Deep sea immunity: unveiling immune constituents from the hydrothermal vent mussel Bathymodiolus azoricus.

Abstract

Marine molluscs are subjected to constant microbial threats in their natural habitats. As a result, they represent suitable models for the study of the molecular mechanisms that govern defense reactions in marine organisms. To understand humoral and cellular defense reactions in animals defying extreme physical and chemical conditions we set out to investigate the deep sea hydrothermal vent mussel Bathymodiolus azoricus found in abundance at the Mid-Atlantic Ridge. In the present study, hemocytes were stimulated with compounds of microbial origin and cellular morphological alterations as well as the production of superoxide assessed. Consequently, zymosan, glucan and peptidoglycan were considered as potent inducers of cellular reactions for inducing drastic cell morphology changes and high levels of superoxide production. Furthermore, we have presented for the first time in a deep sea hydrothermal vent animal, molecular evidence of the Rel-homology domain, a conserved motif present in all members of the Rel/nuclear-factor NF-kappaB family. Additionally we have demonstrated the occurrence of the antibacterial gene mytilin in Bathymodiolus azoricus gill tissues. Our results support the premise of an evolutionary conserved innate immune system in Bathymodiolus. Such system is seemingly homologous to that of Insects and other Bivalves and may involve the participation of NF-kappaB transcription factors and antibacterial genes.

Full text

Page 1

Accepted Manuscript
Deep sea immunity: Unveiling immune constituents from the hydrothermal vent
mussel Bathymodiolus azoricus
Raul Bettencourt, Philippe Roch, Sergio Stefanni, Domitíla Rosa, Ana Colaço,
Ricardo Serrão Santos
PII:
DOI:
Reference:
S0141-1136(07)00005-0
10.1016/j.marenvres.2006.12.010
MERE 3090
To appear in: Marine Environmental Research
Received Date:
Revised Date:
Accepted Date:
27 September 2006
20 December 2006
28 December 2006
Please cite this article as: Bettencourt, R., Roch, P., Stefanni, S., Rosa, D., Colaço, A., Santos, R.S., Deep sea
immunity: Unveiling immune constituents from the hydrothermal vent mussel Bathymodiolus azoricus, Marine
Environmental Research (2007), doi: 10.1016/j.marenvres.2006.12.010
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
peer-00501899, version 1 - 13 Jul 2010
Author manuscript, published in "Marine Environmental Research 64, 2 (2007) 108"
DOI : 10.1016/j.marenvres.2006.12.010

Page 2

ACCEPTED MANUSCRIPT


1
Deep sea immunity: unveiling immune constituents from the hydrothermal vent
mussel Bathymodiolus azoricus.

Raul Bettencourt*, Philippe Roch1, Sergio Stefanni, Domitíla Rosa, Ana Colaço,
Ricardo Serrão Santos

IMAR/Department of Oceanography and Fisheries, University of the Azores, 9901-
862 Horta, Portugal
1) UMR CNRS EcoLag, University of Montpellier 2, case courrier 093, F-34095
Montpellier, France


*Correspondence:
Raul Bettencourt, PhD
University of the Azores
Department of Oceanography and Fisheries
Genetics and Molecular Laboratory
Rua Comendador Fernando da Costa.
9900-862 Horta
Portugal
Tel: +351-292200400
Fax: +351-292200411
Email: raul@notes.horta.uac.pt

Key Words: innate immunity, transcription factor NF-κB, antibacterial response, deep
sea, hydrothermal vent, Bivalve, Bathymodiolus azoricus

Running title: Innate immunity in hydrothermal vent mussel
peer-00501899, version 1 - 13 Jul 2010

