Bacterial symbionts in the hepatopancreas of isopods: diversity and environmental transmission.

Abstract

The midgut glands (hepatopancreas) of terrestrial isopods contain bacterial symbionts. We analysed the phylogenetic diversity of hepatopancreatic bacteria in isopod species from various suborders colonizing marine, semiterrestrial, terrestrial and freshwater habitats. Hepatopancreatic bacteria were absent in the marine isopod Idotea balthica (Valvifera). The symbiotic bacteria present in the midgut glands of the freshwater isopod Asellus aquaticus (Asellota) were closely related to members of the proteobacterial genera Rhodobacter, Burkholderia, Aeromonas or Rickettsiella, but differed markedly between populations. By contrast, species of the suborder Oniscidea were consistently colonized by the same phylotypes of hepatopancreatic bacteria. While symbionts in the semiterrestrial isopod Ligia oceanica (Oniscidea) were close relatives of Pseudomonas sp. (Gammaproteobacteria), individuals of the terrestrial isopod Oniscus asellus (Oniscidea) harboured either 'Candidatus Hepatoplasma crinochetorum' (Mollicutes) or 'Candidatus Hepatincola porcellionum' (Rickettsiales), previously described as symbionts of another terrestrial isopod, Porcellio scaber. These two uncultivated bacterial taxa were consistently present in each population of six and three different species of terrestrial isopods, respectively, collected in different geographical locations. However, infection rates of individuals within a population ranged between 10% and 100%, rendering vertical transmission unlikely. Rather, feeding experiments suggest that 'Candidatus Hepatoplasma crinochetorum' is environmentally transmitted to the progeny.

Full text

Page 1

Bacterialsymbiontsinthehepatopancreasofisopods:diversityand
environmentaltransmission
Yongjie Wang1, Andreas Brune2,3& Martin Zimmer1
1Zoologisches Institut, Christian-Albrechts-Universit¨ at, Kiel, Germany;2Fachbereich Biologie, Mikrobielle O¨kologie, Universit¨ at Konstanz, Konstanz,
Germany; and3Abteilung Biogeochemie, Max-Planck-Institut f¨ ur terrestrische Mikrobiologie, Marburg, Germany
Correspondence: Martin Zimmer,
Zoologisches Institut, Christian-Albrechts-
Universit¨ at, Am Botanischen Garten 9, 24118
Kiel, Germany. Tel.: 149 431 880 4153;
fax: 149 431 880 4747;
e-mail: mzimmer@zoologie.uni-kiel.de
Present address: Yongjie Wang,
Dienstleistungszentrum L¨ andlicher Raum
(DLR Rheinpfalz), Abteilung Phytomedizin,
Neustadt an der Weinstraße, Germany.
Received 20 November 2006; revised 6 March
2007; accepted 9 March 2007.
First published online 16 May 2007.
DOI:10.1111/j.1574-6941.2007.00329.x
Editor: Christoph Tebbe
Keywords
isopoda; symbiotic bacteria; transmission;
distribution; specificity.
Abstract
The midgut glands (hepatopancreas) of terrestrial isopods contain bacterial
symbionts. We analysed the phylogenetic diversity of hepatopancreatic bacteria in
isopod species from various suborders colonizing marine, semiterrestrial, terres-
trial and freshwater habitats. Hepatopancreatic bacteria were absent in the marine
isopod Idotea balthica (Valvifera). The symbiotic bacteria present in the midgut
glands of the freshwater isopod Asellus aquaticus (Asellota) were closely related to
members of the proteobacterial genera Rhodobacter, Burkholderia, Aeromonas or
Rickettsiella, but differed markedly between populations. Bycontrast, species of the
suborder Oniscidea were consistently colonized by the same phylotypes of
hepatopancreatic bacteria. While symbionts in the semiterrestrial isopod Ligia
oceanica (Oniscidea) were close relatives of Pseudomonas sp. (Gammaproteobacter-
ia), individuals of the terrestrial isopod Oniscus asellus (Oniscidea) harboured
either ‘Candidatus Hepatoplasma crinochetorum’ (Mollicutes) or ‘Candidatus
Hepatincola porcellionum’ (Rickettsiales), previously described as symbionts of
another terrestrial isopod, Porcellio scaber. These two uncultivated bacterial taxa
were consistently present in each population of six and three different species of
terrestrial isopods, respectively, collected in different geographical locations.
However, infection rates of individuals within a population ranged between 10%
and 100%, rendering vertical transmission unlikely. Rather, feeding experiments
suggest that ‘Candidatus Hepatoplasma crinochetorum’ is environmentally trans-
mitted to the progeny.
Introduction
Isopods (Crustacea: Isopoda) originated from the marine
environment and have successfully colonized terrestrial
habitats. It is assumed that the terrestrial suborder Onisci-
dea shares a common ancestor with the marine suborders
Valvifera and Sphaeromatidea (Zimmer, 2002). The midgut
glands (hepatopancreas) of the terrestrial isopods Porcellio
dilatatus (Donadey & Besse, 1972), Porcellio scaber (Wood &
Griffith, 1988; Hames & Hopkin, 1989; Zimmer & Topp,
1998a,b; Zimmer, 1999; Wang et al., 2004a,b), Oniscus
asellus (Hopkin & Martin, 1982; Wood & Griffith, 1988;
Hames & Hopkin, 1989) (both Oniscidea: Crinocheta), and
of the semiterrestrial species Ligia pallasii (Oniscidea: Di-
plocheta) (Zimmer et al., 2001) carry symbiotic bacteria.
The hepatopancreas secretes digestive fluids into the hind-
gut where digestion takes place and is involved in the
resorption of digestively released nutrients (Zimmer, 2002).
One of the most interesting aspects of bacterial symbionts
inside the hepatopancreatic lumen is their proposed con-
tribution to digestive processes of the isopods, i.e. the
hydrolysis of cellulose (Zimmer & Topp, 1998a,b; Zimmer
et al., 2002) and the oxidation of phenolics (Zimmer, 1999;
Zimmer et al., 2002) and lignins (Zimmer & Topp, 1998b;
Zimmer et al., 2002). In contrast to macroalgal food sources
of marine isopods, detrital food sources of terrestrial (and
freshwater) isopods contain little nutrients, but are rich in
cellulose and phenolics. Thus, hepatopancreatic bacteria
may have facilitated the evolutionary colonization of terres-
trial habitats by Oniscidea and their utilization of terrestrial
food sources (Zimmer & Topp, 1998b; Zimmer et al., 2001;
Zimmer & Bartholm´ e, 2003).
Either hepatopancreatic bacteria were acquired by the
isopods simultaneously with numerous adaptations that
allowed colonization of land or the acquisition of hepato-
pancreatic bacteria was a predisposition to the colonization
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved

