile Tilapia Type II
Medaka SLR
Medaka GHR
GoldWsh
Grass carp
Mrigal carp
Rohu carp
Catla carp
Carp isoform 1
Carp isoform 2
Southern CatWsh Type I
Southern CatWsh Type II
Eel isoform 1
Eel isoform 2
Masu salmon SLR
Masu salmon
Atlantic salmon
Coho salmon isoform 1
Coho salmon isoform 2
Rainbow trout isoform 1
Rainbow trout isoform 2
Xenopus
Turtle
Chicken
Pigeon
Mouse
Human
AB058418
AF352396
AH014067
AY573601
AF502071
AY662334
AB115179
AY973232
AY973233
DQ002886
DQ010539
AF293417
AY283778
AY691179
AY691177
AY691178
AY741100
AY691176
AY336104
AY973231
AB180476
AB180477
AB071216
AB071216
AY462105
AF403539
AF403540
AY861675
AY751531
AF193799
AF211173
NM001001293
D84308
BC075720
NM000163
93
87
80
51
81
55
79
79
33
74
34
55
61
55
54
54
55
55
52
34
56
34
66
58
51
52
52
52
52
29
32
30
28
27
28
90
80
79
40
79
39
71
71
39
68
36
50
50
50
49
49
49
49
43
37
46
44
55
41
42
44
41
43
41
32
34
34
35
32
31
Truncated GHR
Japanes Xounder
Turbot
Human
AB110985
AF352397
NM000163
91
86
37
86
78
30

Page 7

J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
149
identity with black sea bream (Acanthopagrus schlegeli)
type I GHR as opposed to type II and the full-length and
truncated turbot and Japanese Xounder GHRs.
The hhGHR shares 93% and 87% nucleotide identity
with the Japanese Xounder and turbot full-length GHRs,
respectively. Other Wsh species show lower identity (681%)
and similarity (679%). Additionally, non-teleost species
share lower identity (632%) and similarity (635%) with
hhGHR, although all species have highly conserved regions
characteristic of the cytokine receptor family (Kopchick
and Andry, 2000). The hhGHR possesses three paired
cysteine residues and one unpaired cysteine residue
upstream of the FGEFS motif. This arrangement is similar
to other Wsh species except salmonid species, lacking one
pair of cysteines, and eel (Anguilla japonica) GHR1 which
lack the unpaired cysteine. Halibut has six potential N-gly-
cosylation sites similar to most teleosts. Additionally, nine
intracellular tyrosine residues are conserved among species
with the exception of carp (Cyprinus carpio), eel, southern
catWsh (Silurus meridionalis) and salmonids. The varied
arrangement of intracellular tyrosine residues may reXect
diVerent intracellular signaling by GHRs in diVerent Wsh
species similar to the situation in mammals. Conserved
intracellular tyrosines are required for STAT5 signaling
in vitro in mammals (Hansen et al., 1996; Wang et al., 1996).
In the present study, two variants of the hhGHRtr have
been isolated. One variant (hhGHRtr1) is similar to the trun-
cated GHR described for two other XatWsh species; turbot
and Japanese Xounder (Calduch-Giner et al., 2001; Nakao
et al., 2004). This receptor is composed of an extracellular
and transmembrane domain in addition to 27 amino acid
residues intracellular identical to hhGHR after which the
truncated split occurs. Additionally, a second form with a
unique 132bp insert in the extracellular domain (hhGHRtr2),
nine nucleotide residues upstream from the transmemem-
brane domain, has been cloned and sequenced. Interestingly,
this insert is not found in the full-length receptor even
though the extracellular domain is identical between the
truncated and full-length receptors. The insert corresponds
to intron six between exon six and seven in Japanese Xounder
(Nakao et al., 2004), suggesting this product is produced by
alternative splicing of the hhGHR gene. Genomic DNA con-
tamination has been ruled out as no band is observed in a
control PCR with the reverse transcriptase step omitted.
Such structural change in the extracellular receptor domain
could well alter the aYnity of GH to its receptor, but this has
not been elucidated.
