Detection and quantification of Entomophaga maimaiga resting spores in forest soil using real-time PCR.

Abstract

Environmental sampling to monitor entomopathogen titre in forest soil, a known reservoir of insect pathogens such as fungi and viruses, is important in the evaluation of conditions that could trigger epizootics and in the development of strategies for insect pest management. Molecular or PCR-based analysis of environmental samples provides a sensitive method for strain- or species-based detection, and real-time PCR, in particular, allows quantification of the organism of interest. In this study we developed a DNA extraction method and a real-time PCR assay for detection and quantification of Entomophaga maimaiga (Zygomycetes: Entomophthorales), a fungal pathogen of the gypsy moth, in the organic layer of forest soil. DNA from fungal resting spores (azygospores) in soil was extracted using a detergent and bead mill homogenization treatment followed by purification of the crude DNA extract using Sephadex-polyvinylpolypyrrolidone microcolumns. The purification step eliminated most of the environmental contaminants commonly co-extracted with genomic DNA from soil samples but detection assays still required the addition of bovine serum albumin to relieve PCR inhibition. The real-time PCR assay used primers and probe based on sequence analysis of the nuclear ribosomal ITS region of several E. maimaiga and two E. aulicae strains. Comparison of threshold cycle values from different soil samples spiked with E. maimaiga DNA showed that soil background DNA and remaining co-extracted contaminants are critical factors determining detection sensitivity. Based on our results from comparisons of resting spore titres among different forest soils, estimates were best for organic soils with comparatively high densities of resting spores.

Full text

Page 1

Detection and quantification of Entomophaga maimaiga
resting spores in forest soil using real-time PCR
Louela A. CASTRILLO*, Lene THOMSEN, Punita JUNEJA, Ann E. HAJEK
Department of Entomology, Cornell University, Ithaca, NY 14853-2601, USA
a r t i c l e i n f o
Article history:
Received 28 September 2006
Received in revised form
1 December 2006
Accepted 7 January 2007
Published online 26 January 2007
Corresponding Editor:
Richard A. Humber
Keywords:
Azygospores
DNA extraction
Entomophthoraceae
Entomophthorales
Forest soil
Zygomycetes
Zygomycota
a b s t r a c t
Environmental sampling to monitor entomopathogen titre in forest soil, a known reservoir
of insect pathogens such as fungi and viruses, is important in the evaluation of conditions
that could trigger epizootics and in the development of strategies for insect pest manage-
ment. Molecular or PCR-based analysis of environmental samples provides a sensitive
method for strain- or species-based detection, and real-time PCR, in particular, allows
quantification of the organism of interest. In this study we developed a DNA extraction
method and a real-time PCR assay for detection and quantification of Entomophaga mai-
maiga (Zygomycetes: Entomophthorales), a fungal pathogen of the gypsy moth, in the organic
layer of forest soil. DNA from fungal resting spores (azygospores) in soil was extracted us-
ing a detergent and bead mill homogenization treatment followed by purification of the
crude DNA extract using Sephadex–polyvinylpolypyrrolidone microcolumns. The purifica-
tion step eliminated most of the environmental contaminants commonly co-extracted
with genomic DNA from soil samples but detection assays still required the addition of bo-
vine serum albumin to relieve PCR inhibition. The real-time PCR assay used primers and
probe based on sequence analysis of the nuclear ribosomal ITS region of several E. mai-
maiga and two E. aulicae strains. Comparison of threshold cycle values from different soil
samples spiked with E. maimaiga DNA showed that soil background DNA and remaining
co-extracted contaminants are critical factors determining detection sensitivity. Based
on our results from comparisons of resting spore titres among different forest soils, esti-
mates were best for organic soils with comparatively high densities of resting spores.
ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Introduction
Entomopathogenic fungi can have a significant impact on
arthropod population densities, both through continuously
present low levels of infection or through development of
epizootics. These fungi persist through time in reservoirs in
the soil. Thus, studying entomopathogenic fungi in the soil is
important to understanding the epizootiology of diseases
causedbythesepathogens.Somehypocrealeanfungiinfecting
arthropodsareculturableandselectivemediaareavailablefor
their extraction and quantification from soil (Hajek et al. in
press). However, an important fungal group, the order Ento-
mophthorales, is more fastidious and cannot be cultured from
soil. An alternative method of detection uses standard, or
end-point, PCR with species- or strain-specific markers, as
has been developed for soil-borne stages of a number of ana-
morphic entomopathogens in the Hypocreales (e.g., Castrillo
et al. 2003; Entz et al. 2005). Although these methods can be
* Corresponding author.
E-mail address: lac48@cornell.edu
0953-7562/$ – see front matter ª 2007 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
doi:10.1016/j.mycres.2007.01.010
available at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/mycres
mycological research 111 (2007) 324–331