Page 2

of land. In the former case, these bacteria would be lacking
in marine isopods; in the latter case, hepatopancreatic
bacteria would be present in marine species (Zimmer et al.,
2002). In contrast to their terrestrial relatives, those four
marine isopod species of the suborders Valvifera and
Sphaeromatidea tested thus far do not harbour bacteria in
their midgut glands (Zimmer et al., 2001, 2002; S. Fraune &
M. Zimmer, unpublished data), even though they live in a
benthic environment that is rich in potential bacterial
inoculants. Thus,it hasbeen discussed whether thesemarine
isopods either are effective in protecting themselves from
bacterial inoculation or lack the capability of hosting
bacteria in their hepatopancreas (Zimmer, 2002). However,
this is contradicted by the observation of hepatopancreatic
bacteria in Asellus aquaticus (Zimmer & Bartholm´ e, 2003), a
freshwater representative of Asellota, an isopod suborder
common in both marine and freshwater systems. Asellus
aquaticus, which is one of the most common detritivorous
crustaceans in temperate lentic freshwaters, feeds mainly on
decaying plant leaf litter like its terrestrial relatives (Isopoda:
Oniscidea).
Recently, we reported that two types of phylogenetically
distinct hepatopancreatic symbionts – ‘Candidatus Hepa-
tincola porcellionum’, curved rod-shaped bacteria related to
the Rickettsiales (Alphaproteobacteria), and ‘Candidatus He-
patoplasma crinochetorum’, sphere-shaped Mycoplasma-
like bacteria (Mollicutes) – colonize the epithelial brush
border of the hepatopancreas in the terrestrial P. scaber
(Wang et al., 2004a,b). However, little is known about the
identity of bacterial symbionts in other terrestrial isopod
species, owing to the failurein isolating and cultivating these
bacteria in previous studies. Yet, this knowledge would be
valuable in shedding light on the role of bacterial symbionts
during the colonization of land by arthropods with marine
ancestors.
Many terrestrial arthropods have evolved elegant trans-
mission mechanisms to ensure the inoculation of their
progeny with specific bacterial symbionts, involving three
different modes of transmission (Cary& Giovannoni, 1993):
(1) vertical transmission from (female) parent to the off-
spring (Aksoy, 2003), (2) horizontal transmission between
syntopic hosts and (3) environmental transmission, where
the new host generation takes up its symbionts from the
environment (McFall-Ngai, 2002). Theory predicts that
mutualistic symbioses will evolve under conditions of
vertical transmission of the symbiont from parent to off-
spring (Herre et al., 1999) as the transmission of symbionts
is critical in mutualistic symbioses, both for obligate sym-
bionts and for their host. It is only through vertical
transmission that a host can ensure that none of its progeny
will stay aposymbiotic. Yet, many mutualists rely on hor-
izontal transmission (discussed in Wilkinson & Sherratt,
2001), and horizontal transfer of symbionts is the rule in
sexually reproducing animals with symbionts that are not
harboured inside the reproductive tract (Douglas, 1995).
Thus, knowing the mechanism of symbiont transmission in
isopods is crucial to our understanding of isopod–symbiont
interactions.
In the present study, we (1) determine the phylogenetic
affiliations of symbiotic bacteria in the hepatopancreas of
selected isopod species from different habitats (aquatic,
semiterrestrial, terrestrial); (2) survey the distribution
of the symbionts among geographically distinct isopod
populations; and (3) investigate the mode of symbiont
transmission.
Materials and methods
Collection and culture of isopods
Idotea balthica Pallas 1772 (Valvifera: Idoteidae) was col-
lected from seaweed at the Falckenstein beach near Kiel,
Germany, kept in plastic containers filled with artificial
seawater, and fed on brown algae (Fucus spp.). Ligia oceanica
Brandt 1833 (Oniscidea: Ligiidae) was collected beneath
rocks at the Falckenstein lighthouse near Kiel, kept in plastic
containers with a bottom of 1cm of wet sand, and fed on
brown algae (Fucus spp.). Oniscus asellus Linnaeus 1758
(Oniscidea: Oniscidae) and Porcellio scaber Latreille 1804
(Oniscidea: Porcellionidae) were collected from beneath
decaying wood in the botanical garden of the Christian-
Albrechts-Universit¨ at of Kiel, kept in plastic containers with
a bottom of 1cm of moist plaster, and fed with decaying leaf
litter. Asellus aquaticus (Linnaeus 1758) (Asellota: Asellidae)
was collected in various ponds in the vicinity of Kiel, and in
Lake Neuw¨ uhren near Pl¨ on, about 20km south-east of Kiel;
they were kept in aerated tap water and fed with mixed leaf
litter taken from the field. Isopod cultures were maintained
at 121C.
For the survey of the geographical distribution of bacter-
ial symbionts in different terrestrial isopod species, an area
of about 10m2at each collection site was screened for
isopods living underneath decaying detritus.
Symbiont transmission
Gravid females of P. scaber were divided into treatment and
control groups. For the treatment group, isopods were
washed five times in autoclaved water, surface-sterilized
with 70% ethanol and UV light (l=254nm) for 10s and
5min, respectively, and washed again five times in water.
Subsequently, they were cultivated individually in sterile
Petri dishes (85mm diameter) with sterile filter paper
(80mm) covering the bottom. The filter paper was
wetted using sterile-filtered supernatant of an aqueous
soil suspension and was renewed every 2 days during
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
142
Y. Wang et al.

Page 3

the first 2 weeks of the experiment. Leaf litter was surface-
sterilized by means of combined ethanol and UV treatment
(l=254nm) before it was offered as food. Gravid females
in the control group were also kept individually in Petri
dishes, but were not subjected to surface sterilization, and
were fed nonsterilized leaf litter. Unfiltered supernatant
(see above) was used to moisten the filter papers. Isopods
were maintained at 151C, 16/8h light–dark. Isopod hatchl-
ings (mancae) were harvested just before hatching, and
juveniles were collected at day 1 (stage 1) and at day 7
(stage 2) after their release from their mother’s brood
pouch and the immediate removal of the mother upon
offspring hatching. For each group, 30 embryos or 40
juveniles were obtained from each of the 10 mothers.
Mother isopods were dissected immediately after obtaining
their embryos or juveniles.
DNA extraction
Adult isopods (both males and females) were washed five
times in autoclaved water, surface-sterilized with 70%
ethanol and UV light (l=254nm) for 1 and 5min, respec-
tively, and washed again five times in water. After blotting
their bodies dry, the midgut glands were dissected and
stored in autoclaved reaction tubes filled with 1mL acetone.
Total DNA was extracted and purified using a bead-beating
protocol (Friedrich et al., 2001). DNA was recovered
through isopropanol precipitation, then rinsed in 70%
ethanol (v/v, ?201C), subsequently resuspended in PCR
water (Sigma), and stored at ?201C before usage.
PCR, sequencing and sequence analysis
The PCR primers applied in this study are listed in Table 1.
PCR amplification, cloning, and restriction fragment length
polymorphism (RFLP) analysis of 16S rRNA genes followed
the protocols described in Wang et al. (2004a,b). Diagnostic
PCR with symbiont-specific primers used a 200-mL
PCR tube with a 50-mL reaction volume containing 200mM
each dNTP, 5.0mL of a 10? reaction buffer (Eppendorf),
25pmol of each primer, 1.0U of Taq DNA polymerase
(Eppendorf) and 1mL of template DNA. Samples were
amplified with a DNA thermal cycler (Eppendorf)
under the following conditions: initial denaturation at
941C for 3min, followed by 30 cycles of denatura-
tion at 941C for 30s, annealing at 551C for 30s and
extension at 721C for 1min, followed by a final elongation
for 7min at 721C.
Both strands of the inserts were sequenced using primers
M13 forward, M13 reverse, and 533f/907r on an ABI
sequencer by GATC (http://www.gatc.de). Sequences were
assembled and compared with those in public databases
using BLAST (Altschul et al., 1997). Closely related sequences
were retrieved and added to the alignment. Only sequences
with more than 1200 nucleotides were used for the align-
ment. Multiple alignments were made using the CLUSTAL W
program (Thompson et al., 1994). Alignments were always
manually checked. Phylogenetic analysis utilized the max-
imum-parsimony, neighbour-joining and minimum evolu-
tion algorithms as implemented in MEGA 3.1 (Kumar et al.,
2004).
The 16S rRNA gene sequences were submitted to
GenBank under accession numbers AY447040–AY447042,
AY539721–AY539726 and AY573580–AY573582.
Denaturing gradient gel electrophoresis (DGGE)
Denaturing gels were prepared using two 6.5% (w/v)
acrylamide gel stock solutions [37.5:1, acrylamide-N,N00-
methylenebisacrylamide in 1? Tris-acetate-EDTA (TAE)
Table 1. Primers used in this study
PrimerOPD designation?
Primer sequence (50–30) Reference or source
27f
63f
533f
907r
1387r
1492r
PsSym137f
PsSym372f
S-D-Bact-0007-a-S-21
S-D-Bact-0043-a-S-21
S-D-Bact-0515-a-S-19
S-D-Bact-0907-a-A-15
S-D-Bact-1387-a-A-18
S-D-Bact-1492-a-A-22
S-G-Hepa-0120-a-S-18w
S-G-Hepa-0352-a-S-21z
GC-clamp
CAGAGTTTGATCCTGGCTCAG
CAGGCCTAACACATGCAAGTC
GTGCCAGCAGCCGCGGTAA
AATTCCTTTGAGTTT
GGGCGGWGTGTACAAGGC
TACGG(C/T)TACCTTGTTACGACTT
ACACGTGGGAATTTGGCT
CAGCAGTAGGGAATTTTTCAC
CGCCCGCCGCGCCCCGCGCCCGG
CCCGCCGCCCCCGCCCCG
Weisburg et al. (1991)
Marchesi et al. (1998)
Henckel et al. (1999)
Henckel et al. (1999)
Marchesi et al. (1998)
Weisburg et al. (1991)
This study
This study
?Except for the GC clamp and primers M13F/M13R, the nomenclature is according to Alm et al. (1996).
wComplemented sequences of the specific probe PsSym120 (Wang et al., 2004a) were used as a ‘Candidatus Hepatincola porcellionum’-specific PCR
forward primer with the Bacteria-specific reverse primer 1492r (Weisburg et al., 1991).
zComplemented sequences of the specific probe PsSym352 (Wang et al., 2004b) were used as a ‘Candidatus Hepatoplasma crinochetorum’-specific
PCR forward primer with the Bacteria-specific reverse primer 1492r (Weisburg et al., 1991).
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
143
Bacterial symbionts in isopods