Page 3

ACCEPTED MANUSCRIPT


2
Abstract
Marine molluscs are subjected to constant microbial threats in their natural
habitats. As a result, they represent suitable models for the study of the molecular
mechanisms that govern defense reactions in marine organisms. To understand humoral
and cellular defense reactions in animals defying extreme physical and chemical
conditions we set out to investigate the deep sea hydrothermal vent mussel
Bathymodiolus azoricus found in abundance at the Mid-Atlantic-Ridge. In the present
study, hemocytes were stimulated with compounds of microbial origin and cellular
morphological alterations as well as the production of superoxide assessed.
Consequently, zymosan, glucan and peptidoglycan were considered as potent inducers
of cellular reactions for inducing drastic cell morphology changes and high levels of
superoxide production. Furthermore, we have presented for the first time in a deep sea
hydrothermal vent animal, molecular evidence of the Rel-homology domain, a
conserved motif present in all members of the Rel/nuclear-factor NF-κB family.
Additionally we have demonstrated the occurrence of the antibacterial gene mytilin in
Bathymodiolus azoricus gill tissues. Our results support the premise of an evolutionary
conserved innate immune system in Bathymodiolus. Such system is seemingly
homologous to that of Insects and other Bivalves and may involve the participation of
NF-κB transcription factors and antibacterial genes.






peer-00501899, version 1 - 13 Jul 2010

Page 4

ACCEPTED MANUSCRIPT


3
1. Introduction

Ancestral metazoans rely on innate immune mechanisms to eliminate infectious
microorganisms. Their survival is thus ensured through efficient recognition of
microbes and the subsequent activation of host mechanisms that involve cell-mediated
and humoral reactions. Additionally, most invertebrates are equipped with a thick
cuticle that acts as a first line of defense, somewhat like human skin or a physical
barrier that excludes pathogens from entering the host. If the cuticle is breached
allowing pathogen entry, sensitive recognition of microbial surface elements commonly
referred as pathogen associated molecular patterns (PAMPs) will incur, followed by a
rapid activation of cellular effectors such as circulating hemocytes or macrophage-like
cells, and by the participation of humoral factors with antimicrobial, cytotoxic
properties or with opsonin-like properties, facilitating phagocytosis reactions.
Insects, Molluscs and Crustaceans are emerging as suitable genetic and molecular
models for the study of innate immune reactions (Leclerc and Reichhart, 2004; Gross et
al., 2001; Bachère et al., 2004). Many gene products and signaling pathways share
striking similarities between Mammals and Invertebrate innate immune reactions
suggesting conserved mechanisms in the course of which, evolution privileged those
responsible for the induction and transcriptional control of immune genes (Hoffmann
and Reichhart, 2002). Perhaps the best example is the Toll receptor, first discovered and
characterized in Drosophila and more recently in Mammals. Protein members of the
transcription factor NF-kappaB family share a highly conserved 300 amino acids
domain named the Rel homology domain (RHD). The RHD is essential for DNA
binding and its function is important for the transcription of immune or inflammatory
genes (Baltimore and Beg, 1995). NF-κB transcription factor homologues have been
peer-00501899, version 1 - 13 Jul 2010

Page 5

ACCEPTED MANUSCRIPT


4
extensively studied in insects and recently characterized in molluscs (Montagnani et al.,
2004). Internal defense in bivalve molluscs is essentially based on innate reactions
involving a variety of cell types and effector molecules of which phagocytic hemocytes
(blood cells) and degradative, oxidative enzymes and the generation of highly reactive
oxygen intermediates (ROIs) play a prominent role in the defense against pathogens
(Wootton and Pipe, 2003). While general immune reactions comprise potent reactive
oxygen intermediates (ROIs) and antimicrobial agents to eliminate or neutralize
infectious microorganisms (Anderson, 1994) some bivalve species do not appear to
generate oxygen metabolites and in some studies, there is evidence suggesting a high
inter-species variability of ROIs production (Lopez et al., 1994; Wooton and Pipe,
2003; Wootton et al., 2003). In addition, cell-free hemolymph possesses several
biological peptides active against bacterial infection (Hubert et al., 1996a; Charlet et al.,
1996) and soluble lectins with agglutinin properties (Wootton and Pipe, 2003; Wootton
et al., 2003).
Oysters, Crassostrea genera and mussels, Mytilus genera are among the most
intensively studied bivalves clearly for reasons concerning their economical importance,
the environmental monitoring of pollutants and the prevention and spread of
invertebrate diseases and human pathogens. Understanding how their biological systems
cope with microbial infestation represents the opportunity to study and provide new
insights into the basic physiological principles that govern the defense mechanisms in
Molluscs.
Bivalve molluscs are found in abundance dwelling around deep sea
hydrothermal vent sites. In the present case-study they are located near the Mid-Atlantic
Ridge in the Azores region. Their physiological adaptation to extreme physical and
chemical conditions raises interesting biological questions. Deep sea hydrothermal vent
peer-00501899, version 1 - 13 Jul 2010