Page 2

sensitive, they do not adequately quantify fungi in soil sam-
ples. Regardless, such methods have not been developed for
species in the order Entomophthorales.
The fungal pathogen Entomophaga maimaiga (Zygomycetes:
Entomophthorales) has been of particular interest based on
therecurrence ofepizooticsthathavemaintainedpopulations
of the gypsy moth (Lymantria dispar), a forest defoliator capa-
ble of devastating outbreaks, under control in many areas of
the USA. This host-specific fungal pathogen is native to Asia
(Nielsen et al. 2005) and was first found in the USA in 1989
(Andreadis & Weseloh 1990; Hajek et al. 1990b), after which
time it spread across the contiguous distribution of the gypsy
mothin northeastern USA.E. maimaiga infectsgypsymoth lar-
vae during the approximately two-month period they are
present in spring (Hajek 1999). The fungus actively ejects con-
idia from infected larval cadavers, but once late instar larvae
are present, the fungus usually produces thick-walled azygo-
spores (resting spores) within cadavers that are left hanging
on tree trunks. These cadavers fall from tree trunks, and rest-
ing spores are leached into the organic layer of soil.
Atpresent,one methodhas beendevelopedforquantifying
E. maimaiga resting spores in soil based on visual counts after
wet sieving followed by density gradient centrifugation
(Hajek & Wheeler 1994). However, this method is very time-
consuming.Alternativemethodsthatarelesstime-consuming
rely on visual counts of resting spores, but these are also less
accurate (Weseloh & Andreadis 2002). Most species of
Entomophthorales produce resting spores, which have few dis-
tinctivemorphologicalfeaturestoallowdiscriminationamong
different species.
Real-time PCR, which allows quantification of starting
nucleic acid of target organisms in a reaction using fluores-
cent detection techniques, has been developed for detection
and quantification of several species of fungi in soil (Lees
et al. 2002; Atkins et al. 2003; Kabir et al. 2003). This method
offers greater sensitivity and precision than conventional
end-point PCR and yields accurate quantification of target
organisms.
The objectives of the present study were to develop effi-
cient DNA extraction and purification methods and a real-
time PCR-based assay for detection and quantification of
E. maimaiga resting spores in forest soil. We quickly learned
that the organic-layer soil, in which most resting spores are
found, can interfere with DNA extraction (Tsai & Olson 1992;
Tebbe & Vahjen 1993) so we evaluated the effects of soil type
on DNA extraction. We also assessed the effects of soil
background DNA on the efficacy of the real-time PCR detec-
tion assay for the target fungus.
Materials and methods
Fungal strains and resting spore production
The Entomophaga maimaiga and E. aulicae strains used in this
study are listed in Table 1. All strains are stored and main-
tained at the USDA, ARS Collection of Entomopathogenic
Fungal Cultures (ARSEF; Ithaca, NY). DNA samples for primer
development and PCR specificity assays were isolated from
liquid cultures using the DNeasy Tissue Kit (Qiagen, Valencia,
CA) (Nielsen et al. 2005). Resting spores of E. maimaiga strain
7123 were obtained from laboratory-infected gypsy moth lar-
vae following the protocols reported by Hajek et al. (1990a).
Soil samples
Forest soil samples were collected from four sites (Table 2)
with no known history of Entomophaga maimaiga according
to the method reported by Hajek et al. (1998). Briefly, soil was
collected from around the bases of three large red (Quercus
rubra) or white oak (Q. alba) trees per sampling site. Samples
were taken from the soil surface, no more than 3 cm deep
and 10 cm away from the trunk of each tree, where E. mai-
maiga resting spores are most likely to be found. Three sam-
ples were collected per tree, pooled together, and stored at
4?C in a plastic bag until use. A subsample (ca 100–230 g)
Table 1 – List of Entomophaga maimaiga and E. aulicae strains used in this study
Species/strain (ARSEF No.)Insect hostCollection siteYear
Entomophaga maimaiga
1400
3828
5384
5568
6053
6162
7104
7123
7124
7127
7139
7353
Lymantria dispar (Lepidoptera: Lymantriidae)
"
"
"
"
"
"
"
"
"
"
"
Ishikawa, Japan
New York, USA
Maryland, USA
Virginia, USA
Michigan, USA
Chiba, Japan
Iwate, Japan
Massachusetts, USA
Massachusetts, USA
Khabarowsk, Russia
Heilongjiang, China
Pennsylvania, USA
1984
1996
1996
1997
1998
1998
2001
2003
2003
1999
2002
2003
E. aulicae
2898
3039
7142
Choristoneura fumiferana (Lepidoptera: Tortricidae)
Heterocampa guttivitta (Lepidoptera: Notodontidae)
Euproctis chrysorrhoea (Lepidoptera: Lymantriidae)
Newfoundland, Canada
New York, USA
Maine, USA
1978
1990
2003
Detection and quantification of Entomophaga maimaiga 325