Page 4

(containing 40mM Tris base, 20mM sodium acetate and
1mM EDTA-Na2)] with 0 and 80% denaturant [100%
denaturant contained 7M urea and 40% (v/v) formamide
in 1? TAE], respectively. A linear 40–80% denaturant
gradient was prepared according to the method of Myers
et al. (1987).
ForPCRamplification of bacterial DNAprior toDGGE, a
GC clamp was attached at the 50end of the Bacteria-specific
reverse primer 907r (Henckel et al., 1999). After pre-
electrophoresis for 30min, PCR products were loaded
onto the gel, which was run at 601C and 60V for 15h. The
gel was stained with ethidium bromide (0.5mgmL?1) for
15min and photographed under UV light with a digital
camera.
FISH
Dissected and ruptured hepatopancreas preparations, kept
in 500mL phosphate-buffered saline (PBS; see above), were
homogenized by repeated passage through a pipette tip.
After gravity sedimentation of the tissue shreds (5min),
450mL of supernatant was carefully transferred to a new
sterile 1.5-mL tube containing 50mL of 40% (w/v) formal-
dehyde. After fixation at 41C for 15h, the samples were
centrifuged at 10000g for 5min and washed three times
with 500mL PBS. The final pellets were dissolved in a
mixture of 250mL PBS and 250mL of 97% (v/v) ethanol
and stored at ?211C.
For fluorescence hybridization, hepatopancreas samples
were filtered onto polycarbonate filters (0.2-mm pore size)
and dried at 461C for 30min. Samples were stained with
40,6-diamidino-2-phenylindole (DAPI) and hybridized with
specific fluorescently labelled oligonucleotides (Table 2) as
described by Wagner et al. (1993); negative controls with an
EUB338 antisense probe (Wallner et al., 1993) were used to
exclude nonspecific probe binding. All probes were synthe-
sized and 50-labelled with the fluorescent cyanine dye Cy3 or
with 5(6)-carboxyfluorescein-N-hydroxysuccinimide ester by
Thermo Hybaid (http://www.interactiva.de). Samples were
covered with Citifluor (Citifluor Ltd, London) and examined
at 1000-fold magnification with a Zeiss Axiophot epifluores-
cence microscope using filter sets for DAPI, Cy3 and fluor-
escein.Imageswererecordedwithadigitalcamera(Olympus).
For in situ hybridization, thin sections (8mm) of paraffin-
embedded midgut glands, embryos and juveniles were
prepared and hybridized as previously described (Wang
et al., 2004a,b).
Results
Hepatopancreatic bacteria in isopods from
different habitats
Hepatopancreatic bacteria were detected in midgut gland
homogenates of almost all isopod species tested by fluores-
cence microscopy and whole-cell hybridization with the
fluorescence-labelled oligonucleotide probe EUB338, and
16S rRNA genes were successfully amplified from DNA
extracts of the midgut glands. The only exception was the
marine isopod Idotea balthica, in which no bacterial cells
were observed in DAPI-stained preparations of the 30
individuals tested, and no PCR products were obtained with
bacterial primers.
Table 2. Specific fluorescently labelled oligonucleotide probes used in this study
Fluorescence-
labelled probes?
OPD designationw
Probe Sequence (50–30)
Target sitez
(rRNA position)Formamide (%)‰
Reference
EUB338
NONEUB
ALF1B
GAM42a
S-D-Bact-0338-a-A-18
S-D-Bact-0338-a-S-18
S-Sc-aProt-0019-a-A-17
L-C-gProt-1027-a-A-17
(with competitor BET42a)
S-G-Pseu-0440-a-A-15
S-G-Hepa-0352-a-A-21
S-G-Hepa-0120-a-A-18
GCTGCCTCCCGTAGGAGT
ACTCCTACGGGAGGCAGC
CGTTCGYTCTGAGCCAG
GCCTTCCCACATCGTTT
GCCTTCCCACTTCGTTT
CCTTCCTCCCAACTT
GTGAAAAATTCCCTACTGCTG
AGCCAAATTCCCACGTGT
16S (338–355) 0–50 Amann et al. (1990)
Wallner et al. (1993)
Manz et al. (1992)
Manz et al. (1992)
16S (19–35)
23S (1027–1043)
20
35
PSM G440z
PsSym352
PsSym120
16S (440-454)
16S (352–373)
16S (120–138)
35
0–20
20
Braun-Howland et al. (1993)
Wang et al. (2004a,b)
Wang et al. (2004a,b)
?All probes were synthesized and 50-labelled with the fluorescent cyanine dye Cy3 or with 5 (6)-carboxyfluorescein-N-hydroxysuccinimide ester.
NONEUB, negative control probe complementary to EUB338; EUB338, most Bacteria; ALF1B, Alphaproteobacteria, some Betaproteobacteria,
spirochaetes; GAM42a, Gammaproteobacteria; PSM G440, Pseudomonas spp.; PsSym352, ‘Candidatus Hepatoplasma crinochetorum’ symbionts;
PsSym120, ‘Candidatus Hepatincola porcellionum’symbionts.
wThe nomenclature is according to Alm et al. (1996).
zEscherichia coli numbering (Brosius et al., 1981).
‰Percentage amount of formamide (v/v) in the hybridization buffer.
zNo mismatch in the target site of clones Lo-6 and Lo-8.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
144
Y. Wang et al.