Page 6

ACCEPTED MANUSCRIPT


5
environments are considered highly toxic according to usual life standards, yet the
animals subsisting at the vent sites exhibit high productivity and therefore must
efficiently cope and tolerate unusual levels of heavy metals, pH, temperature, CO2 and
sulfide, in addition to environmental microbes (Santos et al., 2003). The problem of
microbial threat and the need for immunity exist in both deep sea and shallow water
bivalves however differences in the genes of marine organisms living in so distinct
habitats are likely to occur.
In a first attempt to understand how the extreme physical and chemical
conditions to which vent mussels have adapted can affect their host defense reactions,
we set out to identify, components of an innate immune system in Bathymodiolus
azoricus. The present report reveals for the first time the presence of a putative Rel
Homology Domain (RHD) containing gene identified in gills and antibacterial genes
such as mytilin in Bathymodiolus azoricus. Additionally, the laboratory set up to which
vent mussels were acclimatized was regarded as a suitable and amenable system to
study hemocyte reactions even in the absence of the characteristic high hydrostatic
pressure found at deep sea vent sites. We proposed that Bathymodiolus azoricus is
equipped with evolutionary conserved immune factors commonly found in other marine
bivalves. Moreover, our results provide molecular tools that can be applied to evaluate
the effect of extreme environmental factors on host immune reactions in deep sea
hydrothermal vent mussels.





peer-00501899, version 1 - 13 Jul 2010

Page 7

ACCEPTED MANUSCRIPT


6
2. Methods and Materials

2.1. Animal collection and tissue preparation

Mussels were collected using the French ROV Victor 6000 (R/V Atalante,
IFREMER) during the EXOMAR cruise (July 27th- August 2nd 2005) from the Lucky
Strike (37 o 13.52’ N, 32o 26.18’ W; 1700 m depth) hydrothermal vent site, in the
vicinity of the Mid Atlantic Ridge (MAR). Once the mussels were brought to the
surface, they were immediately processed onboard or left in fresh cooled seawater for
subsequent manipulation and acclimatization in the Azorean land-based hydrothermal
vent laboratory set up, LabHorta (Colaço et al., 2003). For the maintenance of
Bathymodiolus azoricus under post-capture conditions, physical and chemical
parameters were essentially followed as described in Kaddar et al. (2005). For
comparative studies, the clam Ruditapes decussatus was collected from the coastal
lagoon on São Jorge Island in the Azores and the mussel Mytilus galloprovincialis was
obtained from a shellfish farm in southern France. The hard clam Mercenaria
mercenaria was obtained from a local hatchery in Long Island, New York. Both M.
galloprovincialis and M. mercenaria tissues were processed during R.B visits to Prof
Philippe Roch (University of Montpellier, France) and to Dr Bassem Allam (Marine
Science Research Center, SUNY Stony Brook, USA) laboratories, respectively. Gill
tissues were either preserved for histological observations according to standard
protocols using 5% formalin and 70% Ethanol solutions or used fresh in addition to
hemocytes, in conformity with cellular studies and antibacterial assays.


