Genomic and cDNA cloning, characterization of Delonix regia trypsin inhibitor (DrTI) gene, and expression of DrTI in Escherichia coli.

Abstract

Degenerate primers were designed based on all possible sequences of the N-terminal and C-terminal regions of Delonix regia trypsin inhibitor (DrTI). Five hundred sixty-one bp of polymerase chain reaction (PCR) product was amplified using the above degenerate primers and genomic DNA and cDNA of Delonix regia as a template. The amplified PCR products were cloned and sequenced. DNA sequence analysis of cDNA and genomic clones of DrTI have the same nucleotide sequence in the coding region, and manifested a genomic clone without intervening sequences in the coding region. The amino acid sequence deduced from the DrTI genomic and cDNA clones agreed with that identified via amino acid sequencing analysis, except that two amino acid residues, Ser and Lys, existed between residues Lys141 and Ser142. DrTI open reading frame was then amplified and cloned in-frame with GST in pGEX4T-1 and overexpressed in Escherichia coli to yield a glutathione S-transferase (GST)-fusion protein with a calculated molecular mass of about 45 kDa. The recombinant DrTI (reDrTI) was derived by treating the GST-DrTI fusion protein with thrombin. Both the reDrTI and GST-DrTI fusion protein exhibited a strong identical inhibitory effect on trypsin activity.

Full text

Page 1

Genomic and cDNA Cloning, Characterization of Delonix regia
Trypsin Inhibitor (DrTI) Gene, and Expression of DrTI in Escherichia coli
Chih-Hung HUNG,1;yPei-Hua PENG,2Chou-Chun HUANG,1Hai-Lung WANG,1
Yu-Jen CHEN,1Yuan-Liang CHEN,1and Lang-Ming CHI3
1Department of Medical Technology, Yuanpei University, Hsinchu 300, Taiwan, ROC
2Institute of Biotechnology, Yuanpei University, Hsinchu 300, Taiwan, ROC
3Proteomics Core Laboratory, Genomic Research Center, Chang Gung University,
Tao Yuan 333, Taiwan, ROC
Received July 11, 2006; Accepted September 14, 2006; Online Publication, January 7, 2007
[doi:10.1271/bbb.60394]
Degenerate primers were designed based on all
possible sequences of the N-terminal and C-terminal
regions of Delonix regia trypsin inhibitor (DrTI). Five
hundred sixty-one bp of polymerase chain reaction
(PCR) product was amplified using the above degener-
ate primers and genomic DNA and cDNA of Delonix
regia as a template. The amplified PCR products were
cloned and sequenced. DNA sequence analysis of cDNA
and genomic clones of DrTI have the same nucleotide
sequence in the coding region, and manifested a geno-
mic clone without intervening sequences in the coding
region. The amino acid sequence deduced from the
DrTI genomic and cDNA clones agreed with that iden-
tified via amino acid sequencing analysis, except that
two amino acid residues, Ser and Lys, existed between
residues Lys141 and Ser142. DrTI open reading frame
was then amplified and cloned in-frame with GST in
pGEX4T-1 and overexpressed in Escherichia coli to
yield a glutathione S-transferase (GST)-fusion protein