A truncated receptor is also found in several mammalian
species; humans, rabbit, rat and mouse (Dastot et al., 1996;
Edens and Talamantes, 1998; Leung et al., 1987). These
Fig. 3. Changes in whole body (A) hhGHR mRNA, (B) hhGHRtr
mRNA and (C) IGF-I content during halibut larval development
through metamorphosis. The larvae are staged according to a staging
scheme developed by Saele et al. (2004). Stage 5, Wrst feeding; stages 6
and 7, premetamorphosis; stage 8, start of metamorphosis; stage 9, meta-
morphic climax; stage, 10 juvenile. Data are means§SEM (nD4–6). Sig-
niWcant diVerences (p < 0.05) in tissue mRNA levels and IGF-I content
between stages are indicated by diVerent letters. Black and white bars
represent normally and abnormally metamorphosing individuals,
respectively. There is an overall signiWcant diVerence between normal
and abnormal larvae in hhGHR and hhGHRtr mRNA levels and IGF-I
content.
5678910
hhGHR
(normalized starting quantity)
0.00
0.01
0.02
0.03
0.04
0.05
0.06
5678910
hhGHRtr
(normalized starting quantity)
0.0000
0.0001
0.0002
0.0003
0.0004
0.0005
0.0006
0.0007
Stage
5678910
IGF-I (ng/larvae)
0.0
0.5
1.0
1.5
2.0
2.5
3.0
a
bc
d
d
c
ab
ab
b
ab
ab
a
a
A
B
C
Table 3
Ratio of hhGHR to hhGHRtr expressed both as normalized starting
mRNA quantity (Norm SQ) and expression relative to an individual larva
(relative expression, RE)
Data are means§ SEM. Normal and abnormal larvae are classiWed as
described by Saele et al. (2004).
StageNorm SQRE
Normal larvae
5
6
7
8
9
10
119.1§20.8
88.8§14.8
87.7§7.4
141.4§38.7
148.9§32.9
119.1§12.9
1.1§ 0.2
0.8§ 0.1
0.8§ 0.1
1.3§ 0.4
1.4§ 0.3
1.1§ 0.1
Abnormal larvae
8
9
10
108.7§35.0
111.0§31.3
42.7§9.4
1.0§ 0.3
1.0§ 0.3
0.4§ 0.1

Page 8

150
J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
forms, analogous to the human GHR279 transcript, have
been suggested to arise by an alternative-splicing mecha-
nism leading to a deletion of the Wrst 26 bases of exon 9
(Ross et al., 1997). In mammals the truncated GHR is sug-
gested to attenuate the full-length recptor. The hGHR279
binds GH with comparable aYnity to the full-length
hGHR (Amit et al., 1997; Dastot et al., 1996; Ross et al.,
1997), but is unable to stimulate signal transduction (Ross
et al., 1997). Cells transfected with hGHR279 increase
GHBP secretion (Dastot et al., 1996; Amit et al., 1997; Ross
et al., 1997) and hGHR279 has been suggested to attenuate
GHR signal transduction, acting as a dominant negative
inhibitor of the full-length receptor (Ayling et al., 1997;
Ross et al., 1997). The truncated receptor could function in
a similar fashion in Wsh, as the conserved intracellular tyro-
sines required for STAT5 activation (Wang et al., 1996;
Hansen et al., 1996) are lacking. Further, the truncated
receptors in XatWsh lack a phenylalanine residue present in
Box 2, analogous to phenylalanine at position 346 in the
human GHR. This residue has been found to be required
for ligand-mediated internalization in transfected COS-7
cells (Allevato et al., 1995), suggested to increase release of
GHBP into the medium in CHO cells by the hGHR279
(Amit et al., 1997). hhGHRtrs contain Box 1, but not Box 2,
both of which are required for regular JAK-STAT signal
transduction in mammals (Zhu et al., 2001). The presence
of Box 1 in XatWsh may, however, inXuence the function of
the truncated receptor. Similar features observed between
the hGHR279 and hhGHRtr may suggest common function
in halibut, inXuencing the GHBP levels and/or attenuating
the full-length receptor.