Page 3

from each site was submitted to the Cornell Nutrient Analysis
Laboratory to determine soil texture, organic matter, moisture
and pH (Table 2).
DNA extraction from resting spores in soil
The initial step was to break the thick-walled resting spores
(21.5–40 mm in diameter with 0.5–4 mm thick cell wall) (Soper
et al. 1988). Preliminary studies were conducted using beads of
different types (glass, zirconia/silica, and zirconia; BioSpec
Products Bartlesville, OK) and sizes (0.1, 0.5, 1, 2.4 and 2.5 mm)
at different bead:soil ratios and at different homogenization
times (10, 20, 30, 60, and 120 s) at 5000 revmin?1to achieve
over95 %lysisofrestingsporesinsoilforDNAextraction.Lysis
of resting spores was evaluated by microscopic examination.
Trialswere also conducted to compareuse of the PowerSoil
DNA kit (MoBio Laboratories, Carlsbad, CA) versus the method
developed by Kuske et al. (1998) for extraction of genomic DNA
from soil. The latter was found to yield at least ten times more
DNAthan theformerandwas adapted,with modifications, for
this study. Genomic DNA from soil was extracted using a de-
tergent and bead mill homogenization treatment followed
by purification through Sephadex–polyvinylpolypyrrolidone
(PVPP) microcolumns to remove co-extracted contaminants
(Kuske et al. 1998), in particular humic acids, which are com-
mon contaminants of DNA extracted from soils. Purification
microcolumns were prepared as follows: TE buffer (pH 7.6)
was added to hydrated Sephadex G50 fine resin (Sigma-
Aldrich, St Louis, MO) (9 ml deionized water to 1 g resin incu-
bated at 4?C overnight, plus another 2 ml water added the
next day) at a resin:buffer ratio (v/v) of 2:1. Granular PVPP
(20 mg/ml; Sigma-Aldrich, St Louis, MO) was added to the
resin–buffer suspension, vortexed, and the mixture allowed
to equilibrate for several hours. Five-hundred microlitres of
the suspension was pipetted into each microcolumn (Ultra-
free-MC centrifugal filters, Millipore, Billerica, MA), and the
columns were centrifuged in a swinging rotor at 500 ?g for
5 min, rotated 180?, and spun another 10 min at 750 ?g at
room temperature. This procedure resulted in an even pack-
ing to 400 ml of each microcolumn. Microcolumns were pre-
pared daily before use, but could also be stored before use at
4?C in small batches in plastic bags to prevent drying.
The developed protocol is as follows, 0.5 g soil samples
were transferred to 2 ml bead-beater tubes with 3 g of
2.4 mm zirconia beads and 1 ml 2? TENS buffer [100 mM
Tris–HCl (ph 8), 40 mM EDTA, 200 mM NaCl, 2 % (w/v) sodium
dodecyl sulphate] was added to each tube and the mixture
was briefly vortexed. Samples were homogenized for 1 min
at 5000 revmin?1in a Mini Bead Beater (BioSpec Products) to
disrupt soil material and break fungal resting spores without