with a calculated molecular mass of about 45kDa. The
recombinant DrTI (reDrTI) was derived by treating
the GST-DrTI fusion protein with thrombin. Both the
reDrTI and GST-DrTI fusion protein exhibited a strong
identical inhibitory effect on trypsin activity.
Key words:Delonix regia trypsin inhibitor; Kunitz-type
trypsin inhibitor; Delonix regia; molecular
cloning
Seed proteins have important roles in plant survival
such as maintaining seed viability, providing nutrition
during early seeding, and protecting the seeds against
microbes and insects.1)Protease inhibitors of seeds can
inhibit trypsin while it passes through the gut of an
animal, thus helping with seed dispersal, and protecting
plants against pests and diseases.2–5)Protease inhibitors
are present in significant quantities in Leguminosae
seeds and in smaller quantities in cereals, cucurbits,
potatoes and other tubers.6–8)Numerous studies have
recently demonstrated the efficacy of proteinase inhib-
itors as defense proteins; the most direct proof comes
from proteinase inhibitor overexpression in transgenic
plants, which causes increases in resistance to insect
pests.9–11)Besides their natural biological functions,
proteinase inhibitors might also be useful in treating
human pathologies such as inflammation, hemorrhage,12)
and cancer.13–16)
Serine proteinase inhibitors from plants are classified
into families: the Kunitz trypsin, Bowman-Birk protei-
nase, potato I, potato II, barley trypsin, and squash
inhibitor families.17)The legume proteinase inhibitors
are further classified into two main groups according
to their size and cysteine content. Kunitz-type inhibi-
tors are proteins (Mr 18,000–22,000) with one or two
polypeptide chains and low cysteine content, generally
with four cysteine residues arranged into two disulfide
bridges, each comprising 170–180 amino acids. Delonix
regia trypsin inhibitor (DrTI) which belongs to the
Kunitz family, is purified from Delonix regia (Legumi-
nosae Caesalpinioideae) seeds. The primary structure of
DrTI has been identified.18)It comprises a single-
polypeptide chain with a molecular mass of 22kDa
and two disulfide bonds. The amino acid sequence of
DrTI has a high similar comparative sequence of related
Kunitz inhibitors, including SBTI,19)SwTI,20)PtTI,21)
EcTI,22)BvTI-3c and ACTI.23,24)Finally, DrTI is an
effective inhibitor of trypsin and human plasma kallik-
rein, but not of chymotrypsin, plasmin, factor Xa or
tissue kallikrein.
Sequence comparison with other plant trypsin inhib-
yTo whom correspondence should be addressed. Tel: +886-3-5381183, ext. 8664; Fax: +886-3-5385353; E-mail: chihhung@mail.yust.edu.tw
Abbreviations: DrTI, Delonix regia trypsin inhibitor; L-BAPNA, ?-N-benzoyl-D,L-arginine-4-nitro-anilide hydrochloride; re, recombinant; GST,
glutathione S-transferase; SDS–PAGE, sodium dodecylsulfate polyacrylamide gel electrophoresis; DTT, dithiothreitol; PCR, polymerase chain
reaction; ORF, open reading frame
Biosci. Biotechnol. Biochem., 71 (1), 98–103, 2007