An interesting Wnding of the present study is that the
hhGHR and hhGHRtr mRNA levels are diVerentially regu-
lated during metamorphosis. An increase in the ratio of
hhGHR to hhGHRtr at stages 8 and 9 (Table 3) suggests
that the truncated form may provide less dominant nega-
tive inhibition of receptor action during metamorphosis,
although tissue speciWc ratios and protein levels must be
considered. GHR full-length and truncated forms are regu-
lated diVerently in mouse 3T3-L1 adipocyte cells, modulat-
ing GH action (Iida et al., 2003). Truncated GHR isoforms
are also diVerentially regulated in a tissue-speciWc manner
in mouse (Iida et al., 2004). Likewise at the beginning of
metamorphosis, the increase hhGHR:hhGHRtr ratio sug-
gests this could lead to less GHRtr inhibition which would
allow GH increase access to its full-length receptor.
Decreased expression of hhGHR and hhGHRtr mRNA in
abnormal individuals (Figs. 3A,B) compared with normal
individuals, suggests these transcripts are important for
metamorphic success. Further, the lower hhGHR:hhGHRtr
ratios in abnormal individuals at each stage 8–10 and
greater decrease between stages could increase the eVect of
the GHRtr on GHR if these transcripts are translated into
functional proteins.
The pituitary GH content increases gradually and pro-
portionally with body size during halibut development
through metamorphosis (Einarsdóttir et al., 2006b).
Ontogenetic changes in GHR expression may therefore be
of importance for GH action during this developmental
process. In the present study, the highest hhGHR mRNA
levels are found during the pre-metamorphic stage 6 and at
the beginning of metamorphosis (stage 8), suggesting that
tissue sensitivity for GH is highest in the larval phase if
these mRNA levels correlate to cellular GHR protein con-
tents. As with hhGHR mRNA levels, IGF-I contents are
high at the onset of metamorphosis and decrease in a simi-
lar manner thereafter during post-metamorphic and juve-
nile stages. IGF-I content and hhGHR mRNA levels are
signiWcantly lower in abnormal compared with normal
individuals at the onset of metamorphosis, while the pitui-
tary GH contents do not diVer from normally metamor-
phosed individuals (Einarsdóttir et al., 2006b). The
relatively high levels of hhGHR mRNA and IGF-I content
at the onset of metamorphosis and the much lower levels in
abnormal individuals suggests that the GH-IGF-I system is
important for metamorphic success.
GH inXuences multiple systems in Wsh and could inXu-
ence metamorphosis at various levels. A major function of
GH in Wsh is to stimulate tissue proliferation and growth
(see Reinecke et al., 2005) and GH and IGF-I could act
together to stimulate bone growth driving eye migration.
Additionally GH is important for energy mobilization and
food conversion in Wsh (see Björnsson, 1997; Martinez
et al., 2000). Halibut reduce feed intake during metamor-
phosis, at the same time as the major biochemical and mor-
phological conversions during metamorphosis are likely to
demand large energy expenditure (Heiddis Smáradóttir,
unpublished observations). This is in line with the observa-
tion that GH exerts a lipolytic action in isolated gilthead
sea bream adiposities (Albalat et al., 2005) and has been
shown to greatly increase food conversion eYciency in GH
transgenic tilapia (Martinez et al., 2000). GH has also been
shown to be important for osmoregulation in teleost Wsh
where it stimulates Na+, K+-ATPase activity in gill chloride
cells (see McCormick, 2001). GH could act in a similar
fashion during halibut metamorphosis to adapt the Wsh to
variable salinities encountered during metamorphosis.
In summary, three variants of a class I cytokine receptor,
a full-length and two truncated forms, have been cloned
and sequenced from the liver of Atlantic halibut. These
receptors show conserved sequences with other vertebrate
GHRs and high similarity and identity with other XatWsh
GHRs. The hhGHR mRNA levels and IGF-I protein con-
tents change in a stage-speciWc manner, decreasing from the
onset of metamorphosis to post-metamorphosis. The
hhGHRtr mRNA levels are diVerentially regulated relative
to the full-length receptor, suggesting a possible role for
this variant in regulation of GH signaling. Both full-length
and truncated hhGHRs mRNA levels are regulated inde-
pendently of GH protein content and larval weight. Down-
regulation of hhGHR and hhGHRtr mRNA and IGF-I
protein content is found in larvae with arrested metamor-
phosis, suggesting the GH-IGF-I system is important for
successful development of larval halibut.