shearing genomic DNA. Tubes were then centrifuged at
12,000 ?g for 10 min at room temperature and w800 ml of the
supernatant collected. The soil–bead pellet was washed once
with 1 ml of 2? TENS buffer and the second supernatant
was pooled with the first. Nucleic acids were precipitated by
adding 1/10 volume of 3 M sodium acetate and 0.54 volume
of room temperature isopropanol. Precipitates were washed
with 70 % ethanol, air-dried, resuspended in 100–200 ml TE
(pH 8). Fifty microlitre aliquots (maximum volume per micro-
column) of the suspension were pipetted onto Sephadex–PVPP
microcolumns, spun in a fixed angle rotor at 750 ?g for 10 min,
and eluates from the same extraction sample pooled together.
DNA was precipitated as above, resuspended in 100 ml TE (pH
8), and analysed using a spectrophotometer (readings at 230,
260 and 280 nm) (BioPhotometer, Eppendorf, Westbury, NY)
and by gel electrophoresis. All DNA samples were stored at
?20?C until use.
Soil seeding experiments
To determine efficacy of the DNA extraction method and
sensitivity of the real-time PCR assays on different forest soils,
subsamples from each sampling site were seeded with
suspensions of Entomophaga maimaiga 7123 resting spores in
deionized water. Five gram soil samples were seeded with dif-
ferent concentrations of resting spores delivered in volumes
of 100 ml g?1of soil to obtain titres of 4 ?101, 2? 102, 1?103,
5 ?103, and 2.5?104resting spores g?1of soil, representative
of the range of resting spore titres detected in the field (Hajek
et al. 2004a, 2004b). Seeded soil was mixed using a sterile spat-
ula and three subsamples of 0.5 g were obtained for separate
DNA extractions. DNA samples were pooled together for
each soil sample-resting spore titre combination and stored
at ?20?C until use. Genomic DNA was also extracted from un-
seeded soil samples to determine amount of background DNA
present. Genomic DNA from pure resting spores of different
concentrations, as used for soil seeding, was extracted using
the same method used for seeded soils.
Primers and TaqMan probe
Real-time PCR primers and probe were designed using the
Primer Express software, version 2 (Applied Biosystems, Foster,
CA), based on the nuclear ribosomal ITS sequence of
Table 2 – Sampling locations and properties of the soils used in this study
Sampling locationTextureComposition (%)Moisture
(%)
Organic matter
(%)
pH
SandSiltClay
Site 1 (Potomac Road),
Finger Lakes
National Forest, Hector, NY (FLNF1)
Site 2 (Ravine Loop Trail)
Finger Lakes
National Forest, Hector, NY (FLNF2)
McGowan Woods, Ithaca, NY (MG)
Plot 22N, Michigan (MI)
Silty loam17 68 155.2 77.94.6
Silty loam20 56 242.615.8 5.6
Silty loam
Sandy loam
29
85
63
12
8
3
3
1
22.7
8.4
4.5
4.2
326L. A. Castrillo et al.