Page 5

Hepatopancreatic bacteria in the semiterrestrial
Ligia oceanica
In the semiterrestrial isopod Ligia oceanica, the hepatopan-
creatic bacteria were straight, rod-shaped cells (0.8mm wide
and 1.8–2.5mm long: Fig. 1a–c) of uniform appearance. The
two ribotypes in the corresponding clone library differed
only slightly in their RFLP patterns. Phylogenetic analysis of
representative clones showed that they were closely related to
eachother(99% sequence identity) andrepresenteda lineage
within the genus Pseudomonas (Table 3). Cell densities
ranged from 0.3?107to 6.0?107cells per animal (n=10).
All bacteria in the hepatopancreas of L. oceanica (DAPI-
stained: Fig. 1a–c) exhibited strong hybridization signals
with probes EUB338, GAM42a (with BET42a as competitor)
and PSM G440, specific for all Bacteria, only Gammaproteo-
bacteria and members of the genus Pseudomonas, respec-
tively, confirming that the cloned 16S rRNA genes originated
from the hepatopancreatic symbionts and that the latter
form a homogeneous population of Pseudomonas sp.
Hepatopancreatic bacteria in Oniscus asellus
and other terrestrial isopods
Individuals of the terrestrial isopod Oniscus asellus con-
tained either spherical cells (0.5–0.8mm in diameter) or
curved rods (0.5mm wide and 1.5–3.8mm long), which
morphologically resembled the two previously described
bacterial symbionts in the hepatopancreas of the closely
related isopod species Porcellio scaber (Wang et al., 2004a,b).
Cell densities ranged between 0.6?108and 9.3?108cells
per animal (n=5).
Accordingly, DGGE of PCR products obtained with the
same primer combination (533f/907r) yielded a single DNA
band for L. oceanica, whereas two different bands were
obtained fordifferent individuals of O. asellus. The positions
Fig. 1. Epifluorescence microphotographs of symbiotic bacteria in homogenates of the midgut glands of (a–c) the semiterrestrial Ligia oceanica and
(d–i) the terrestrial Oniscus asellus after fluorescence-labelled oligonucleotide probe in situ hybridization. (a) Stained with DAPI; (b) hybridized with
probeGAM42a specific for Gammaproteobacteria; (c) hybridized with probe PSM G440 specific for the genus Pseudomonas; (d) left panel: stained with
DAPI; (e) probeEUB338 specific forBacteria;(f) probePsSym352specific for ‘Candidatus Hepatoplasma crinochetorum’; (g)stained with DAPI; (h) probe
ALF1b specific for Alphaproteobacteria; (i) probe PsSym120 specific for ‘Candidatus Hepatincola porcellionum’. Scale bar: 5mm.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
145
Bacterial symbionts in isopods

Page 6

of the bands in the acrylamide gel obtained for O. asellus
were identical to those obtained with clones of ‘Candidatus
Hepatincola porcellionum’ and ‘Candidatus Hepatoplasma
crinochetorum’ present in P. scaber (Wang et al., 2004a,b).
These bacterial species seem to mutually exclude each other,
as we never found an individual isopod that harboured both
symbiont in its midgut glands.
A clone library of 16S rRNA genes from O. asellus
comprised three ribotypes that differed only slightly in their
RFLP patterns. Representative clones showed high sequence
similarity among each other (98.1–99.6%). They were
closely related to the sphere-shaped symbiont ‘Candidatus
Hepatoplasma crinochetorum’ in the hepatopancreas of
P. scaber (Table 3).
The specific probe PsSym352, previously designed to
detect‘Candidatus Hepatoplasma
P. scaber (Wang et al., 2004b), also matched the target
sequence of all three cloned 16S rRNA genes from O. asellus
(Fig. 1d–f). All of the DAPI-stained, sphere-shaped cells
showed specific hybridization with both probe EUB338 and
PsSym352, supporting the close relationship between the
Mycoplasma-like symbionts found in O. asellus and P. scaber.
The curved rod-shaped hepatopancreatic bacteria found in
O. asellus (Fig. 1g–i) hybridized with the Bacteria-specific
probe (EUB338), the Alphaproteobacteria-specific probe
(ALF1B) and the probe PsSym120 designed to detect
crinochetorum’ in
specifically ‘Candidatus Hepatincola porcellionum’ in
P.scaber(Wang et al.,2004a),whichsuggestedthatthesecond
symbiont,whichwasnotrepresentedintheclonelibraryofO.
asellus (see above), belongs to this rickettsial lineage.
Using the specific FISH probes, ‘Candidatus Hepatoplas-
ma crinochetorum’ was detected not only in O. asellus and
P. scaber populations collected in different locations
(Table 4), but also in the terrestrial isopod species Philoscia
muscorum (Scopoli 1763), Armadillidium vulgare (Latreille
1804), Trachelipus rathkii (Brandt 1833) and Alloniscus
perconvexus Dana 1854, whereas ‘Candidatus Hepatincola
porcellionum’ was found only in T. rathkii. Aposymbiotic
individuals were present in all species (Table 4). Morpholo-
gically different, rod-shaped bacteria, not hybridizing with
the probes for ‘Candidatus Hepatoplasma crinochetorum’
and ‘Candidatus Hepatincola porcellionum’, were observed
in the hepatopancreas of 6.3% of A. perconvexus.
Hepatopancreatic bacteria in the freshwater
isopods Asellus aquaticus
The hepatopancreatic community in the freshwater isopod
Asellus aquaticus was more complex than that in the other
isopod species. Microscopic inspection had already shown
that bacterial morphotypes in the midgut glands differed
between both individuals and populations. Short rod-
Table 3. Ribotypes of clones in clone libraries of hepatopancreatic bacteria in different isopod species, and phylogenetic affiliation of representative
clones of each ribotype
Isopod species
Asellus aquaticus?w
(Asellota: Asellidae)
(Pl¨ on)
Asellus aquaticus?w
(Asellota: Asellidae)
(Kiel)
Clones
tested
Clones in
ribotype
Representative
clone ID
Sequence affiliation Sequence
similarity
(%) Subclass Closest relative
158
7
Aa-12
Aa-3
Alphaproteobacteria
Gammaproteobacteria
Rhodobacter sp. (AY584573)
Aeromonas sobria (X74683)
98.1
99.9
3715 Aa-7
Gammaproteobacteria
Uncultured Gammaproteobacterium
(AY947958)
Uncultured Gammaproteobacterium
(AY947958)
Burkholderia sp. N2P5 (U37342)
Pseudomonas sp. (AY958857)
Pseudomonas sp. (AY958857)
98.8
13 Aa-10
Gammaproteobacteria
98.9
9 Aa-11
Lo-6
Lo-8
Betaproteobacteria
Gammaproteobacteria
Gammaproteobacteria
99.9
99.7
99.5
Ligia oceanicaz‰
(Oniscidea: Ligiidae)
(Kiel)
Oniscus aselluswz
(Oniscidea: Oniscidae)
(Kiel)
3316
17
126Oa-2
Mollicutes
‘Candidatus Hepatoplasma crinochetorum’
(AY500250)
‘Candidatus Hepatoplasma crinochetorum’
(AY500250)
‘Candidatus Hepatoplasma crinochetorum’
(AY500250)
99.2
4 Oa-12
Mollicutes
98.7
2 Oa-13
Mollicutes
98.7
?Freshwater species.
wFeeds on terrestrial detritus.
zSemiterrestrial species.
‰Feeds on microalgae and macroalgal detritus.
zTerrestrial species.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
146
Y. Wang et al.