peer-00501899, version 1 - 13 Jul 2010

Page 8

ACCEPTED MANUSCRIPT


7
2.2. Hemocyte reactions and Antibacterial assays

Hemolymph was withdrawn from B. azoricus by introducing a syringe through
the posterior adductor muscle and deposited directly onto a sterile microscope glass
slide. To each slide containing approximately 100 µl of hemolymph, an additional 20 µl
of distinct commercially available pathogen associated molecular pattern (PAMPs)
suspensions (10 µg/ml) were added and covered with a cover slip. Slides were kept in a
humid chamber for 15 min and hemocyte reactions observed under light microscopy.
The following PAMPs suspensions of microbial origin, were used in a similar procedure
as described in Bettencourt et al. (2004): Zymosan (a carbohydrate derivative from the
yeast cell wall of Saccharomyces cerevisiae, Sigma Z 4250), β-1,3-glucan (a
polysaccharide extracted from the cell wall of the seaweed algae Laminaria digitata,
Sigma L-9634), Peptidoglycan (a polymer consisting of carbohydrate and amino acids
from the bacterial cell wall of Staphylococcus aureus, Fluka 77140), Lipopolysaccharide
(also known as bacterial endotoxin LPS, a major molecule of cell membrane from gram-
negative bacteria, consisting of a lipid and a polysaccharide,, extracted from Escherichia
coli 055:B5, Sigma L-4524),. In addition, 10 µM phorbol-12-myristate-13-acetate
(known as PMA, a human lymphocyte proliferation inducer, Sigma P-8139) diluted in
phosphate buffer saline was used in incubations with freshly withdrawn hemolymph.
The generation of superoxide (02-º) by hemocyte suspensions was monitored
according to the procedures of Anderson et al. (1994) and Arumugam et al. (2000) with
minor modifications. Briefly, an aliquot of 1 ml hemocyte suspension in sterilized sea
water (containing 108 cells/ml) was incubated with an equal volume of 0.1% of Nitro
blue tetrazolium chloride (NBT), with or without chemicals of microbial origin (100 µl of
the following, 1X yeastolate (a yeast extract, Invitrogren®), zymosan (10mg/ml), glucan
peer-00501899, version 1 - 13 Jul 2010

Page 9

ACCEPTED MANUSCRIPT


8
(10 mg/ml), peptidoglycan (10mg/ml), Lipopolysaccharide (LPS) (10 mg/ml) and PMA
(10 µM), at room temperature and for 60 min. Control experiment consisted of
incubations with sterilized sea water. After centrifugations and resuspensions described
in Arumugam et al. (2000), the optical density of supernatants obtained from controls
and stimulated hemocytes were read at 630 nm from four independent experiments.
For antibacterial assays, whole gill and hemocyte homogenates from B. azoricus
were prepared with Phosphate Buffer saline containing proteases inhibitors (Sigma®,
Protease inhibitor cocktail P2714) and tested in agar based Luria-Bertani medium plates
overlaid with a bacterial-agar lawn (0.7% top agar layer). Bacterial growth-inhibition
assays were carried out with one of the following bacterial strains (1 × 107 cfu/ml):
Micrococcus luteus, Enterobacter cloacae, Escherichia coli, Pseudomonas aeruginosa,
Bacillus subtilis and Staphylococcus aureus.

2.3 RNA extraction, Reverse Transcription-Polymerase Chain Reaction and sequencing

Total RNA from Bathymodiolus azoricus gill tissues was extracted with
TRIZOL (Life Technology®) according to manufacturer’s instructions and re-suspended
in nuclease-free water. The quality of total RNA preparations was assessed in agarose
gel electrophoresis using the standard denaturing formaldehyde procedure. For the first
strand cDNA synthesis or reverse transcriptase reaction (RT), the Moloney Murine
Leukemia Virus (M-MLV) reverse transcriptase enzyme (Promega) was utilized
according to manufacturer’s instructions and using 5 µg total RNA in 50 µl total volume
reactions containing RNAse inhibitor. Subsequently, 5 µl of RT reactions were mixed to
a Polymerase Chain Reaction (PCR) master mix (PCR Master Mix, Promega®)
containing appropriate PCR buffer, deoxyribonucleotide triphosphates (dNTPs)
peer-00501899, version 1 - 13 Jul 2010