Page 4

Entomophaga maimaiga strains 1400, 3828, 5568, 6053, 6162,
7127, and 7139 (GenBank accession numbers DQ534745,
DQ534747, DQ534748, DQ534749, DQ534750, DQ534751, and
DQ534752, respectively) and E. aulicae strains 3039 and 7142
(GenBank accession numbers DQ534746 and DQ534753, respec-
tively).E.maimaigaisamemberoftheE.aulicaespeciescomplex
(Soper et al. 1988), the members of which infect forest lepidop-
terans (Walsh 1996), and thus, other species of this closely re-
lated group could co-occur with E. maimaiga resting spores in
forest soils. Therefore, numerous isolates of E. maimaiga from
Asia and North America, as well as three isolates of E. aulicae
from forest lepidopterans were included in primer selection.
Primers EmTqF1 (50CTCTTTGTTTATTCTTTGCTATTGATTGAG)
and EmTqR1 (50GCACAAAAAGTACCTCCACTGATG) amplified
a91 bpregionoftheITSregion.TheprobeEmTqP1(50TTAAATT
TGATGGATTTAGGTCTGGCGTAAAGTGA) was labelled at the
50-end with fluorescent FAM reporter dye and the 30-end was
labelled with TAMRA quencher dye (Applied Biosystems).
Specificity of the primer pair was tested against most of the
sequenced fungal strains, plus E. maimaiga strains 5384, 7104,
7124, and 7353 and E. aulicae strain 2898. The E. maimaiga
strains tested reflected the genotypic diversity of this species
in the USA, along with representatives from Japan and Russia
(Nielsen et al. 2005). Specificity was tested using standard end-
point PCR assays. PCR reaction mixtures (25 ml volume) con-
tained 1? PCR buffer with 1.5 mM MgCl2; 200 mM each of
dATP, dCTP, dGTP, and dTTP; 0.8 mM of each primer; 50 ng fun-
gal DNA; and 2.5 units Taq PCR enzyme (Qiagen). PCR amplifi-
cation was performed in a PTC-200 thermal cycler (MJ
Research, Waltham, MA) programmed for initial denaturation
at 94?C for 4 min, 30 cycles of denaturation at 94?C for 1 min,
annealing at 55?C for 1 min, and extension at 72?C for 1 min.
Reaction tubes were held at 4?C before visualization of the
PCR products in a 1 % (w/v) agarose gel stained with ethidium
bromide. Assays were repeated at least twice for each strain.
Additional assays were conducted using a lower primer con-
centration of 0.5 mM and a gradient cycle from 55 to 65?C to
eliminate non-specific bands generated in E. aulicae 7142.
PCR inhibition by soil components (i.e., humic acid) was
tested by standard PCR assays as reported above (with 0.5 mM
primer concentration and 55?C annealing temperature) using
genomic DNA extracted from McGowan Woods and Michigan
soils seeded with E. maimaiga 7123 resting spores. Assays were
conducted using undiluted and diluted (1:10 with pH 8 TE
buffer) genomic DNA from soil, with bovine serum albumin
(BSA; New England Biolabs, Beverly, MA) at concentrations
of 0, 0.4, 0.6, 0.8 and 1 mg ml?1final concentration added to re-
lieve inhibition (Kreader 1996). Experiments were repeated at
least twice, and results were visualized in 1 % agarose gels
stained with ethidium bromide and examined under UV light.
Real-time PCR
Optimal primer and probe concentrations for real-time PCR
were determined empirically. Combinations of different
primer concentrations (forward and reverse primers at 0.05,
0.1, 0.2, 0.4, 0.5 and 0.8 mM) and probe concentrations (0.125,