Page 7

shaped cells (0.5mm wide and 1.0–1.3mm long) with den-
sities ranging from 1.2?106to 2.9?106cells per animal
(n=6) and long rod-shaped cells (0.7mm wide and
1.8–2.7mm long) with densities ranging between 0.3?106
and 1.7?106cells per animal (n=4) were observed in
individuals collectedin
(0.3–0.7mm wide) with densities ranging from 1.6?106to
1.9?106cells per animal (n=2) and short rod-shaped cells
in chains (0.4mm wide and 0.4–0.6mm long) with densities
of 0.7?106cells per animal (n=1) were observed in
different individuals collected near Kiel.
A clone library of 16S rRNA genes representing hepato-
pancreatic bacteria of a pooled population of eight indivi-
duals collected in Kiel contained three different ribotypes
(Table 3). Sequencing of representative clones showed that
76% of the clones in the clone library were virtually identical
in sequence (99.7% similarity) and were related (496%
similarity) to Rickettsiella grylli (Vago & Martoja, 1963;
Roux et al., 1997), whereas the rest were virtually identical
to a free-living Burkholderia species in the Burkholderia
glathei subgroup (Table 3).
For Asellus aquaticus collected in Lake Neuw¨ uhren
(Pl¨ on), 16S rRNA genes were successfully amplified only
with the alternative primer pair 63f/1387r (Table 1). The
corresponding clone library, representing hepatopancreatic
bacteria of a pooled population of 15 individuals, contained
two different ribotypes closely related either to Aeromonas
sobria or to Rhodobacter species (Table 3).
Pl¨ on.Sphere-shaped cells
Transmission of symbionts in the terrestrial
Porcellio scaber
Whereas all mother isopods were screened positive for
‘Candidatus Hepatoplasma’, no symbiotic bacteria were
detected by DAPI/FISH staining in the homogenates of 100
P. scaber embryos obtained from 10 mothers, either in the
sterile treatment or the control group. The absence of
hepatopancreatic bacteria was corroborated by the lack of
PCR products from DNA extracts of embryos (n=30 each
from 10 mothers from each group) from both control and
treatment groups as well as of juveniles from the treatment
group. By contrast, an amplicon of 1162bp was obtained
from DNA extracts of juveniles from the control group,
indicating the presence of ‘Candidatus Hepatoplasma crino-
chetorum’.
Data fromwhole-cell hybridization and PCR were further
confirmed by the results obtained with thin sections of
whole embryos and juveniles. In situ hybridization with
probes EUB338 and PsSym352 did not detect any bacteria
in embryos from both control and treatment groups or in
juveniles of the treatment group, whereas hybridization
signal with both probes was observed in the hepatopancreas
of juveniles from the control group. The prevalence of
bacterial symbionts in juveniles of the control group, how-
ever, waslow(juvenile stage 1, o20%; stage 2, o30%) and
varied between different cohorts (juvenile stage 1, 0–20%;
stage 2, 0–30%).
Table 4. Prevalence of hepatopancreatic bacteria in various populations of terrestrial isopods (Oniscidea) of different geographical origin, and
frequency of ‘Candidatus Hepatoplasma crinochetorum’ and ‘Candidatus Hepatincola porcellionum’, determined by whole-cell hybridization with
specific oligonucleotide probes
Isopod speciesGeographical origin Habitat
N
Prevalence?
(%)Morphotypew
Frequency (%)z
HcHp
Porcellio scaber
Kiel
Kiel
K¨ oln, Germany
K¨ oln, Germany
Vancouver Island, Canada (BC)
Haines Island, Canada (BC)
Kiel
K¨ oln, Germany
K¨ oln, Germany
Poitiers, France
Kiel
Kiel
Kiel
Vancouver Island, Canada (BC)
Woodland
Artificial salt marsh
Woodland
Grassland
Grassland
Coastal grassland
Woodland
Woodland
Grassland
Woodland
Woodland
Grassland
Grassland
Sandy beach
22
70
100.0
100.0
100.0
100.0
25.0
13.5
68.6
71.4
100.0
90.0
62.5
10.0
80.0
25.0
S, C
S, C
S, C
S, C
S, C
S, C
S, C, R
S, C
S, C
S
S
S
S, C
S, R
59.1
92.8
88.9
85.7
20.8
8.1
45.7
28.5
80.0
90.0
62.5
10.0
60.0
18.8
40.9
7.2
11.1
14.3
4.2
5.4
8.6
42.9
20.0
0
0
0
20.0
0
9
15
24
37
35
14
11
10
13
11
Oniscus asellus
Philoscia muscorum
Armadillidium vulgare
Trachelipus rathkii
Alloniscus perconvexus
8
16
n, number of samples investigated.
?Symbionts detected by DAPI staining.
wMorphotypes: C, curved rods; R, straight rods; S, spheres.
zSymbionts hybridized with oligonucleotide probes PsSym352 and PsSym120, respectively. Hc, ‘Candidatus Hepatoplasma crinochetorum’; Hp,
‘Candidatus Hepatincola porcellionum’.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
147
Bacterial symbionts in isopods

Page 8

Discussion
Symbiont--host relationships
The results of this study support the hypothesis that
hepatopancreatic bacterial symbionts of isopods have been
acquired simultaneously with numerous adaptations that
allowed the colonization of land, as discussed by Zimmer
et al. (2002). No bacteria or bacterial DNAwere found in the
hepatopancreas of the marine Idotea balthica (Valvifera:
Idoteidae). Having thoroughly screened a total of four
species of the marine suborders Valvifera and Sphaeromati-
dea (Zimmer et al., 2001, 2002; S. Fraune & M. Zimmer,
unpublished data), we suggest that these marine isopods –
although living in a microbe-rich environment with a high
riskof bacterial infection – do not harbour hepatopancreatic
bacteria. All other isopod species investigated contained
bacteria in their midgut glands. The presence and identity
of hepatopancreatic bacteria coincided nicely with the
phylogenetic position of their isopod hosts (Fig. 2).
The reasons for the exclusion of bacteria from the
hepatopancreas of marine isopods are not clear. Sleeter
et al. (1978) proposed the production of antibiotics in the
gut of the wood-boring Limnoria tripunctata, simply be-
cause they could not find bacteria inside the gut lumen
[although Zachary & Colwell (1979) found gut microorgan-
isms in this species]. It is possible that antibiotics of
endogenous or external origin prevent the colonization of
the midgut glandsbybacteria in marineisopods. Hellio et al.
(2000) found antibiotic agents in nine of 16 species of
marine macroalgae, and such compounds might still be
active in the guts of their consumers (namely isopods or
amphipods), preventing bacterial colonization of the hepa-
topancreas. In such a scenario, the acquisition of hepato-
pancreatic symbionts in other isopod species (as shown
herein) would simply be the consequence of an evolutionary
change in feeding habit, replacing a diet of fresh algae that is
potentially rich in antibiotics (Hellio et al., 2000) with
detritus or microbial epibionts, lacking the antibiotic agents
of macroalgal origin. The former is the major food source of
Idotea balthica and other Valvifera and Sphaeromatidea,
while the latter is the preferred food source of Asellus
aquaticus (see below), Ligia oceanica and other oniscid
isopods.
Plante et al. (1990), however, proffer a different explana-
tion, emphasizing the importance of the microhabitat in
being a successful host to microbial endosymbionts. While
the gut lumen of marine invertebrates exhibits conditions
virtually identical with the external environment in terms of
ionic and osmotic levels, this is not the case in freshwater
invertebrates. The gut of terrestrial invertebrates provides an
aquatic habitat in a terrestrial environment. Thus, the
significance of microbial gut symbionts can be explained
from different points of view: (1) for marine microorgan-
isms, it is not advantageous to colonize the gut of an
invertebrate instead of living in sea water, except for being
protected from other consumers, whereas the gut of a
terrestrial invertebrate grants a more favourable environ-
ment than soil or leaf litter; and (2) for terrestrial inverte-
brates, gut symbionts in a stable environment are more
favourable partners to rely on in terms of facilitation in a
hostile environment than soil- or litter-colonizing bacteria
that inhabit a variable milieu, while this difference is
thought to be insignificant for marine invertebrates (Harris,
1993).
Our present results, together with a previous study by
Zimmer & Bartholm´ e (2003), clearly prove the presence of
bacterial symbionts in the hepatopancreas of Asellus aqua-
ticus. Considering the similar nutritive ecology of freshwater
and terrestrial isopods, both being detritivores that feed on
leaf litter, the presence of bacteria in the midgut glands may
reflect a convergent adaptation to the same food source in
different taxonomic branches of isopods (cf. Zimmer &
Bartholm´ e, 2003). On the other hand, Asellota are closely
related to, and may even be the sister group of, Oniscidea
(cf. Fig. 2). Thus, we may propose a common marine
ancestorof these taxa to have acquired the ability to harbour
bacterial symbionts in the midgut glands by feeding on food
sources other than macroalgae (see above). This evolution-
ary achievement of hepatopancreatic symbionts may then
have been a prerequisite for the utilization of terrestrial food
Fig. 2. Phylogenetic relationship of isopod species studied herein (based
on Schmidt & W¨ agele, 2001), overlain with the identity of hepatopan-
creatic bacteria in the respective species. . . . .: no bacteria, ....: unspecific
symbiosis with various bacteria;–: symbiosis with bacteria of the genus
Pseudomonas (proposed for Crinocheta based on preliminary data); - - -:
symbiosis with ‘Candidatus Hepatoplasma’, - . - . -: symbiosis with
‘Candidatus Hepatincola’; ?: the phylogenetic relationship between
Valvifera, Asellota and Oniscidea is currently debated controversially (cf.
Schmalfuss, 1989; W¨ agele, 1989; Brusca & Wilson, 1991; Tabacaru &
Danielopol, 1999).
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
148
Y. Wang et al.

