Structure of the yeast polarity protein Sro7 reveals a SNARE regulatory mechanism

Department of Structural Biology, Stanford University School of Medicine, 299 Campus Drive West, Stanford, California 94305-5126, USA.
Nature (Impact Factor: 41.46). 04/2007; 446(7135):567-71. DOI: 10.1038/nature05635
Source: PubMed


Polarized exocytosis requires coordination between the actin cytoskeleton and the exocytic machinery responsible for fusion of secretory vesicles at specific sites on the plasma membrane. Fusion requires formation of a complex between a vesicle-bound R-SNARE and plasma membrane Qa, Qb and Qc SNARE proteins. Proteins in the lethal giant larvae protein family, including lethal giant larvae and tomosyn in metazoans and Sro7 in yeast, interact with Q-SNAREs and are emerging as key regulators of polarized exocytosis. The crystal structure of Sro7 reveals two seven-bladed WD40 beta-propellers followed by a 60-residue-long 'tail', which is bound to the surface of the amino-terminal propeller. Deletion of the Sro7 tail enables binding to the Qbc SNARE region of Sec9 and this interaction inhibits SNARE complex assembly. The N-terminal domain of Sec9 provides a second, high-affinity Sro7 interaction that is unaffected by the tail. The results suggest that Sro7 acts as an allosteric regulator of exocytosis through interactions with factors that control the tail. Sequence alignments indicate that lethal giant larvae and tomosyn have a two-beta-propeller fold similar to that of Sro7, but only tomosyn appears to retain the regulatory tail.

Download full-text


Available from: Patrick J Brennwald, Dec 21, 2014
  • Source
    • "Studies in yeast interactome demonstrated that WD40 proteins are involved in more protein-protein interactions than any other domains [13], [14]. The functional versatility of WD40 proteins is owed to their ability, (i) to target different substrates selectively similar to F-box proteins [15] (ii) to recruit different substrates in binding modes similar to the peptide-in-groove binding of clathrin [16] or by distinct binding modes through the top and side of the WD domain as in the Gβ of the G proteins [11] (iii) to interact through insertion motifs as in MAD3 protein [17] or inter-blade binding grooves of WD40 domains for ligand binding as in Sro7 protein [18]. "
    [Show abstract] [Hide abstract]
    ABSTRACT: As a crop, flax holds significant commercial value for its omega-3 rich oilseeds and stem fibres. Canada is the largest producer of linseed but there exists scope for significant yield improvements. Implementation of mechanisms such as male sterility can permit the development of hybrids to assist in achieving this goal. Temperature sensitive male sterility has been reported in flax but the leakiness of this system in field conditions limits the production of quality hybrid seeds. Here, we characterized a 2,588 bp transcript differentially expressed in male sterile lines of flax. The twelve intron gene predicted to encode a 368 amino acid protein has five WD40 repeats which, in silico, form a propeller structure with putative nucleic acid and histone binding capabilities. The LuWD40-1 protein localized to the nucleus and its expression increased during the transition and continued through the vegetative stages (seed, etiolated seedling, stem) while the transcript levels declined during reproductive development (ovary, anthers) and embryonic morphogenesis of male fertile plants. Knockout lines for LuWD40-1 in flax failed to develop shoots while overexpression lines showed delayed growth phenotype and were male sterile. The non-viable flowers failed to open and the pollen grains from these flowers were empty. Three independent transgenic lines overexpressing the LuWD40-1 gene had ~80% non-viable pollen, reduced branching, delayed flowering and maturity compared to male fertile genotypes. The present study provides new insights into a male sterility mechanism present in flax.
    PLoS ONE 07/2013; 8(7):e69124. DOI:10.1371/journal.pone.0069124 · 3.23 Impact Factor
  • Source
    • "The tom-1A ΔSNARE domain (aa 1–1045 ) includes the WD40 repeats and the downstream 57 amino acid linker, based on conserved sequence alignments [24] amplified from pAB29 using primers AGAGTCATCCCTCAGAACAG and GTCTAGGATCCATGCATCGGATTCACTCCAGAACTATTC, TOPO-cloned creating pAB47. tom-1A ΔSNARE was subcloned into pAB36 containing pUNC-17 using BamH restriction sites, creating pAB48. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Neurosecretion is critically dependent on the assembly of a macromolecular complex between the SNARE proteins syntaxin, SNAP-25 and synaptobrevin. Evidence indicates that the binding of tomosyn to syntaxin and SNAP-25 interferes with this assembly, thereby negatively regulating both synaptic transmission and peptide release. Tomosyn has two conserved domains: an N-terminal encompassing multiple WD40 repeats predicted to form two β-propeller structures and a C-terminal SNARE-binding motif. To assess the function of each domain, we performed an in vivo analysis of the N- and C- terminal domains of C. elegans tomosyn (TOM-1) in a tom-1 mutant background. We verified that both truncated TOM-1 constructs were transcribed at levels comparable to rescuing full-length TOM-1, were of the predicted size, and localized to synapses. Unlike full-length TOM-1, expression of the N- or C-terminal domains alone was unable to restore inhibitory control of synaptic transmission in tom-1 mutants. Similarly, co-expression of both domains failed to restore TOM-1 function. In addition, neither the N- nor C-terminal domain inhibited release when expressed in a wild-type background. Based on these results, we conclude that the ability of tomosyn to regulate neurotransmitter release in vivo depends on the physical integrity of the protein, indicating that both N- and C-terminal domains are necessary but not sufficient for effective inhibition of release in vivo.
    PLoS ONE 10/2011; 6(10):e26185. DOI:10.1371/journal.pone.0026185 · 3.23 Impact Factor
  • Source
    • "The three α-helixes all interact with the WD40 domains mainly through hydrophobic interactions. Both the C-terminal tail and the insertion motif of Sro7 are involved in stabilizing the WD40 fold and tying up the two WD40 domains together (Hattendorf et al., 2007). Interestingly, neither of two WD40 propellers in Sro7 has the " velcro " closure. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The WD40 domain exhibits a β-propeller architecture, often comprising seven blades. The WD40 domain is one of the most abundant domains and also among the top interacting domains in eukaryotic genomes. In this review, we will discuss the identification, definition and architecture of the WD40 domains. WD40 domain proteins are involved in a large variety of cellular processes, in which WD40 domains function as a protein-protein or protein-DNA interaction platform. WD40 domain mediates molecular recognition events mainly through the smaller top surface, but also through the bottom surface and sides. So far, no WD40 domain has been found to display enzymatic activity. We will also discuss the different binding modes exhibited by the large versatile family of WD40 domain proteins. In the last part of this review, we will discuss how post-translational modifications are recognized by WD40 domain proteins.
    Protein & Cell 03/2011; 2(3):202-14. DOI:10.1007/s13238-011-1018-1 · 3.25 Impact Factor
Show more