Page 2

itors of the Kunitz family reveals that, instead of the
conserved Arg or Lys found in other Kunitz TIs, DrTI
contains a negatively charged residue (Glu68) at the P1
reactive site.18)The present study aimed to clone the
cDNA and genomic DNA of the DrTI gene and to
express GST-DrTI fusion protein and reDrTI which
exhibit a strong identical inhibitory effect on trypsin
activity (E. coli). In the future, mutant proteins can
perhaps be utilized by site-directed mutagenesis to
investigate the role of Glu68 residue in trypsin inhib-
itory activity of DrTI.
Materials and Methods
Materials. Isopropyl-1-thio-D-galactopyranoside (IPTG),
PCR marker, T4 DNA ligase and thrombin were pur-
chased from Promega (Madison, WI). The expression
vector, pGEX4T-1, and a HiTrap? DEAE FF column
were purchased from Amersham Pharmacia Biotech
(Uppsala, Sweden). Trypsin, glutathione-agarose gel and
L-BAPNA were from Sigma (St. Louis, MO). Restric-
tion enzymes and other reagents used in molecular-
biology techniques were purchased from New England
Biolabs, Boston, MA. A DNeasy Plant Maxi kit and an
Oligotex mRNA Purification System were from Qiagen
(Hilden, Germany). All other chemicals used were of
analytical grade.
Isolation of Delonix regia genomic DNA and mRNA,
and cDNA synthesis. Delonix regia genomic DNA was
extracted from 1g of lyophilized young leaves using a
silica-gel membrane-type kit (DNeasy Plant Maxi,
Qiagen, Hilden, Germany) based on a previous study.25)
Maturing Delonix regia seeds about one month after
flowering were obtained from a local source (Hsinchu,
Taiwan). Total cellular RNA was isolated from the seeds
by homogenizing them in 4 M guanidinium thiocya-
nate.26)Poly (A)þwas purified from total cellular RNA
using the Oligotex mRNA Purification System. Poly
(A)þrich RNA from the seeds of Delonix regia was
used for cDNA synthesis as described previously.27)The
genomic DNA and cDNA samples were used for the
subsequent PCR analysis.
Amplification of Delonix regia genomic DNA and
cDNA with DrTI specific primers. On the basis of the
amino acid sequence of DrTI,15)two degenerate PCR
primers were prepared. Primer Astart(50-TCNGAYGCN-
GARAARGTNTAYGAYATHGA-30) encodes the first
eight N-terminal amino acids of the DrTI. Primer Astop
(50-NGAYTCNGTYTCNGANCCNGANCGNGGYTT-
30) encodes the last eight C-terminal amino acids of the
DrTI. The reaction mixture for PCR was prepared in a
PCR reaction tube. The reaction volume of 50ml con-
tained 1 ? PCR buffer (20mM Tris–HCl, pH 8.8, 10mM
KCl, 10mM (NH4)2SO4, 0.1% Triton-X-100 and 5mg
BSA), 500ng of genomic DNA or 500ng cDNA, 400mM
dNTP, 1.5mM MgCl2, 50pmole of each of paired Astart/
Astop primers and 2.5 units Pfu DNA polymerase
(Promega, Madison, WI). The reactions were amplified
in a thermal cycler (GeneAmp PCR System 9700,
Applied Biosystems) according to the following PCR
step-cycle program: pre-incubation at 95?C for 5min,
denaturation at 95?C for 1min, annealing at 45?C for
1min, and extension at 72?C for 2min. The cycle was
repeated 35 times followed by a final extension at 72?C
for 7min. Reaction products were analyzed by electro-
phoresis on 1.5% agarose gel in Tris/acetate EDTA
(40mM Tris–HCl, pH 8.0, 5mM sodium acetate, 1mM
EDTA). The products were detected by ethidium
bromide staining.
Construction of genomic and cDNA clones of DrTI.
DNA fragments of 0.56kbp isolated and produced by
PCR reaction by agarose gel electrophoresis were
ligated to pBluescript vector (Stratagene, La Jolla, CA)
which was digested Sma I and calf intestine phospha-
tase. Transformed E. coli cells (TG 1) were selected by
blue-white selection. Clones with 561bp fragments were
sequenced using an ABI 310 automated sequencer. All
inserts were sequenced at least twice on both strands.
Construction of expression plasmids and overexpres-
sion of GST-DrTI fusion proteins in E. coli. Expression
plasmid was the derivative of pGEX-4T-1 and was
constructed by ligating a 561bp BamHI/EcoRI frag-
ment derived from pcDrTI by PCR with primer-A, 50
AAGGATCCTCGGACGCGGAGAAGGTTT 30and pri-
mer-B, 50AGGAATTCTTAGGACTCCGTTTCCGAT
30,28)which contained the entire DrTI coding sequence
in-frame into the BamHI/EcoRI sites of pGEX4T-1.
The resulting construct, pGEX4T-1-cDrTI contained
both glutathione S-transferase and the DrTI gene. All the
constructs of DrTI cDNA were confirmed by sequencing
the ligation products of pGEX4T-1 plasmids. To enlarge
the expression of DrTI fusion protein, E. coli TG 1 cells
harboring pGEX4T-1-cDrTI construct were grown at
37?C in 500ml of LB broth (1% NaCl, 1% Bacto-
tryptone, 0.5% Bacto-yeast extract, pH 7.0) containing
100mg/ml of ampicillin. When OD600 reached 0.6,
IPTG was added to a final concentration of 1mM to
induce fusion protein expression and the culture was
incubated for a further 4h at 30?C. A maximal harvest
was obtained under these conditions. Total soluble
proteins were extracted in resuspended buffer (10mM
Na2HPO4, 1.8mM NaH2PO4, 140mM NaCl, 2.7mM
KCl, pH 7.5, 1mM DTT, 0.2mg/ml lysozyme) by
repeated freeze-thawing, followed by centrifugation
(10;000 ? g, 10min) at 4?C, the supernatant being the
crude protein extract. Fifteen mg of crude protein extract
was analyzed on 12.5% SDS–PAGE followed by
Coomassie blue staining.
Purification of GST-DrTI fusion proteins and reDrTI.
GST-DrTI fusion proteins were produced and purified to
homogeneity as described previously.29)In brief, crude
Genomic and cDNA Cloning of DrTI99