Page 9

sources (Zimmer et al., 2001), be it in freshwater or
terrestrial habitats. However, hepatopancreatic bacteria in
A. aquaticus are not only phylogenetically diverse (two or
three phylotypes from different proteobacterial lineages),
but also differ between isopod populations collected in
geographically close sites (Pl¨ on and Kiel, Germany). More-
over, the symbionts we detected in A. aquaticus are not
related to those of terrestrial isopods (Wang et al., 2004a,b),
indicating that the midgut glands of terrestrial and fresh-
water isopods harbour different bacterial species with pre-
sumably different relationships to their hosts.
In contrast to A. aquaticus, the number of potential
hepatopancreatic symbionts appears to be limited to a few
bacterial species in Oniscidea. We could unambiguously
show that various oniscid isopod species of the Crinocheta
(see Fig. 2) from different regions and habitats consistently
harboured one of two different bacterial symbionts. ‘Candi-
datus Hepatoplasma crinochetorum’ and ‘Candidatus He-
patincola porcellionum’ were present in a total of six and
three crinochete isopod species from European and North
American locations, respectively. This strongly indicates that
symbiotic associations with these two bacterial symbionts
are ubiquitous among the Crinocheta (for the semiterres-
trial genus Ligia, see below). The high incidence (up to 90%)
of aposymbiotic individuals, however, indicates a facultative
rather than an obligate association between hepatopancrea-
tic symbionts and isopods.
In contrast to the crinochete isopod species tested in the
present study, the semiterrestrial Ligia oceanica harboured
symbionts of the genus Pseudomonas. Rod-shaped bacteria
were observed also in some individuals of Porcellio scaber,
Oniscus asellus and Alloniscus perconvexus (present study;
Hopkin & Martin, 1982; Wood & Griffith, 1988; Ullrich
et al., 1991; Zimmer et al., 2002); based on FISH, we
tentatively classified them as members of the genus Pseudo-
monas (S. Fraune & M. Zimmer, unpublished data).
From our present results on bacterial symbionts in
Oniscidea, we conclude that the colonization of supralittoral
habitats by the common ancestor of all terrestrial isopods
was accompanied by the acquisition of bacterial symbionts.
Although a more detailed assay would be required to decide
upon this issue unambiguously, we propose that these initial
hepatopancreatic symbionts were ancestors of Pseudomonas
sp. that are still harboured in the semiterrestrial genus Ligia,
representing an evolutionary prototype of Oniscidea
(Schmalfuss, 1978; Carefoot & Taylor, 1995), as well as
presumably in at least some crinochete species (see above).
These initial symbionts of Oniscidea seem to have been
supplemented during the subsequent phylogenetic radiation
of terrestrial isopods by new symbionts (‘Candidatus Hepa-
toplasma’ and ‘Candidatus Hepatincola’), which are cur-
rently present in various species of crinochete terrestrial
isopods (cf. Fig. 2).
Such an evolutionary takeover of a host has recently been
demonstrated experimentally in aphids (Hemiptera: Aphi-
dina), where the primary symbiont, Buchnera aphidicola, is
being replaced by secondary symbionts (Gammaproteobac-
teria) (Koga et al., 2003). Similarly, tsetse flies (Glossina spp.;
Diptera: Glossinidae) may lodge a commensal, Sodalis
glossinidius (Gammaproteobacteria), as secondary symbiont
that belongs to the same family as the primary symbiont,
Wigglesworthia glossinidia (Dale & Maudlin, 1999). In
dryophtherid beetles (Coleoptera: Curculionoidea) even
three lineages of Enterobactericeae exist that colonized their
host in independent evolutionary steps (cf. Nardon et al.,
2003).
Applying a model by Doebeli & Dieckmann (2000), we
hypothesize that either the initial acquisition of Pseudomo-
nas sp. or the subsequent symbiotic takeover mayhave led to
the branching and later speciation within the Oniscidea, as
has been discussed by Buckling & Rainey (2002) in broader
context. Leonardo & Muiru (2003) recently presented
evidence for nutritional specialization being determined by
the identity of facultative bacterial symbionts in aphids.
Hepatopancreatic bacteria in both terrestrial (cf. Zimmer,
2002) and aquatic isopods (Zimmer & Bartholm´ e, 2003) are
thought to contribute to the utilization of low-quality food
sources. Notably, members of the proteobacterial genera
Burkholderia, Aeromonas and Pseudomonas, close relatives of
the symbionts of A. aquaticus and L. oceanica, are capable of
degrading plant polymers, phenolic compounds or polycyc-
lic aromatic hydrocarbons. Recently, a symbiotic Pseudomo-
nas sp. in the gut of Tetraponera ants (van Borm et al., 2002)
was found to be involved in nitrogen fixing. Although
nitrogen is abundant in fresh seaweeds, it is significantly
reduced in decaying seaweed detritus, one of the major food
sources of Ligia, and nitrogen-fixing hepatopancreatic sym-
bionts mayhave helped the semiterrestrial L. oceanica andits
evolutionary kin in colonizing terrestrial habitats. In the
case of the symbionts of terrestrial isopods, however, the
next relatives (distantly related members of the Entomoplas-
matales and Ricketsiales) do not offer any clues with respect
to their possible function in the symbiosis (Wang et al.,
2004a,b). The nature of these associations and their sig-
nificance for their hosts remain to be elucidated.
Transmission of symbionts
The hepatopancreatic symbionts of terrestrial isopods ap-
pear to be transmitted either horizontally among syntopic
conspecifics or through the environment. Symbiotic bacter-
ia were not detected in soils and leaf litter samples by FISH
(data not shown), but the number of symbionts in the
environment – and that of the symbionts necessary success-
fully to establish the symbiosis in the juvenile host – may be
rather low.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
149
Bacterial symbionts in isopods