Page 9

J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
151
Acknowledgments
The authors thank Heiddis Smáradóttir, Arnar Jonsson
and Oystein Saele for larval sampling, Barbro Egnér for
measuring tissue IGF-I content, Shunsuke Moriyama for
providing the IGF-I antibody, and Susana Benedet for
advice on GHR cloning and sequencing. This work has
been carried out within the project “Arrested development:
The Molecular and Endocrine Basis of FlatWsh Metamor-
phosis” (Q5RS-2002-01192) with Wnancial support from
the Commission of the European Communities. However,
it does not necessarily reXect the Commission’s views and
in no way anticipates its future policy in this area. This
project was further supported by the Swedish Council for
Agricultural and Forestry Research (FORMAS).
References
Albalat, A., Gomez-Requeni, P., Rojas, P., Medale, F., Kaushik, S., Vianen,
G.J., Van den Thillart, G., Gutierrez, J., Perez-Sanchez, J., Navarro, I.,
2005. Nutritional and hormonal control of lipolysis in isolated gilthead
seabream (Sparus aurata) adipocytes. Am. J. Physiol. 289, R259–R265.
Allevato, G., Billestrup, N., Goujon, L., Galsgaard, E.D., Norstedt, G.,
Postel-Vinay, M.C., Kelly, P.A., Nielsen, J.H., 1995. IdentiWcation of
phenylalanine 346 in the rat growth hormone receptor as being critical
for ligand-mediated internalization and down-regulation. J. Biol.
Chem. 270, 17210–17214.
Amit, T., Bergman, T., Dastot, F., Youdim, M.B., Amselem, S., Hochberg,
Z., 1997. A membrane-Wxed, truncated isoform of the human growth
hormone receptor. J. Clin. Endocrinol. Metab. 82, 3813–3817.
Ayling, R.M., Ross, R., Towner, P., Von Laue, S., Finidori, J., Moutouss-
amy, S., Buchanan, C.R., Clayton, P.E., Norman, M.R., 1997. A domi-
nant-negative mutation of the growth hormone receptor causes
familial short stature. Nat. Genet. 16, 13–14.
Bern, H.A., Nicoll, C.S., Strohan, R.C., 1967. Prolactin and tadpole growth.
Proc. Soc. Exp. Biol. Med. 126, 518–520.
Björnsson, B.Th., 1997. The biology of salmon growth hormone: from
daylight to dominance. Fish Physiol. Biochem. 17, 9–24.
Calduch-Giner, J., Duval, H., Chesnel, F., Boeuf, G., Perez-Sanchez, J.,
Boujard, D., 2001. Fish growth hormone receptor: molecular charac-
terization of two membrane-anchored forms. Endocrinology 142,
3269–3273.
Dastot, F., Sobrier, M.L., Duquesnoy, P., Duriez, B., Goossens, M., Amse-
lem, S., 1996. Alternatively spliced forms in the cytoplasmic domain of
the human growth hormone (GH) receptor regulate its ability to gener-
ate a soluble GH-binding protein. Proc. Natl. Acad. Sci. USA 93,
10723–10728.
de Jesus, E.G., Hirano, T., Inui, Y., 1993. Flounder metamorphosis: its reg-
ulation by various hormones. Fish Physiol. Biochem. 11, 323–328.
de Jesus, E.G., Hirano, T., Inui, Y., 1994. The antimetamorphic eVect of
prolactin in the Japanese Xounder. Gen. Comp. Endocrinol. 93, 44–50.
Edens, A., Talamantes, F., 1998. Alternative processing of growth hor-
mone receptor transcripts. Endocr. Rev. 19, 559–582.
Einarsdóttir, I.E., Silva, N., Power, D.M., Smáradóttir, H., Björnsson,
B.Th., 2006a. Thyroid and pituitary gland development from hatching
through metamorphosis of a teleost XatWsh, the Atlantic halibut. Anat.