Page 3

protein extracts were loaded onto a glutathione-agarose
affinity column, and then, after washing, the GST-DrTI
fusion protein was eluted using 5mM reduced gluta-
thione in 50mM Tris–HCl, pH 8.0. The fusion proteins
were then treated with thrombin to liberate the recombi-
nant DrTIs which were purified with a HiTrap? DEAE
FF column (1ml). After applying the sample to the
column, it was eluted with 50mM Tris/HCl, pH 8.0, and
then eluted with a linear gradient of 0 to 0.3 M NaCl in
the buffer.
Trypsin Inhibitory activity of reDrTI. The trypsin
inhibitory activities of GST-DrTI fusion protein, reDrTI
and native DrTI were measured by incubating each DrTI
with trypsin in 1ml of 0.1 M Tris–HCl buffer, pH 8.0
containing 0.01 M CaCl2 for 5min at 37?C. Residual
trypsin activity was determined by adding 10ml L-
BAPNA (50mg/ml in DMSO) at 37?C. After 20min of
incubation, the reaction was stopped by adding 0.5ml of
10% acetic acid. The degree of inhibition was deter-
mined by measuring the optical density at 410nm.30)
Results and Discussion
Amplification and analysis of DrTI cDNA and
genomic fragment
The application of degenerate primers based on the
amino acid sequence for DrTI was used to amplify the
specific sequences of DrTI cDNA and genomic DNA,
and the expected size obtained was as illustrated in
(Fig. 1). The main product obtained following amplifi-
cation of DrTI cDNA and genomic DNA with primers
Astart/Astop annealed at 45?C was a fragment of
approximately 0.56kbp.
The amplified DNA fragments produced by PCR
reaction with cDNA and genomic DNA as template
were subsequently subcloned to pBluescript vector and
sequenced. Analysis of cloned DNA fragments from
PCR reaction using either cDNA or genomic DNA as
template revealed cloned DNA of the expected size
(0.56kbp) covering the entire DrTI. Random sampling
and sequencing of clones containing the 561bp fragment
obtained detected only one type, and (Fig. 2) showed
that the deduced amino acid sequence of DrTI using
DNA sequence analysis of cDNA and genomic clones of
DrTI had the same nucleotide sequence in the coding
region, and identified the genomic clone without
intervening sequences in the coding region. The amino
acid sequence deduced from the cDNA clone agreed
with that determined by amino acid sequencing analysis,
except for two amino acid residues, Ser and Lys,
between residues Lys141 and Ser142 of the amino acid
sequence.18)The genomic clones isolated from soybeans
encoding kunitz-type trypsin inhibitors and Bowman-
Birk-type trypsin inhibitor have been reported not to
contain an intron.30–32)
Construction of expression plasmids and overexpres-
sion of GST-DrTI fusion proteins in E. coli
The primers were applied to PCR on the pcDrTI to
generate DrTI-encoding DNA fragments for subcloning.
DNA fragments encoding 187 amino acids of DrTI
flanked by EcoRI and BamHI were ligated into
pGEX4T-1 using T4 DNA ligase. The desired expres-
sion vector with insert was confirmed via nucleotide
sequencing. The expression plasmid was designated
pGAEX4T-1-cDrTI.
The GST-DrTI fusion proteins were obtained from
pGEX4T-1-cDrTI expression in E. coli TG1 cells. The
fusion proteins were purified from the E. coli lysate
through affinity chromatography with a glutathione-
agarose gel column. The purified fusion proteins were
then treated with thrombin and purified with a HiTrap?
DEAE FF column. This study obtained a final yield of
5–6mg purified reDrTI/liter induced E. coli at 30?C.
The homogeneity of purified reDrTIs was analyzed
using SDS–PAGE and the results are shown in (Fig. 3).
The N-terminal amino acid sequence of reDrTIs was
determined using an automatic sequencer, and the
results revealed that reDrTI has the same N-terminal
amino acid sequence (about 15 amino acid residues) as
native DrTI, except for two extra amino acid Gly-Ser at
the N-terminus (data not shown).
Trypsin inhibitory activity of GST-DrTI fusion protein
and reDrTI
The trypsin inhibitory activity of the fusion protein
and reDrTI was tested and compared with that of native
DrTI (Fig. 4). On a molar basis, the reDrTI and fusion
protein exhibited the same 50% inhibition concentration
as the native DrTI. The Ki value of the reDrTI was
21.9nM, the same as that of native DrTI.18)
General discussion
To clone the DrTI gene, PCR amplification was
Fig. 1.
Using DrTI Degenerate Primer Pairs Astart/Astop.
Lane M, 100bp ladder marker. Lane 1, PCR products obtained
with cDNA as a template. Lane 2, PCR products obtained with
genomic DNA as a template. Five ml of PCR reaction was applied to
the agarose gel, and the gel was stained with ethidium bromide.
Amplification of Delonix regia Gemonic DNA and cDNA
100 C.-H. HUNG et al.