Page 10

In the offspring of P. scaber raised in the laboratory under
sterile conditions, neither embryos nor juveniles harboured
any hepatopancreatic bacteria. However, if kept under
nonsterile conditions, bacteria were detected in the midgut
glands of juveniles 1 week after hatching. Since we did not
surface-sterilize eggs in the brood pouch, we cannot exclude
maternal smearing of eggs either inside, or prior to their
transport into, the brood pouch. However, if this played a
role in symbiont transmission, we would expect embryos
and juveniles under sterile conditions to be infected with
symbionts, too. As clearly shown by the present results, this
is not the case.
The transmission of symbionts is critical in mutualistic
symbioses, both for obligatory symbionts and for their host.
It is only through vertical transmission that a host can
ensure that none of its progeny will stay aposymbiotic, and
many obligate symbioses are based on this mechanism.
Nevertheless, many mutualists still rely on horizontal trans-
mission (discussed in Wilkinson & Sherratt, 2001), and
horizontal transfer of symbionts seems to be the rule in
sexually reproducing animals with symbionts that are not
harboured inside the reproductive tract (Douglas, 1995):
larvae of pony fish (Leiognathus nuchalis; Perciformes:
Leiognathidae) are aposymbiotic when they hatch and
become infected by luminescent bacteria at an age of at least
45 days (Wada et al., 1999). Similarly, aposymbiotic juve-
niles of lucinid mussels acquire sulfide-oxidizing intracellu-
lar gill symbionts (Gammaproteobacteria) horizontally.
Given that competition between different symbionts may
exert negative effects on the host (discussed in Koga et al.,
2003), it seems advantageous to the host to keep the
diversity of symbionts low. Again, the best way to achieve
this aim is controlled vertical transmission, but even those
systems dependent on environmental transmission have
developed strategies to master this problem. The flatworm
Convoluta roscoffensis harbours endosymbiotic algae of the
genus Tetraselmis, but host individuals differ in what species
of Tetraselmis they accommodate. Aposymbiotic juveniles
take up algae while feeding and reject all but one species
(Douglas, 1980). A similar transmission mechanism, with
bacteria being ingested along with the food, has been
proposed for the sponge Halichondria panicae and its
symbionts of the genus Rhodobacter (Alphaproteobacteria)
(Althoff et al., 1998; discussed in Stackebrandt & Pukall,
1999; M¨ uller, 1999).
Horizontal transfer of symbionts via faeces or litter, as
suggested by our findings in P. scaber (see above), seems to
be inefficient, since it apparently does not ensure that all
offspring gainaccessto (thecorrect) symbionts,indicated by
the often low prevalence of symbionts in the hosts tested
herein. Nonetheless, despite the lack of detection of the
symbionts outside of their hepatopancreatic habitat, ‘Can-
didatus Hepatincola’ and ‘Candidatus Hepatoplasma’ are
present in 10–100% of individuals tested, suggesting that
(1) they are common enough in the environment to ensure
frequent infection of hosts, and (2) at least one of the
symbiotic partners invests in finding, or being found by, an
associate. Since the prevalence of symbiotic bacteria is
mainly affected by both transmission rate and fitness effects
for the host, and transmission rate is potentially low owing
to the environmental transmission route, we assume posi-
tiveeffects of this symbiont to its host, but this remains to be
tested.
Acknowledgements
This study was supported by the Deutsche Forschungsge-
meinschaft, grant Zi 633/3-112. We thank Ulrich Stingl
(Konstanz) for valuable discussion, Malte Mews (Kiel) for
collecting and culturing I. balthica and A. aquaticus, and
Karen A. Brune for proofreading the manuscript.
References
Aksoy S (2003) Control of tsetse flies and trypanosomes using
molecular genetics. Vet Parasitol 115: 125–145.
Alm EW, Oerther DB, Larsen N, Stahl DA & Raskin L (1996) The
oligonucleotide probe database. Appl Environ Microbiol 62:
3557–3559.
Althoff K, Sch¨ utt C, Steffen R, Batel R & M¨ uller WEG (1998)
Evidence for a symbiosis between bacteria of the genus
Rhodobacter and the marine sponge Halichondria panicea:
harbor also for putatively toxic bacteria? Mar Biol 130:
529–536.
Altschul SF, Madden TL,Sch¨ affer AA, Zhang J, ZhangZ, Miller W
& Lipman DJ (1997) Gapped BLASTand PSI-BLAST: a new
generation of protein database search programs. Nucleic Acids
Res 25: 3389–3402.
Amann RI, Krumholz L & Stahl DA (1990) Fluorescent-
oligonucleotide probing of whole cells for determinative,
phylogenetic, and environmental studies in microbiology. J
Bacteriol 172: 762–770.
Braun-Howland EB, Vescio PA & Nierzwicki-Bauer SA (1993)
Use of a simplified cell blot technique and 16S rRNA-directed
probes for identification of common environmental isolates.
Appl Environ Microbiol 59: 3219–3224.
Brosius J, Dull TJ, Sleeter DD & Noller HF (1981) Gene
organization and primary structure of a ribosomal RNA
operon from Escherichia coli. J Mol Biol 148: 107–127.
Brusca RC & Wilson GDF (1991) A phylogenetic analysis of the
isopoda with some classificatory recommendations. Mem
Queensland Mus 31: 143–204.
Buckling A & Rainey PB (2002) The role of parasites in sympatric
and allopatric host diversification. Nature 420: 496–499.
Carefoot TH & Taylor BE (1995) Ligia: a prototypal terrestrial
isopod. Crustacean Issues 9: Terrestrial Isopod Biology (Alikhan
MA, ed), pp. 47–60. Balkema, Rotterdam.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
150
Y. Wang et al.