0.25 and 0.5 m M) were tested to obtain the lowest threshold
cycle (Ct) values at 90 to 110 % assay efficiency, which can be
directly correlated to the starting concentration of the sample
target DNA. Optimization trials included a standard curve of
pure Entomophaga maimaiga 7123 DNA from resting spores,
comprised of five series of ten-fold dilutions; genomic extract
from unseeded soil from the Finger Lakes National Forest
(FLNF) site 1 spiked with DNA used for the standard curve
(from 0.1 ng to 1 pg); and a no-template control.
Real-time PCR assays were conducted using the iCycler iQ
Real-time PCR detection system (BioRad Laboratories, Foster,
CA). Each reaction mixture (25 ml final volume) contained 1?
TaqMan Universal Primer Mastermix (Applied Biosystems,
Branchburg, NJ), 0.5 mM each primer, 0.125 mM probe, 0.8 mgml?1
BSA (final concentration), and 2 ml of each of the appropriately
diluted sample DNA (E. maimaiga standard and soil genomic
DNA). Thermal cycling conditions were as follows: initial de-
naturation at 95?C for 10 min, followed by 40 cycles of dena-
turation at 95?C for 30 s and single-step annealing and
extension at 60?C for 1 min. Each PCR assay included a stan-
dard curve (ten-fold dilutions from 100 or 10 ng to 1 pg) for
determining starting DNA concentration of unknowns and
a no-template control in addition to genomic DNA from soil
samples (1:10 dilution). Assays were performed with dupli-
cates of each sample. At least three independent PCR assays
were conducted for each experiment.
Detection of different strains
Sensitivity of the real-time PCR assay of diverse strains of
Entomophaga maimaiga present in the northeast USA was de-
termined in assays against strains 3828, 5384, 6053, 7124
and 7353 at 10 ng DNA. The standard curve was composed
of E. maimaiga 7123 DNA (ten-fold dilutions from 100 ng to
1 pg).
Effect of soil background DNA on sensitivity of real-time PCR
The effect of soil background DNA on the detection limit of
Entomophaga maimaiga resting spores in the soil was tested
by spiking 1:10 dilutions of genomic DNA from unseeded sub-
samples from each sampling site with various concentrations
of E. maimaiga 7123 pure DNA (0.1 pg to 1 ng). This method was
used to reduce the effect of possible interactions between soil
sample and the DNA extraction process, which could affect
the concentration of resting spore DNA in background soil
DNA. Real-time PCR assays also included genomic soil DNA
with 10 ng E. aulicae 7142 DNA added.
Detection of resting spore titres in different soil samples
Comparative sensitivity of real-time PCR on various Entomo-
phaga maimaiga titres in different forest soils was evaluated
in assays of genomic DNA from seeded soil samples. Detect-
able E. maimaiga DNA concentrations, based on Ct values
obtained for each soil sample-resting spore titre mix, were
used to calculate predictedrestingspore number usingregres-
sion analysis. Correlation of pure resting spore number and
DNA concentration was calculated based on quantity of DNA
extracted from resting spore suspensions of known concen-
trations (4?101, 2 ?102, 1 ?103, 5?103, and 2.5?104resting
Detection and quantification of Entomophaga maimaiga327