Page 4

performed using Delonix regia genomic DNA isolated
from young leaves or cDNA isolated from maturing
seeds as a template and the same degenerate PCR
primers based on all possible sequences of the N-
terminal and C-terminal regions of DrTI. These ampli-
fied products had the same size as the genomic DNA and
cDNA. DNA sequence analysis of cDNA and genomic
clones of DrTI displayed the same nucleotide sequence
in the coding region. The correct nucleotide sequence of
the primer parts of DrTI was not observed in cDNA or
genomic clones because the DrTI clone included
degenerate primers. This result shows that the DrTI
gene did not contain intervening sequences in the coding
region. The amino acid sequence deduced from the
cDNA clone agreed with that determined by amino acid
sequencing analysis, excepts for the existence two
amino acid residues, Ser and Lys, between residues
Lys141 and Ser142 of the amino acid sequence. The
difference in amino acid sequence between the cDNA
and the protein of DrTI indicates that Delonix regia
contains several related trypsin inhibitor genes as
soybean (Glycine mnx) trypsin inhibitors.30,33)
This study obtained a final yield of 5–6mg of purified
reDrTI/liter-induced E. coli at 30?C. The reDrTI and
fusion protein had the same 50% inhibition concentra-
tion as the native DrTI. The Ki value of the reDrTI was
determined to be 21.9nM, the same as that of native
DrTI.
Fig. 2.Nucleotide Sequence of DrTI cDNA in the Coding Region and Its Deduced Amino Acid Sequence.
Locations of oligonucleotide primers used in primer extension analyses are shown by underlining. The box indicates the amino acids with
different sequence compared by amino acid sequence analysis.18)The GenBank accession numbers of the nucleotide sequences of DrTI cDNA
and genomic DNA in the coding region are DQ019824 and DQ019825, respectively.
Fig. 3.
reDrTI and Native DrTI.
Lane M, molecular-mass markers. Lane 1, GST-DrTI fusion
protein. Lane 2, fusion protein treated with thrombin. Lane 3,
glutathione S-transferase. Lane 4, reDrTI. Lane 5, native DrTI.
Twelve Percent SDS–PAGE Analysis of the Fusion Protein,
Molar ratio of inhibitor to trypsin
0.00.20.4 0.60.81.0 1.2
Residual protein activity (%)
0
20
40
60
80
100
Native DrTI
Fusion protein
re DrTI
GST
Fig. 4.
reDrTI and Native DrTI.
Increasing concentrations of inhibitor with respect were to a fixed
concentration of trypsin (2nM). Residual enzyme activity was
determined by using L-BAPNA as substrate. Native DrTI was
purified from Delonix regia seed as described elsewhere.18)Each
point is the mean of three assays.
Trypsin Inhibitor Activity of GST-DrTI Fusion Protein,
Genomic and cDNA Cloning of DrTI 101