Embryol. (Berl) 211, 47–60.
Einarsdóttir, I.E., Anjos, L., Hildahl, J., Björnsson, B.Th., Power, D.M.,
2006b. Isolation of Atlantic halibut pituitary hormones by continuous-
elution electrophoresis followed by Wngerprint identiWcation, and
assessment of growth hormone content during larval development.
Gen. Comp. Endocrinol., doi:10.1016/j.ygcen.2006.09.010.
Fukada, H., Ozaki, Y., Pierce, A.L., Adachi, S., Yamauchi, K., Hara, A.,
Swanson, P., DickhoV, W.W., 2004. Salmon growth hormone receptor:
molecular cloning, ligand speciWcity, and response to fasting. Gen.
Comp. Endocrinol. 139, 61–71.
Hansen, L.H., Wang, X., Kopchick, J.J., Bouchelouche, P., Nielsen, J.H.,
Galsgaard, E.D., Billestrup, N., 1996. IdentiWcation of tyrosine residues
in the intracellular domain of the growth hormone receptor required
for transcriptional signaling and Stat5 activation. J. Biol. Chem. 271,
12669–12673.
Huang, H., Brown, D.D., 2000. Overexpression of Xenopus laevis growth
hormone stimulates growth of tadpoles and frogs. Proc. Natl. Acad.
Sci. USA 97, 190–194.
Iida, K., Takahashi, Y., Kaji, H., Yoshioka, S., Murata, M., Iguchi, G.,
Okimura, Y., Chihara, K., 2003. Diverse regulation of full-length and
truncated growth hormone receptor expression in 3T3-L1 adipocytes.
Mol. Cell. Endocrinol. 210, 21–29.
Iida, K., Del Rincon, J.P., Kim, D.S., Itoh, E., Nass, R., Coschigano, K.T.,
Kopchick, J.J., Thorner, M.O., 2004. Tissue-speciWc regulation of
growth hormone (GH) receptor and insulin-like growth factor-I gene
expression in the pituitary and liver of GH-deWcient (lit/lit) mice and
transgenic mice that overexpress bovine GH (bGH) or a bGH antago-
nist. Endocrinol. 145, 1564–1570.
Jiao, B., Huang, X., Chan, C.B., Zhang, L., Wang, D., Cheng, C.H., 2006.
The co-existence of two growth hormone receptors in teleost Wsh and
their diVerential signal transduction, tissue distribution and hormonal
regulation of expression in seabream. J. Mol. Endocrinol. 36, 23–40.
Kajimura, S., Kawaguchi, N., Kaneko, T., Kawazoe, I., Hirano, T., Visita-
cion, N., Grau, E.G., Aida, K., 2004. IdentiWcation of the growth hor-
mone receptor in an advanced teleost, the tilapia (Oreochromis
mossambicus) with special reference to its distinct expression pattern in
the ovary. J. Endocrinol. 181, 65–76.
Kopchick, J.J., Andry, J.M., 2000. Growth hormone (GH), GH receptor,
and signal transduction. Mol. Genet. Metabol. 71, 293–314.
Lee, L.T., Nong, G., Chan, Y.H., Tse, D.L., Cheng, C.H., 2001. Molecular
cloning of a teleost growth hormone receptor and its functional inter-
action with human growth hormone. Gene 270, 121–129.
Leung, D.W., Spencer, S.A., Cachianes, G., Hammonds, R.G., Collins, C.,
Henzel, W.J., Barnard, R., Waters, M.J., Wood, W.I., 1987. Growth
hormone receptor and serum binding protein: puriWcation, cloning and
expression. Nature 330, 537–543.
Martinez, R., Juncal, J., Zaldivar, C., Arenal, A., Guillen, I., Morera, V.,
Carrillo, O., Estrada, M., Morales, A., Estrada, M.P., 2000. Growth
eYciency in transgenic tilapia (Oreochromis sp.) carrying a single copy
of a homologous cDNA growth hormone. Biochem. Biophys. Res.
Commun. 267, 466–472.
McCormick, S.D., 2001. Endocrine control of osmoregulation in teleost
Wsh. Am. Zool. 41, 781–794.