Page 11

Cary SC & Giovannoni SJ (1993) Transovarial inheritance of
endosymbiotic bacteria in clams inhabiting deep-sea
hydrothermal vents and cold seeps. Proc Natl Acad Sci USA 90:
5695–5699.
Dale C & Maudlin I (1999) Sodalis gen. nov. and Sodalis
glossinidius sp. nov., a microaerophilic secondary
endosymbiont of the tsetse fly Glossina morsitans morsitans.
Int J Syst Bacteriol 49: 267–275.
Doebeli M & Dieckmann U (2000) Evolutionary branching and
sympatric speciation caused by different types of ecological
interactions. Am Nat 156: S77–S101.
Donadey D & Besse G (1972) E´tude histologique, ultrastructurale
et exp´ erimentale des caecums digestifs de Porcellio dilatatus et
Ligia oceanica (Crustacea, Isopoda). Tethys 4: 145–162.
Douglas AE (1980) Establishment of the symbiosis in Convoluta
roscoffensis. J Mar Biol Assoc UK 63: 419–434.
Douglas AE (1995) The ecology of symbiotic micro-organisms.
Adv Ecol Res 26: 69–103.
Friedrich MW, Schmitt-Wagner D, Lueders T & Brune A (2001)
Axial differences in community structure of crenarchaeota and
euryarchaeota in the highly compartmentalized gut of the soil-
feeding termite Cubitermes orthognathus. Appl Environ
Microbiol 67: 4880–4890.
Hames CAC & Hopkin SP (1989) The structure and function of
the digestive system of terrestrial isopods. J Zool Lond 217:
599–627.
Harris JM (1993) The presence, nature, and role of gut microflora
in aquatic invertebrates: a synthesis. Microb Ecol 25: 195–231.
Hellio C, BremerG, Pons AM, Le Gal Y & Bourgougnon N (2000)
Inhibition of the development of microorganisms (bacteria
and fungi) by extracts of marine algae from Brittany, France.
Appl Microbiol Biotechnol 54: 543–549.
Henckel T, Friedrich M & Conrad R (1999) Molecular analyses of
the methane-oxidizing microbial community in rice field soil
by targeting the genes of the 16S rRNA, particulate methane
monooxygenase, and methanol dehydrogenase. Appl Environ
Microbiol 65: 1980–1990.
Herre EA, Knowlton N, Mueller UG & Rehner SA (1999) The
evolution of mutualisms: exploring the paths between conflict
and cooperation. Trends Ecol Evol 14: 49–53.
Hopkin SP & Martin MH (1982) The distribution of zinc,
cadmium, lead and copper within the hepatopancreas of a
woodlouse. Tissue Cell 14: 703–715.
Koga R, Tsuchida T & Fukatsu T (2003) Changing partners in an
obligate symbiosis: a facultative endosymbiont can
compensate for loss of the essential endosymbiont Buchnera in
an aphid. Proc Roy Soc Lond B 270: 2543–2550.
Kumar S, Tamura K & Nei M (2004) MEGA3: integrated software
for molecular evolutionary genetics analysis and sequence
alignment. Brief Bioinform 5: 150–163.
Leonardo TE & Muiru GT (2003) Facultative symbionts are
associated with host plant specialization in pea aphid
populations. Proc Roy Soc Lond B 270: S209–S212.
Manz W, Amann R, Ludwig W, Wagner M & Schleifer KH (1992)
Phylogenetic oligodeoxynucleotide probes for the major
subclasses of Proteobacteria: problems and solutions. System
Appl Microbiol 15: 593–600.
Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ
& Wade WG (1998) Design and evaluation of useful
bacterium-specific PCR primers that amplify genes coding for
bacterial 16S rRNA. Appl Environ Microbiol 64: 795–799.
McFall-Ngai MJ (2002) Unseen forces: the influence of bacteria
on animal development. Dev Biol 242: 1–14.
M¨ uller WEG (1999) 16S rRNA sequences as diagnostic tools to
elucidate potential symbiotic relationships between bacteria
and the marine sponge Halichondria panicea: reply to
Stackebrandt and Pukall (Mar Biol 133: 159–161). Mar Biol
134: 213–215.
Myers RM, Maniatis T & Lerman LS (1987) Detection and
localization of single base changes by denaturing gradient gel
electrophoresis. Methods Enzymol 155: 501–527.
Nardon P, Charles H, Delobel B, Lefevre C & Heddi A (2003)
Symbiosis in the dryophthoridae weevils (Coleoptera,
Cuculionoidea): morphological variability of symbiotic
intracellular bacteria. Symbiosis 34: 231–251.
Plante CJ, Jumars PA & Baross JA (1990) Digestive associations
between marine invertebrates and bacteria. Annu Rev Ecol Syst
21: 93–127.
Roux V, Bergoin M, Lamaze N & Raoult D (1997) Reassessment
of the taxonomic position of Rickettsiella grylli. Int J Syst
Bacteriol 47: 1255–1257.
Schmalfuss H (1978) Ligia simoni: a model for the evolution of
terrestrial isopods. Stuttg Beitr Natkde 317: 1–5.
Schmalfuss H (1989) Phylogenetics in Oniscidea. Monit Zool Ital
(NS) Monogr 4: 3–27.
Schmidt C & W¨ agele J (2001) Morphology and evolution of
respiratory structures in the pleopod exopodites of terrestrial
isopoda (Crustacea, Isopoda, Oniscidea). Acta Zool 82:
315–330.
Sleeter TD, Boyle PJ, Cundell AM & Mitchell R (1978)
Relationships between marine microorganisms and the wood-
boring isopod Limnoria tripunctata. Mar Biol 45: 329–336.
Stackebrandt E & Pukall R (1999) Deriving taxonomic decisions
from 16S rDNA: a case study–Response to Althoff et al. (Mar
Biol 130: 529–536). Mar Biol 130: 529–536.
Tabacaru I & Danielopol DL (1999) Contribution a la
connaissance de la phylogn´ enie des isopoda (Crustacea). Vie et
Milieu 49: 163–176.
Thompson JD, Higgins DG & Gibson TJ (1994) CLUSTALW:
improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap
penalties and weight matrix choice. Nucleic Acids Res 22:
4673–4680.
Ullrich B, Storch V & Schairer H (1991) Bacteria on the food, in
the intestine and on the faeces of the woodlouse Oniscus asellus
(Crustacea, Isopoda). Pedobiologia 34: 41–51.
Vago C & Martoja R (1963) Rickettsiosis in the Gryllidae
(Orthoptera). C R Hebd Seances Acad Sci 256: 1045–1047.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
151
Bacterial symbionts in isopods

Page 12

van Borm S, Buschinger A, Boomsma JJ & Billen J (2002)
Tetraponera ants have gut symbionts related to nitrogen-fixing
root-nodule bacteria. Proc Biol Sci 269: 2023–2027.
Wada M, Azuma N, Mizuno N & Kurokura H (1999) Transfer of
symbiotic luminous bacteria from parental Leiognathus
nuchalis to their offspring. Mar Biol 135: 683–687.
W¨ agele J (1989) Evolution und phylogenetisches System der
Isopoda. Zoologica 47: 1–226.
Wagner M, Amann R, Lemmer H & Schleifer KH (1993) Probing
activated sludge with oligonucleotides specific for
proteobacteria: inadequacy of culture-dependent methods for
describing microbial community structure. Appl Environ
Microbiol 59: 1520–1525.
Wallner G, Amann R & Beisker W (1993) Optimizing fluorescent
in situ hybridization with rRNA-targeted oligonucleotide
probes for flow cytometric identification of microorganisms.
Cytometry 14: 136–143.
Wang Y, Stingl U, Anton-Erxleben F, Geisler S, Brune A &
Zimmer M (2004a) ‘Candidatus Hepatoplasma
crinochetorum,’ a new, stalk-forming lineage of Mollicutes
colonizing the midgut glands of a terrestrial isopod. Appl
Environ Microbiol 70: 6166–6172.
Wang Y, Stingl U, Anton-Erxleben F, Zimmer M & Brune A
(2004b) ‘Candidatus Hepatincola porcellionum’ gen. nov., sp.
nov., a new, stalk-forming lineage of Rickettsiales colonizing
the midgut glands of a terrestrial isopod. Arch Microbiol 181:
299–304.
Weisburg WG, Barns SM, Pelletier DA & Lane DJ (1991) 16S
ribosomal DNA amplification for phylogenetic study. J
Bacteriol 173: 697–703.
Wilkinson DM & Sherratt TN (2001) Horizontally acquired
mutualisms, an unsolved problem in ecology? Oikos 92:
377–384.
Wood S & Griffith BS (1988) Bacteria associated with the
hepatopancreas of the woodlice Oniscus asellus and Porcellio
scaber (Crustacea, Isopoda). Pedobiologia 31: 89–94.
Zachary A & Colwell RR (1979) Gut-associated microflora of
Limnoria tripunctata in marine creosote-treated wood pilings.
Nature 282: 716–717.
Zimmer M (1999) The fate and effects of ingested hydrolysable
tannins in Porcellio scaber. J Chem Ecol 25: 611–628.
Zimmer M (2002) Nutrition in terrestrial isopods (Isopoda:
Oniscidea): an evolutionary-ecological approach. Biol Rev 77:
455–493.
Zimmer M & Bartholm´ e S (2003) Bacterial endosymbionts in
Asellus aquaticus (Isopoda) and Gammarus pulex
(Amphipoda), and their contribution to digestion. Limnol
Oceanogr 48: 2208–2213.
Zimmer M & Topp W (1998a) Microorganisms and cellulose
digestion in the gut of Porcellio scaber (Isopoda: Oniscidea). J
Chem Ecol 24: 1395–1408.
Zimmer M & Topp W (1998b) Nutritional biology of terrestrial
isopods (Isopoda: Oniscidea): copper revisited. Isr J Zool 44:
453–462.
Zimmer M, Danko JP, Pennings SC, Danford AR, Ziegler A,
Uglow RF & Carefoot TH (2001) Hepatopancreatic
endosymbionts in coastal isopods (Crustacea: Isopoda), and
their contribution to digestion. Mar Biol 138: 955–963.
Zimmer M, Danko JP, Danford AR, Carefoot TH, Ziegler A &
Uglow RF (2002) Cellulose digestion and phenol oxidation in
coastal isopods (Custacea: Isopoda). Mar Biol 140: 1207–1213.
FEMS Microbiol Ecol 61 (2007) 141–152
c ?2007 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
152
Y. Wang et al.