Page 5

An interesting peculiarity of DrTI is that a Glu68
residue was found in the expected position for the
reactive site rather than an Arg or Lys, usually present in
other Kunitz-type inhibitors.18)Swartzia pickellii trypsin
inhibitor also contains a Glu residue in the reactive site
for trypsin.20)In the future, mutant proteins can perhaps
be utilized by site-directed mutagenesis to investigate
the role of Glu68 residue in trypsin inhibitory activity of
DrTI.
Acknowledgments
This work was supported by the National Science
Council of Taiwan, Republic of China, projects NSC92-
2622-B264-002-CC3 and NSC91-2314-B264-001.
References
1)Millerd, A., Biochemistry of legume seed proteins.
Annu. Rev. Plant Physiol., 26, 53–72 (1975).
Ryan, C. A., Protease inhibitor gene families: strategies
for transformation to improve plant defenses against
herbivores. BioEssays, 10, 20–24 (1989).
Broadway, R. M., Are insects resistant to plant protei-
nase inhibitors? J. Insect Physiol., 41, 107–116 (1995).
Koiwa, H., Bressan, R. A., and Hasegawa, P. M.,
Regulation of protease inhibitors and plant defense.
Trends Plant Sci., 2, 379–384 (1997).
Ryan, C. A., Proteolytic enzymes and their inhibitors in
plants. Annu. Rev. Plant Physiol., 24, 173–196 (1973).
Richardson, M., Seed storage proteins: the enzyme
inhibitors. In ‘‘Methods in Plant Biochemistry,’’ eds.
Dey, P. M., and Harborne, J. B., Academic Press, New
York, pp. 259–305 (1991).
Yeh, K. W., Chen, J. C., Lin, M. I., Chen, Y. M., and
Lin, C. Y., Functional activity of sporamin from sweet
potato (Ipomoea batatas Lam.): a tuber storage protein
with trypsin inhibitory activity. Plant Mol. Biol., 33,
565–570 (1997).
Hou, W. C., Lin, J. S., Chen, H. J., Chen, T. E., Chang,
C. F., and Lin, Y. R., Dioscorin, the major tuber storage
protein of yam (Dioscorea batatas decne) with carbonic
anhydrase and trypsin inhibitor activities. J. Agric. Food
Chem., 47, 2168–2172 (1999).
Schuler, T. H., Poppy, G. M., Kerry, B. R., and
Denholm, I., Insect-resistant transgenic plants. Trends
Biotechnol., 16, 168–175 (1998).
Heitz, T., Geoffroy, P., Fritig, B., and Legrand, M., The
PR-6 family: proteinase inhibitors in plant-microbe and
plant insect interactions. In ‘‘Pathogenesis-Related Pro-
teins in Plants,’’ eds. Datta, S. K., and Muthukrishan, S.,
CRC Press, Boca Raton, pp. 131–155 (1999).
Lee, S. I., Lee, S. H., Koo, J. C., Chun, H. J., Lim, C. O.,
Mun, J. H., Song, Y. H., and Cho, M. J., Soybean Kunitz
trypsin inhibitor (SKTI) confers resistance to the brown
planthopper (Nilaparvata lugens Stal) in transgenic rice.
Mol. Breed, 5, 1–9 (1999).
Oliva, M. L. V., Souza-Pinto, J. C., Batista, I. F. C.,
Araujo, M. S., Silveira, V. F., Auerswald, E. A.,
Mentele, R., Eckerskorn, C., Sampaio, M. U., and
Sampaio, C. A. M., Leucaena leucocephala serine
2)
3)
4)
5)
6)
7)
8)
9)
10)
11)
12)
proteinase inhibitor: primary structure and action on
blood coagulation, kinin release and rat paw edema.