Page 10

ACCEPTED MANUSCRIPT


9
(10mM), Taq polymerase and degenerated or sequence-specific oligonucleotides as
primers to target immune-related genes from B. azoricus. In order to identify members
of the inflammatory transcription factor Rel/NF-κB gene family, the Rel homology
domain (RHD), was chosen for its conserved DNA binding domain sequence homology
among different taxonomic groups. Thus, multiple sequence alignments retrieved from
the Protein families data base of alignments (Pfam) web site based at the Sanger
Institute, UK (http://www.sanger.ac.uk/Software/Pfam/index.shtml) were selected for
the design of degenerated primers. The aligned sequences included RHDs from
Drosophila melanogaster, Crassostrea gigas, Strongylocentrotus purpuratus, and
Halocynthia roretzi. The sense degenerated primer was based on the amino acid
sequence RFRYECE and corresponded to: 5’-MGNTTYMGNTAYGARTGYGAR-3’.
The antisense degenerated primer was based on the amino acid sequence VVRLCFQ
and corresponded to: 5’-YTGRAARCANARNCKNACNAC-3’. Both primers were
manufactured by INVITROGEN using the following IUB codes to identify non-
standard or mixed bases: M= A+C; K= T+G; R= A+G; N= A+C+G+T; Y= C+T.
Sequence-specific primers for DNA amplification of the Rel domain in B.
azoricus was determined after successful sequencing of PCR products obtained in RT-
PCR experiments using Mytilus galloprovincialis RNA and the above mentioned
degenerated primers. The RHD sequence-specific sense primer was: 5’-
TATGAGTGCGAGGGAAGATCT-3’ and the RHD sequence-specific anti-sense
primer was: 5’-GAAAGGGTCAACGTTGATTTC-3’. Thermocycling conditions were
performed taking in account primer’s degeneracy and lower annealing temperatures.
Thus, a 50 µl volume reaction containing 5µl of RT product, 4 µl of the sense and anti-
sense primers (total of 80 pmol each), 5 µl of 25 mM MgCl2, 5 µl of 10X PCR enhancer
solution (Invitrogen), 6 µl of PCR grade water and 25 µl of 2X PCR Mix (Promega®)
peer-00501899, version 1 - 13 Jul 2010

Page 11

ACCEPTED MANUSCRIPT


10
was subjected to the following thermocycling conditions: Initial denaturing step at 94º C
for 2 min, followed by 10 cycles of denaturation at 94º C for 1 min, annealing at 48º C
for 2 min and extension at 70º C for 1.30 min. Subsequently, cycling reactions followed
another round of 35 cycles of denaturation at 94º C for 30 sec, annealing at 52º C for 1
min and extension at 70º C for 1 min. PCR reaction terminated with a final extension at
70º C for 10 min. When using sequence-specific RHD primers thermocycling
conditions were slightly different: Initial denaturing step at 94º C for 2 min, followed by
10 cycles of denaturation at 94º C for 1 min, annealing at 52º C for 1 min and extension
at 70º C for 1 min. Cyclic reactions followed another round of 25 cycles of denaturation
at 94º C for 30 sec, annealing at 56º C for 30 sec and extension at 70º C for 30 sec. PCR
reaction ended with a final extension at 70º C for 10 min. PCR products were examined
on 1.5% agarose gel electrophoresis using Tris-boric acid-EDTA buffer and ethidium
bromide for DNA visualization, according to standard protocol. 1 KB Plus DNA ladder
(Invitrogen) was used as a marker. To identify RHD cDNA in Ruditapes decussatus and
Mercenaria mercenaria, similar experimental approach was used as described above.
In an attempt to target antibacterial genes in B. azoricus we also used sequence-
specific primers based on Mytilus galloprovincialis mytilin and defensin MGD2 genes
in RT-PCR experiments. The mytilin sense and anti-sense primers were:
5’
GTTATTCTGGCTATCGCTCTTG 3’ and 5’GTATAATGTCAAACAGAACGGGTC 3’
respectively. The defensin MGD2 sense and anti-sense primers were:
5’CAGCATTCGTCTTGTTGGTGG
3’ and
5’CGCATCTATAGCATGTGCACC
3’,
respectively. All PCR amplicons were gel extracted with the Wizard SV GEL and PCR
Clean-Up System (Promega), re-suspended in double distilled H2O and submitted to
nucleotide sequencing with both sense and anti-sense primers, through the BMR-
Genomics sequencing facility at the University of Padova, Italy (http://www.bmr-
peer-00501899, version 1 - 13 Jul 2010