Moriyama, S., Swanson, P., Nishii, M., Takahashi, A., Kawauchi, H., Dick-
hoV, W.W., Plisetskaya, E.M., 1994. Development of a homologous
radioimmunoassay for coho salmon insulin-like growth factor-I. Gen.
Comp. Endocrinol. 96, 149–161.
Nakao, N., Higashimoto, Y., Ohkubo, T., Yoshizato, H., Nakai, N., Naka-
shima, K., Tanaka, M., 2004. Characterization of structure and expres-
sion of the growth hormone receptor gene of the Japanese Xounder
(Paralichtys olivaceus). J. Endocrinol. 182, 157–164.
Reinecke, M., Björnsson, B.Th., DickhoV, W.W., McCormick, S.D., Nav-
arro, I., Power, D.M., Gutierrez, J., 2005. Growth hormone and insulin-
like growth factors in Wsh: where we are and where to go. Gen. Comp.
Endocrinol. 142, 20–24.
Ross, R.J., Esposito, N., Shen, X.Y., Von Laue, S., Chew, S.L., Dobson,
P.R., Postel-Vinay, M.C., Finidori, J., 1997. A short isoform of the
human growth hormone receptor functions as a dominant negative
inhibitor of the full-length receptor and generates large amounts of
binding protein. Mol. Endocrinol. 11, 265–273.
Saele, O., Solbakken, J.S., Watanabe, K., Hamre, K., Power, D., Pittman,
K., 2004. Staging of Atlantic halibut (Hippoglossus hippoglossus L.)
from Wrst feeding through metamorphosis, including cranial ossiWca-
tion independent of eye migration. Aquaculture 239, 445–465.
Shintani, N., Nohira, T., Hikosaka, A., Kawahara, A., 2002. Tissue-speciWc
regulation of type III iodothyronine 5-deiodinase gene expression

Page 10

152
J. Hildahl et al. / General and Comparative Endocrinology 151 (2007) 143–152
mediates the eVects of prolactin and growth hormone in Xenopus meta-
morphosis. Dev. Growth DiVer. 44, 327–335.
Takada, M., Kasai, M., 2003. Growth hormone is a weaker candidate
than prolactin for the hormone responsible for the development of
a larval-type feature in cultured bullfrog skin. J. Exp. Biol. 206,
1137–1142.
Tse, D.L., Tse, M.C., Chan, C.B., Deng, L., Zhang, W.M., Lin, H.R.,
Cheng, C.H., 2003. Seabream growth hormone receptor: molecular
cloning and functional studies of the full-length cDNA, and tissue
expression of two alternatively spliced forms. Biochim. Biophys. Acta
1625, 64–76.
Very, N.M., Kittilson, J.D., Norbeck, L.A., Sheridan, M.A., 2005. Isolation,
characterization, and distribution of two cDNAs encoding for growth
hormone receptor in rainbow trout (Oncorhynchus mykiss). Comp.
Biochem. Physiol. B 140, 615–628.
Wang, X., Darus, C.J., Xu, B.C., Kopchick, J.J., 1996. IdentiWcation of
growth hormone receptor (GHR) tyrosine residues required for GHR
phosphorylation and JAK2 and STAT5 activation. Mol. Endocrinol.
10, 1249–1260.
Wright, M.L., Cykowski, L.J., Lundrigan, L., Hemond, K.L., Kochan,
D.M., Faszewski, E.E., Anuszewski, C.M., 1994. Anterior pituitary and
adrenal cortical hormones accelerate or inhibit tadpole hindlimb
growth and development depending on stage of spontaneous develop-
ment or thyroxine concentration in induced metamorphosis. J. Exp.
Zool. 270, 175–188.
Yamano, K., Miwa, S., 1998. DiVerential gene expression of thyroid
hormone receptor alpha and beta in Wsh development. Gen. Comp.
Endocrinol. 109, 75–85.
Zhu, T., Goh, E.L., Graichen, R., Ling, L., Lobie, P.E., 2001. Signal trans-
duction via the growth hormone receptor. Cell Signal. 13, 599–616.