Biochim. Biophys. Acta, 1477, 64–74 (2000).
DeClerck, Y. A., Imren, S., Montgomery, A. M.,
Mueller, B. M., Reisfeld, R. A., and Laug, W. E.,
Proteases and protease inhibitors in tumor progression.
Adv. Exp. Med. Biol., 425, 89–97 (1997).
Kennedy, A. R., The Bowman-Birk inhibitor from
soybeans as an anticarcinogenic agent. Am. J. Clin.
Nutr., 68, 1406S–1412S (1998).
Lin, J. Y., Hsieh, Y. S., and Chu, S. C., Chimeric protein:
abrin B chain-trypsin inhibitor conjugate as a new
antitumor agent. Biochem. Int., 19, 313–323 (1989).
Armstrong, W. B., Kennedy, A. R., Wan, X. S., Taylor,
T. H., Nguyen, Q. A., Jensen, J., Thompson, W.,
Lagerberg, W., and Meyskens, F. L. Jr., Clinical
modulation of oral leukoplakia and protease activity
by Bowman-Birk inhibitor concentrate in a phase IIa
chemoprevention trial. Clin. Cancer Res., 6, 4684–4691
(2000).
Richardson, M., ‘‘Methods in Plant Biochemistry’’Vol. 5,
eds. Dey, P. M., and Harborne, J. B., Academic Press,
New York (1991).
Pando, S. C., Oliva, M. L. V., Sampaio, C. A. M., Di
Ciero, L., Novello, J. C., and Marangoni, S., Primary
sequence determination of a Kunitz inhibitor isolated
from Delonix regia seeds. Phytochemistry, 57, 625–631
(2001).
Koide, T., and Ikenaka, T., Studies on soybean trypsin
inhibitor: amino acid sequence of the carboxyl terminal
region and the complete amino acid sequence of soybean
trypsin inhibitor (Kunitz). Eur. J. Biochem., 32, 417–431
(1973).
do Socorro, M., Cavalcanti, M., Oliva, M. L., Fritz, H.,
Jochum, M., Mentele, R., Sampaio, M., Coelho, L. C.,
Batista, I. F., and Sampaio, C. A., Characterization of
a Kunitz trypsin inhibitor with one disulfide bridge
purified from Swartzia pickellii. Biochem. Biophys. Res.
Commun., 291, 635–639 (2002).
Yamamoto, M., Hara, S., and Ikenaka, T., Amino acid
sequences of two trypsin inhibitors from winged bean
seeds (Psophocarpus tetragonolobus (L)DC.). J. Bio-
chem., 94, 849–863 (1983).
Batista, I. F. C., Oliva, M. L. V., Araujo, M. S., Sampaio,
M. U., Richardson, M., Fritz, H., and Sampaio, C. A. M.,
Primary structure of a Kunitz-type trypsin inhibitor from
Enterolobium contortisiliquum seeds. Phytochemistry,
41, 1017–1022 (1996).
Di Ciero, L., Oliva, M. L. V., Torquato, R., Kohler, P.,
Weder, J. K. P., Novello, J. C., Sampaio, C. A. M.,
Oliveira, B., and Marangoni, S., The complete amino
acid sequence of a trypsin inhibitor from Bauhinia
variegata var. candida seeds. J. Protein Chem., 17, 827–
834 (1998).
Wu, H. C., and Lin, J. Y., The complete amino acid
sequence of a Kunitz family trypsin inhibitor. J.
Biochem., 113, 258–263 (1993).
Kuribara, H., Shindo, Y., Matsuoka, T., Takubo, K.,
Futo, S., Aoki, N., Hirano, T., Akiyama, H., Goda, Y.,
Toyoda, M., and Hino, A., Novel reference molecules
for quantitation of genetically modified maize and
soybean. J. AOAC Int., 85, 1077–1089 (2002).
Sambrook, J., Russell, D. W., ‘‘Molecular Cloning: a
13)
14)
15)
16)
17)
18)
19)
20)
21)
22)
23)
24)
25)
26)
102 C.-H. HUNG et al.