Page 5

spores), as were used for the soil seeding study. Predicted rest-
ing spore numbers were then compared with the actual spore
titre in each soil sample–resting spore mix.
Data analysis
Analysis of variance and Tukey post hoc tests of real-time PCR
data and regression analysis of Entomophaga maimaiga DNA
extracted from known resting spore concentrations were con-
ducted using StatView (SAS Institute Inc, Cary, NC).
Results
DNA extraction from soil
Amixof3 gof2.4 mmzirconiabeadsand0.5 gsoilin2 mlbead-
beater tubes homogenized at 5000 revmin?1for 1 min was
found to be optimal, by producing w100 % lysis of resting
spores (by microscopic inspection) in the maximum possible
soil weight of 0.5 g without shearing genomic DNA. A longer
homogenizationtimeof2 minwasnotnecessary,eventhough
itstilldidnotresultinshearing,asDNAyieldswerefoundtobe
comparable at both processing times (data not shown).
Crude DNA extracts from the different sampling sites con-
tained co-extracted contaminants, visible as brown coloura-
tion. The darkest extracts came from Michigan soil, while
FLNFsite2sampleshadthelightestcolour.Purificationthough
microcolumns with Sephadex and PVPP resins resulted in the
visible loss of most of the brown colouration in the genomic
DNA. However, spectrophotometer readings at 230 and
260 nm, for determining the level of humic acid contamina-
tion,showedthatthiscontaminantwasstillpresent.Thehigh-
est level of contamination was observed in the Michigan
samples with an A260/A230 of 1.16. A A260:A230 ratio below 2
is indicative of humic acid contamination, and the Michigan
samples had the lowest ratio observed. Absorbance ratios
fromtheothersampleswerenear2,indicatingcleanerDNAex-
tracts. DNA yield from the different unseeded forest soils var-
ied. Mean background genomic DNA from McGowan Woods,
Michigan Plot 22N, FLNF sites 1 and 2 were 23.4, 35.2, 15.3 and
14.2 mg g?1of soil, respectively.
Primer specificity
End-point or standard PCR assays to test primers EmTqF1 and
EmTqR1 showed that similar sized PCR products of w91 bp
were generated from the different Entomophaga maimaiga
strainstested(datanotshown).NoPCRproductwasgenerated
fromE.aulicaestrains2898or3039andtwonon-specificampli-
cons, w3000 and <90 bp, were generated from E. aulicae strain
7142 (data not shown). Specificity was improved when primer
concentration was reduced to 0.5 mM and annealing tempera-
ture was raised above 61?C; these changes resulted in the
loss of non-specific products. No changes were made on the
primer design as the real-time PCR assay included a probe
based on E. maimaiga ITS sequence, which would further im-
prove assay specificity, and had an annealing temperature of
60?C.
Effect of BSA on PCR inhibition
PCR assays on genomic DNA from seeded soils showed that
remaininghumicacidcontaminantsafterpurificationthrough
Sephadex–PVPP microcolumns were sufficient to inhibit
amplification.TheadditionofBSArelievedinhibitioninassays
with diluted (1:10) genomic DNA but not with undiluted sam-
ples for the different soils tested. Levels of co-extracted
contaminants were still enough in the undiluted samples
to inhibit reactions even in the presence of BSA. Among the
different BSA concentrations tested, 0.8 mgml?1final concen-
tration was found optimal, resulting in a distinct PCR product
from each of the seeded soil tested (Fig 1). At a concentration
of 1 mgml?1, BSA itself was found to be inhibitory to amplifica-
tion and resulted in the loss of PCR products.
Detection of different strains
Real-time PCR assays of Entomophaga maimaiga strains 3828,
5384, 6053, 7104, 7124 and 7353 at 10 ng DNA per reaction
A
B
C
500 bp -
500 bp -
M123456789
100 bp -
100 bp -
500 bp -
100 bp -
Fig 1 – The effect of bovine serum albumin (BSA) concen-
tration on the amplification of Entomophaga maimaiga
extracted directly from soil samples. BSA at 0.2–1 mgmlL1
final concentration was tested to relieve PCR inhibition from
contaminants co-extracted with E. maimaiga DNA from soil.
No amplification products were generated in the absence of
BSA (A). A concentration of 0.8 mg/ml BSA (C) was found
optimal, generating consistent results and distinct PCR
products compared with 0.4 mgmlL1(B). Lanes 1–4 and 5–8
represent soil samples from McGowan woods and
Michigan, respectively, seeded with E. maimaiga resting
spores. Lane 9 represents a positive control of 20 ng pure
E. maimaiga DNA. The marker is a 1 kb Plus DNA ladder
(Invitrogen, Valencia, CA).
328L. A. Castrillo et al.