Page 12

ACCEPTED MANUSCRIPT


11
genomics.it/). Database sequence homology searches were performed with the Web-
based BLAST search tool available at: http://www.ncbi.nlm.nhi.gov. RHD sequences
were submitted to GenBank (National Center for Biotechnology Information, Bethesda
MD) and given the following accession references: Bathymodiolus azoricus RHD,
DQ673621; Mercenaria mercenaria RHD, DQ673622; Mytilus galloprovincialis RHD,
DQ673623 and Ruditapes decussatus RHD, DQ673624.

2.4. Amino acid alignment and phylogenetic analysis

The predicted RHD amino acid sequences from Bathymodiolus azoricus, Mytilus
galloprovincialis, Ruditapes decussatus and Mercenaria mercenaria were compared to
other RHD amino acid sequences from Tubifex tubifex GenBank accession No
BAD60879; Drosophila melanogaster GenBank accession No AAT94434, Halocynthia
roretzi GenBank No BAD47173, Danio rerio GenBank accession No AA026402,
Xenopus laevis GenBank accession No AAH70711 and Homo sapiens GenBank
accession No AAH11603. Complete alignment was performed with CLUSTAL X
(Thompson et al., 1997) with the following changes to the default values: gap opening
penalty = 35.00 and gap extension penalty = 0.75 in the pairwise alignment parameters;
and gap opening penalty = 15.00 and gap extension penalty = 0.30 in the multiple
alignment parameters.
The phylogenetic tree of the RDH amino acid sequences was constructed using
MEGA version 3.1 (Kumar et al., 2004). The neighbor-joining (NJ) algorithm (Saitou
and Nei, 1987) was implemented to construct a phylogenetic tree from the Poisson
correction distances (Nei and Kumar, 2000). The support for internal branches within
the NJ tree was assessed using the bootstrap (Felsenstein, 1985) with 1000 replicates.
peer-00501899, version 1 - 13 Jul 2010

Page 13

ACCEPTED MANUSCRIPT


12

2.5. Whole mount and paraffin tissue sections in-situ hybridization

Single gill filaments were separated from formalin-70% Ethanol preserved gill
tissues from B. azoricus and analyzed for the presence of Rel/NF-κB and mytilin
transcripts according to Tautz (1996) and Braissant & Wahli (1998) with minor
modifications. Since filaments were originally fixed, a pre-treatment step was carried
out with Phosphate Buffered Saline (PBS) containing 0.1% Triton X 100 for 15 min at
room temperature after which a mild treatment with PBS containing 50 µg/ml of
proteinase K was performed for 5 min at room temperature. The proteinase K digestion
time is critical for subsequent steps since filaments are made up of two coalescent
unicellular layers of endothelial-like cells. After proteinase K digestion, filaments were
washed thoroughly with PBS containing 0.1% Triton X 100 and re-fixed for 15 min
with 4% paraformaldehyde in PBS. Two subsequent washes were performed with PBS-
Triton X solution and finally filaments were equilibrated with 5X SSC (NaCl 0.75M,
Na-Citrate 0.075M) before pre-hybridization. Pre-hybridization was carried out as
described in Braissant & Wahli (1998) for 6 hours at 55 ºC after which the hybridization
reaction was performed at 55ºC for 16 hours. A PCR-generated probe corresponding to
RHD (see above) was biotinylated (Biotin-High Prime, Roche Diagnostics) and used to
detect Rel/NF-κB messengers (mRNA). In addition, a cDNA probe corresponding to
mytilin was generated by PCR, biotinylated and used to target the antibacterial gene
mytilin. After hybridization, filaments were washed for 30 min in 2X SSC, at room
temperature, 2 times 30 min in 2X SSC at 55 ºC and 2 times 30 min in 0.1X SSC at 55
ºC. Filaments were then equilibrated in (buffer 1) 100 mM Tris-HCl, 150 mM NaCl, pH
7.5 for 15 min and incubated with the same buffer containing streptavidin-alkaline
peer-00501899, version 1 - 13 Jul 2010

Page 14

ACCEPTED MANUSCRIPT


13
phosphatase conjugate (Roche Diagnostics) diluted 1:5000 and 1% blocking reagent
(Roche Diagnostics) for 6 hours or over night. After thorough washes with buffer 1, an
additional incubation was performed with (buffer 2) 100 mM Tris-HCl, 100 mM NaCl
and 50 mM MgCl2, pH 9.5. Color development was performed at room temperature in
buffer 2 containing 0.02% BCIP and 0.03% NBT. The resulting color may vary
depending on the amount of transcript but visualization was typically detected in B.
azoricus gills within 1-3 hours. Control experiments were carried out using an unrelated
PCR generated 300 bp cDNA fragment (calf thymus gene, Clontech) labeled with
Biotin-High Prime (Roche Diagnostics). To detect and localize specific Rel/NF-κB and
mytilin mRNAs in paraffin-embedded tissue sections, gill tissues were preserved
according to standard histological procedures using an automated tissue processor
(LEICA TP 1020) and sectioned with a manual microtome (LEICA RM 2035). Pre-
hybridization and hybridization were as mentioned above for whole mount tissues
experiments.

3. Results

3.1. Cellular reactions an antibacterial assays

In the present study we subjected freshly withdrawn hemolymph from B.
azoricus to sterile sea water solutions containing different purified compounds of
microbial origin (pathogen-associated molecular patterns, PAMPs). These compounds
have been utilized as inducers of innate immune reactions in different taxonomic
groups. Stimulation of hemocytes present in the hemolymph was clearly induced as
morphological changes such as philopodia extensions and degranulation were observed
peer-00501899, version 1 - 13 Jul 2010

Page 15

ACCEPTED MANUSCRIPT


14
during exposures to zymosan, β-glucan or peptidoglycan whereas lipopolysaccaride
(LPS) and phorbol myristate acetate (PMA) did not have a visible effect on cell
morphology (Fig 1A). The apparent lack of responsiveness to PMA stimulation is
somewhat intriguing as this molecule is a well known stimulant of Protein Kinase C
activity in immune competent cells of mammalian and invertebrate systems. To further
investigate the hemocyte activation as a result of exposure to immune inducers, we
assessed the production of superoxide by means of a colorimetric assay based on the
reduction of nitro blue tetrazolium and the formation of formazan. The gram+ bacterial
cell wall component, peptidoglycan and yeast derivatives such as zymosan and glucan
did induce high levels of free oxygen radicals. In contrast, such induction was markedly
reduced when LPS and PMA were used (Fig. 1B). Thus, the cellular morphological
alterations visualized with zymosan, glucan and peptidoglycan seemed to compare with
the elevated levels of O2-º produced. Although no obvious morphological changes could
be visualized with LPS and PMA, their effect on the superoxide production was clearly
above the levels obtained in control experiments (Fig 1B).
To test antibacterial activity in gill and hemocytes extracts, we used LB agar
plates overlaid with an agar bacterial lawn. Antibacterial activity was observed in both
gill and hemocyte extracts only against the gram-positive bacteria M. luteus, whereas
activity against B. subtilis and E. cloacae was observed only in gill extracts. Both
extracts did not present activity against E. coli, S. aureus and P. aeroginosa (Fig. 2).
The reduced growth inhibition zone when using twice the amount of M. luteus on
bacterial plates indicates that the amount of bacteria could be a limiting factor of
antibacterial activity.


peer-00501899, version 1 - 13 Jul 2010